CN117568507A - Rubber tree germplasm resource typing SNP locus, primer and application thereof - Google Patents

Abstract

The invention discloses a rubber tree germplasm resource typing SNP locus, a primer and application thereof. According to the invention, through constructing rubber tree genetic maps of different stem circumferences, locating QTL intervals related to the stem circumferences, screening sites with significant differences exist in the intervals, developing significant difference SNP sites and detection primer sets thereof which can be used for typing rubber tree germplasm resources, and typing and verifying the SNP sites by utilizing 2 batches of different rubber tree germplasm resources, thereby screening and obtaining SNP molecular markers which can be more accurately and rapidly typed, and being used for identification of the rubber tree germplasm resources and molecular assisted breeding. Meanwhile, the invention also provides a method for breeding the rubber tree germplasm resources with different stem circumferences or typing the rubber tree germplasm resources, which can more rapidly and accurately conduct typing, solves the problem of inaccurate analysis of the stem circumference characteristics of the rubber tree, shortens the screening period of the rubber tree germplasm resources and provides technical support for identification and molecular assisted breeding of the rubber tree germplasm resources.

Description

Rubber tree germplasm resource typing SNP locus, primer and application thereof

Technical Field

The invention belongs to the technical field of biological molecules. More particularly, relates to a rubber tree germplasm resource typing SNP locus, and a primer and application thereof.

Background

The rubber tree (Hevea brasiliensis) is a tree species of Euphorbiaceae (Euphobiaceae) rubber tree genus (Hevea) with a rainforest for years, is native to Brazilian Amazon river basin in south America, and the secretion is natural rubber, and is widely applied to agriculture, national defense, transportation and other aspects as well as four industrial raw materials in the world, thereby playing an irreplaceable role in national economy. Rubber tree has a service life of about 30-40 years, rubber tapping is started after 7-8 years of planting, the non-production period is longer, and the early planting cost is higher. The stem circumference of the rubber tree is a main index for measuring the growth vigor and wood volume of the rubber tree, and is also an important index for judging whether the rubber tree is cut or not in the planting production technology, so that the time of a non-production period can be effectively reduced, the cut is advanced, and more income is created for farmers.

The traditional breeding means of the rubber tree is cross breeding, but the breeding period is longer, and 30 years are required for average breeding of one strain, so that the development of the rubber industry is severely restricted. With the progress of modern molecular biotechnology, molecular marker assisted selective breeding can promote the rubber tree breeding process to a certain extent. The single nucleotide polymorphism (SNP, single nucleotide polymorphisms) markers are densely distributed on chromosomes, have the advantages of rich polymorphism, good genetic stability and the like, are mostly used for researches such as species genetic diversity analysis, core germplasm library construction, genetic map construction, variety identification and the like, and are important markers for molecular breeding application. At present, a SNP marker closely related to the stem circumference of a rubber tree is disclosed in the prior art, the base of a locus is G or T, the stem circumference of the rubber tree with the genotype of heterozygous GT or homozygous TT at the locus is obviously thicker than the stem circumference of the rubber tree with the genotype of homozygous GG at the locus, but when the genotype of the locus is GT or TT, the result cannot be judged; meanwhile, the invention can be determined only by carrying out sequencing, and the conventional laboratory can not realize the sequencing; and the stem circumference of the rubber tree is a character controlled by multiple genes, and a plurality of markers are usually required to be subjected to typing verification at the same time so as to have higher confidence. In order to improve the molecular marker assisted breeding efficiency of the rubber tree, the molecular marker assisted selection work is further developed, more molecular markers are developed, the accuracy of molecular assisted selection is improved, and technical support is provided for carrying out rubber tree germplasm resource identification and molecular assisted breeding on SNP molecular markers which can be accurately used for typing.

Disclosure of Invention

The invention aims to overcome the defects and shortcomings of low accuracy, complex method and the like of the traditional SNP marker related to the stem circumference of a rubber tree, and provides a rubber tree germplasm resource typing SNP locus, a primer and application thereof.

The first object of the invention is to provide a rubber tree germplasm resource typing SNP locus.

A second object of the present invention is to provide a specific primer set for detecting SNP sites.

The third object of the invention is to provide the application of the SNP locus and the primer set thereof for typing the germplasm resources of the rubber tree.

The fourth object of the invention is to provide a kit for detecting the circumference of the stem of the rubber tree.

It is a fifth object of the present invention to provide a method for identifying the circumference of a rubber tree.

The sixth object of the invention is to provide a method for breeding rubber tree germplasm resources or rubber tree germplasm resources typing of different stem circumferences.

The above object of the present invention is achieved by the following technical scheme:

according to the invention, through phenotype analysis of stem boundaries of different rubber tree germplasm, high-throughput sequencing analysis is adopted to construct a genetic map of the stem boundary character of the rubber tree, a QTL interval related to the stem boundary is positioned, a site with obvious difference exists in a screening interval, SNP molecular markers are developed, and then the stem boundary phenotype data are obtained, so that obvious different SNP sites capable of distinguishing different stem boundaries of the rubber tree are obtained, and the problem of low accuracy of the SNP markers related to the stem boundaries of the existing rubber tree is solved; the identified significant difference SNP locus for typing of the rubber tree germplasm resources and the detection primer group thereof can be more accurate and can be used for typing rapidly and are used for identifying the rubber tree germplasm resources and breeding in a molecular auxiliary way.

The invention provides a rubber tree germplasm resource typing SNP locus, which is positioned at 28806263bp and/or 60519917bp loci of No. 14 chromosomes of a rubber tree, and has the specific corresponding relation that: the 28806263bp locus is a JC09 mark, the 60519917bp locus is a JC20 locus, the JC09 locus is a base A or G, and the JC20 locus is a base C or T.

The invention provides a specific primer group for the SNP locus, which comprises the following primers for detecting the JC09 locus: primer 1: GAAGGTGACCAAGTTCATGCTACCTGGAATTAATTACCAGTTCCA, primer 2: GAAGGTCGGAGTCAACGGATTACCTGGAATTAATTACCAGTTCCG; the primers for detecting JC20 locus are as follows: primer 1: GAAGGTGACCAAGTTCATGCTTCTAACAATTTTCATACTTCCCTCCC, primer 2: GAAGGTCGGAGTCAACGGATTTCTAACAATTTTCATACTTCCCTCCT.

Further, the primer for detecting JC09 site further comprises: primer 3: TCCGGTCTCGACTAGTTTGTTTAG; the primer for detecting JC20 locus further comprises: primer 3: GATTTTCCTTGATGCACACTCACA.

The invention provides application of the SNP locus in identifying rubber tree stem circumference, rubber tree molecular breeding or rubber tree germplasm resource typing.

The invention provides application of the SNP locus or the specific primer group of the SNP locus in breeding rubber tree germplasm resources of different stem circumferences or preparing a kit for detecting the stem circumference of the rubber tree.

The invention provides a kit for detecting the stem circumference of a rubber tree, which contains the specific primer group of the SNP locus.

Preferably, the kit further contains a sample DNA extraction reagent, and a PCR amplification detection reagent.

Meanwhile, the invention also provides a method for identifying the stem circumference of the rubber tree, which is used for detecting whether the 14 th chromosome (chromosome CM 021239.1) of the plant to be detected contains the SNP locus JC09 and/or JC20 and detecting the genotype of the SNP locus JC 09: the stem circumference of the rubber tree germplasm with the genotype of AA is larger than that of the rubber tree germplasm with the genotype of AG; detecting the genotype of the SNP locus JC 20: the stem circumference of the rubber tree germplasm with the genotype TT is larger than that of the rubber tree germplasm with the genotype CC.

The invention also provides a method for breeding rubber tree germplasm resources with different stem circumferences or typing the rubber tree germplasm resources, which comprises the following steps:

s1, extracting DNA of a sample to be detected;

s2, taking the sample extracted in the step S1 as a template, and adopting a specific primer group of the SNP locus to carry out qPCR detection;

preferably, the specific primer set comprises a primer that detects JC09 locus: primer 1: GAAGGTGACCAAGTTCATGCTACCTGGAATTAATTACCAGTTCCA, primer 2: GAAGGTCGGAGTCAACGGATTACCTGGAATTAATTACCAGTTCCG; primer 3: TCCGGTCTCGACTAGTTTGTTTAG;

the primers for detecting JC20 locus are as follows: primer 1: GAAGGTGACCAAGTTCATGCTTCTAACAATTTTCATACTTCCCTCCC, primer 2: GAAGGTCGGAGTCAACGGATTTCTAACAATTTTCATACTTCCCTCCT; primer 3: GATTTTCCTTGATGCACACTCACA;

s3, analyzing the detection result of the step S2; if the FAM fluorescence value of JC09 allelic site is close to the abscissa, the genotype is AA, and the marking is X; if the FAM fluorescence value of the equipotential site is located at the middle position of the abscissa and the ordinate, the genotype of the FAM fluorescence value is AG, and the marker position is Y; if the FAM fluorescence value of the JC20 allele is close to the abscissa, the genotype is TT, the genotype is marked as X, and if the FAM fluorescence value of the allele is close to the ordinate, the genotype is CC, and the genotype is marked as Y.

Further, in step S3, the stem thickness of JC09 site identified as X is larger than that of Y, and the stem thickness of JC20 site identified as Y is larger than that of X.

The invention has the following beneficial effects:

according to the invention, through constructing rubber tree genetic maps of different stem circumferences, locating QTL intervals related to the stem circumferences, screening sites with significant differences exist in the intervals, developing significant difference SNP sites and detection primer sets thereof which can be used for typing rubber tree germplasm resources, and typing and verifying the SNP sites by utilizing 2 batches of different rubber tree germplasm resources, thereby screening and obtaining SNP molecular markers which can be more accurately and rapidly typed, and being used for identification of the rubber tree germplasm resources and molecular assisted breeding. Meanwhile, the invention also provides a method for breeding and typing rubber tree germplasm resources with different stem circumferences, which can more rapidly and accurately conduct typing, solves the problem of inaccurate analysis of the stem circumference characteristics of the rubber tree, shortens the screening period of the rubber tree germplasm resources and provides technical support for identification and molecular assisted breeding of the rubber tree germplasm resources

Drawings

FIG. 1 shows the frequency distribution of stem circumference of 93-114 and PR107 hybrid offspring populations.

FIG. 2 is a 193 parts natural population stem circumference frequency distribution.

FIG. 3 is a genetic linkage map.

Fig. 4 is QTL localization results.

FIG. 5 shows chromosome localization results.

FIG. 6 shows SNP molecular markers with good typing results.

FIG. 7 shows the different sample typing results of JC09 (upper) and JC20 (lower) (the upper three panels show JC09 versus 193 germplasm amplification results, the first panel shows 70 germplasm amplification results, the second panel shows 55 germplasm amplification results, the third panel shows 68 germplasm amplification results, the lower three panels show JC20 versus 193 germplasm amplification results, the first panel shows 70 germplasm amplification results, the second panel shows 55 germplasm amplification results, and the third panel shows 68 germplasm amplification results).

Fig. 8 is a comparison of JC09 (upper) and JC20 (lower) different classes of phenotypes.

Detailed Description

The invention is further illustrated in the following drawings and specific examples, which are not intended to limit the invention in any way. Unless specifically stated otherwise, the reagents, methods and apparatus employed in the present invention are those conventional in the art.

Reagents and materials used in the following examples are commercially available unless otherwise specified.

EXAMPLE 1 construction of genetic map

The rubber tree test material adopted in the embodiment is collected from rubber tree varieties planted in the Zhanjiang laboratory station base of the national academy of tropical agriculture, including PR107 (male parent), 93-114 (female parent) and 140 filial generation populations obtained after hybridization of the two, and 193 natural populations are collected and stored.

1. Phenotypic assay: the stem circumference of 140 filial generation populations and 193 natural populations were measured at 1m from ground using a tape.

2. DNA extraction: the tender leaves of the rubber trees with different test materials are respectively taken, sheared and placed in a 1.5mL centrifuge tube. The DNA of the leaves of the rubber tree genome is extracted by using a CTAB method. The purity and concentration were checked by 1% agarose gel electrophoresis, 10. Mu.L was then diluted to 100 ng/. Mu.L as working solution, and the stock solution was stored at-20℃for further use.

3. Simplified gene progenitor sequencing: the reduced genome sequencing was performed on 140 filial generation populations using a second generation illuminea sequencing platform.

4. Genetic map construction: and after sequencing, quality control is carried out on the data, mutation sites are checked, typed and filtered, and finally, a genetic map is formed according to a physical map and a map distance calculation.

5. QTL positioning analysis:

(1) Phenotypic analysis: after obtaining the thick phenotype data of the bark of the rubber tree, performing basic graphic, descriptive analysis and the like;

(2) Genotype and profile filtration: for the items with more marks, the marks can be screened according to the mark deletion proportion, the minimum genetic distance and the minimum physical distance;

(3) QTL scanning is performed: using the R/qtl software (methods of use reference: broman K W, wu H, senet al.R/qtl:QTL mapping in experimental crosses[J]Bioinformatics,2003,19 (7): 889-890.) according to the selected model, according to the fingersCarrying out QTL scanning by a fixed step length, and carrying out permutation for each character for a designated number of times;

(4) Determination of the salient interval: and determining the position of the QTL and the confidence interval thereof according to a given threshold value and a confidence interval determining method. The method proceeds with reference to the define.peak () function of the eqtl package (reference software: https:// cran. R-project. Org/web/packages/eqtl/index. Html). Taking the points with LOD exceeding the threshold value as salient points, forming a salient section by using the continuous salient points, taking the position of the point with the highest LOD value as peak of the section, taking the LOD value of the peak point as reference, taking the section which can be covered after the designated LOD value (such as 1.5) is lowered as the confidence section of the QTL, and if the distance between two peaks is not more than a given length (such as 10 cM), merging into one salient section;

(5) Positioning a composite interval: the sum () function of R/QTL is used to make compound interval drawing for each character, the scanning step length is 1cM, each character permutation is 1000 times, after the threshold value is determined, the corresponding threshold value is used for screening QTL for each character.

6. Chromosome localization:

and carrying out QTL localization analysis on the No. 14 chromosome (chromosome CM 021239.1) of the rubber tree sample to be detected according to the stem rough phenotype measurement result by combining with a genetic linkage map.

7. Results:

by measuring the stem circumference sizes of 140 filial generation populations and 193 natural populations, the frequency distribution situation of the stem circumferences of different materials shows that the frequency of the stem circumferences is 60-80cm and is more, the normal distribution is met, the stem circumference phenotype measurement result of 140 filial generation populations is shown as a graph in fig. 1, the minimum value of the stem circumference phenotype measurement result is 48.5cm, the maximum value of the stem circumference phenotype measurement result is 142cm, and the average value of the stem circumferences is 76.12cm; the stem circumference phenotype measurement results of 193 natural populations are shown in FIG. 2, and the stem circumference phenotype measurement results show that the minimum value is 19.16cm, the maximum value is 58.48cm, the average value is 41.76cm, and the stem circumference phenotype measurement results accord with the normal distribution.

And 140 filial generation materials were subjected to simplified genome sequencing (GBS) analysis to construct a genetic linkage map, as shown in FIG. 3, showing a total of 18 pairs of chromosomes, with a total length of 1528cM, an average of 1.356cM, and a total number of 1127. Further, QTL localization was performed according to the stem crude phenotype measurement result in combination with a genetic linkage map, the QTL localization result is shown in fig. 4, in which it is shown that there are two candidate regions located on chromosome 14 (CM 021239.1), and the chromosome localization result is shown in fig. 5. Screening candidate genes according to the QTL positioning result region, and finding 696 candidate genes in the region.

EXAMPLE 2 screening of SNP molecular markers

The section positioned in example 1 is subjected to phenotype significance differential marker screening, and the screening method is specifically as follows: firstly, determining all SNP loci in a positioning interval according to a sequencing result, counting SNP locus information of each germplasm, typing various SNP types (such as 52 AA types, 71 AG types and 17 GG types), then calculating average stem circumference data of each type (such as 82cm for AA types, 73.78cm for AG types and 68.31cm for GG types), finally performing variance analysis according to the average stem circumference result of each type, wherein the variance analysis result shows that the SNP markers are obvious or extremely obvious, and determining the SNP markers as saliency differences.

According to the method, 21 significant differential SNP loci are screened out, based on the screened 21 significant differential SNP loci, rubber tree genome is referenced, 100bp base sequences before and after the SNP loci are extracted by utilizing TBtools, 21 groups of primers are designed by using http:// www.snpway.com/website, and the designed primers are sent to Shanghai Biotechnology Co., ltd for synthesis, and the synthesized primer sequences are shown in the following table 1.

Table 1 group 21 significant differential SNP site primers

The materials used later are all from the germplasm preserved in advance at Zhanjiang laboratory station of national academy of Tropical agriculture, 12 parts in total, and are usedThe 480II fluorescent quantitative PCR instrument and 21 groups of primers carry out PCR reaction in batches according to the following conditionsAnd the 480II instrument screens out primers with good typing effect on the PCR products from the typing results of the PCR products obtained by carrying out SNP typing software operation.

Wherein the amplification reaction system is 10 mu L KASP reaction system (Meng Junren, zeng Wenfang, deng Li, etc.) of Meng Junren, etc. KASP molecular marker development and application of several important characters of peach [ J ]]Chinese agricultural science, 2021,54 (15): 3295-3307.), and according to the actual conditions of the experiment, establishing the composition of the reaction system, namely 5. Mu.L mix reagent (PCR reaction premix solution, purchased from WUHan dynasty peptide biotechnology Co.); a set of three PARMS primer working solutions, each at a concentration of 100 ng/. Mu.L, to which primer 1 and primer 2 were added, each at 0.15. Mu.L and primer 3 at 0.4. Mu.L; 2. Mu.L of DNA extract; finally add 2.3. Mu.L ddH ₂ O made up the reaction system to 10. Mu.L. The reaction procedure is: pre-denaturation: denaturation at 94℃for 15 min: annealing and extending at 94 ℃ for 20 s: amplification for 10 cycles at 65℃with a drop in gradient of 0.7℃per cycle for 1 min; denaturation: annealing and extending at 94 ℃ for 20 s: amplification was performed at 57℃for 1min for 30 cycles.

The typing result of the PCR products is shown in FIG. 6, 12 kinds of seeds are randomly selected to screen SNP markers which are basically classified into three types, namely, the SNP markers cannot be amplified at all or have small amplification quantity; secondly, the amplification can be carried out, but the typing cannot be carried out; thirdly, the amplification effect is good, the typing can be realized, and the total number of the markers is 5, which accounts for 23.80% of all the markers. Finally, 5 stem crude SNP molecular markers with better typing effect are screened out.

Example 3SNP molecular marker validation

In order to verify the accuracy of the SNP molecular marker around the stem of the rubber tree, 66 natural populations planted in 2015 and 2016 are selected for planting127 natural populations of (3) as the germplasm of a rubber tree for inspection, verifying that example 2 screens out 5 stem crude SNP molecular markers with better typing effect, and uses the primers thereof for fluorescence quantitative PCR detection, the method is the same as example 2, and the method is as follows480II is provided with SNP typing software analysis results (expressed as X near a horizontal axis, expressed as Y near a vertical axis, expressed as XY between the two), and corresponds to stem circumference phenotype data one by one and classifies the stem circumference phenotype data, and when large differences exist among different types of phenotype data, the stem circumference SNP molecular markers of the rubber tree are successfully verified.

The detection analysis of the screened 5 SNP molecular markers capable of typing by using 193 natural populations shows that only 2SNP typing results are ideal, and the results are shown in figure 7.

The amplified results of the markers JC09 and JC20 are in one-to-one correspondence with 127 germplasm planted in 2016 and 66 germplasm stem crude phenotype data planted in 2015, and the result is shown in FIG. 8, wherein the average stem diameter of the marker JC09 in 2016 is 40.98cm when the germplasm typing result is X, the average stem diameter of the typing result is Y is 38.9cm, and the average stem diameters of the two groups are 2.08cm different; the typing result of the germplasm in 2015 shows that the average stem thickness of the typing result is X is 45.11cm, the average stem thickness of the typing result is Y is 44.05cm, and the average stem thickness of the two groups is 1.06cm different.

The average stem thickness of the marking JC20 in 2016 is 38.98cm when the parting result is X, the average stem thickness of the marking JC20 in 2016 is 41.13cm when the parting result is Y, and the average stem thickness of the marking JC20 in 2016 is 2.15cm, so that obvious difference exists; the typing result of the germplasm in 2015 shows that the average stem thickness of the typing result is X is 43.68cm, the average stem thickness of the typing result is Y is 45.63cm, and the average stem thickness of the two groups is 1.95cm different.

As can be seen from the above, the markers JC09 and JC20 are used under the condition of no sample feeding and sequencing, and the conventional laboratory is used480II fluorescent quantitative PCR instrumentExperiments were performed, after reaction, using +.>480II self-contained SNP typing software can be used for typing different germplasm types, thereby realizing the purpose of identifying the size of the stem circumference of different germplasm.

Further analysis of the accuracy showed that there were 80 genotypes X and 46 genotypes Y in the 2016 germplasm according to JC09 typing results, 1 of which could not be identified, if the genotype was X and the stem circumference was greater than 38.9cm (average of the stem circumferences of typing results Y), or the genotype was Y and the stem circumference was less than 40.98cm (average of the stem circumferences of typing results X), the identification was accurate, and if the genotype was not identified, the identification was erroneous. By statistics, the typing error rate in the germplasm in 2016 years of JC09 typing result is 44/126 multiplied by 100% = 34.92%, namely the accuracy rate is 65.08%; in 2015, the number of genotypes is 43 in X and 21 in Y, 2 of which cannot be identified, if the genotype is X and the stem circumference is larger than 44.05cm (the average stem circumference of the parting result Y), or the genotype is Y and the stem circumference is smaller than 45.11cm (the average stem circumference of the parting result X), the identification is accurately marked, and if the genotype is X and the stem circumference is smaller than 45.11cm, the identification is incorrectly marked. By statistics, the typing error rate in the germplasm of the JC09 typing result 2015 is 25/64 multiplied by 100% = 39.06%, namely the accuracy rate is 60.94%; the accuracy rate of the germplasm identification results in 2015 and 2016 is 63.01 percent on average.

According to JC20 typing results, 53 genotypes are X in the 2016 germplasm, 73 genotypes are Y, 1 cannot be identified, if the genotypes are X and the stem circumference is smaller than 41.13cm (the average stem circumference of the typing result Y), or the genotypes are Y and the stem circumference is larger than 38.98cm (the average stem circumference of the typing result X), the identification is accurate, and if the genotypes are not identified, the identification is wrong. By statistics, the typing error rate in the germplasm of 2016 years of JC20 typing results is 44/126 multiplied by 100% = 34.92%, namely the accuracy rate is 65.08%; in 2015, the number of genotypes is 28 in X, the number of genotypes is 38 in Y, if the genotypes are X and the stem circumference is smaller than 45.63cm (the average stem circumference of the parting result Y), or the genotypes are Y and the stem circumference is larger than 43.68cm (the average stem circumference of the parting result X), the identification is accurate, and if the genotypes are X and the stem circumference is wrong, the identification is wrong. By statistics, the typing error rate in the germplasm of 2015 of JC20 typing results is 25/66 multiplied by 100% = 37.87%, namely the accuracy rate is 62.13%; the accuracy rate of the germplasm identification results in 2015 and 2016 is 63.61 percent on average.

In the actual detection process, 2SNP markers can be used for carrying out identification on germplasm, the accuracy of germplasm screening can be improved, and the markers with the numbers JC09 and JC20 are finally determined to be suitable for detecting the stem circumference of the rubber tree. According to the invention, through constructing a rubber tree genetic map, locating a QTL interval related to the stem circumference, screening sites with obvious differences in the interval, developing SNP molecular markers, and utilizing 2 batches of germplasm (planted in 2015 and 2016) to carry out typing and verification on related SNP molecular markers, the SNP molecular markers with better accuracy are obtained through screening, the stem circumference characteristics of the rubber tree can be rapidly and effectively detected, and further the method is effectively used for identifying rubber tree germplasm resources and carrying out molecular assisted breeding, and provides technical support for realizing the breeding of excellent varieties in short time, low cost and high accuracy.

The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

Claims (10)

1. The SNP locus is characterized in that the SNP locus is positioned at 28806263bp and/or 60519917bp locus of chromosome 14 of the rubber tree, and the specific corresponding relation is as follows: the 28806263bp locus is a JC09 mark, the 60519917bp locus is a JC20 locus, the JC09 locus is a base A or G, and the JC20 locus is a base C or T.

2. A specific primer set for detecting the SNP site as set forth in claim 1, characterized in that the primers for detecting the JC09 site are: primer 1: GAAGGTGACCAAGTTCATGCTACCTGGAATTAATTACCAGTTCCA, primer 2: GAAGGTCGGAGTCAACGGATTACCTGGAATTAATTACCAGTTCCG; the primers for detecting JC20 locus are as follows: primer 1: GAAGGTGACCAAGTTCATGCTTCTAACAATTTTCATACTTCCCTCCC, primer 2: GAAGGTCGGAGTCAACGGATTTCTAACAATTTTCATACTTCCCTCCT.

3. The specific primer set according to claim 2, wherein the primer for detecting JC09 locus further comprises: primer 3: TCCGGTCTCGACTAGTTTGTTTAG; the primer for detecting JC20 locus further comprises: primer 3: GATTTTCCTTGATGCACACTCACA.

4. Use of the SNP locus according to claim 1 for identifying the stem circumference of rubber trees, molecular breeding of rubber trees or typing of rubber tree germplasm resources.

5. The use of the SNP locus according to claim 1 or the specific primer set of the SNP locus according to claim 2 or 3 for breeding rubber tree germplasm resources of different stem circumferences.

6. Use of the SNP locus according to claim 1 or the specific primer set of the SNP locus according to claim 2 or 3 in the preparation of a kit for detecting the circumference of a rubber tree stem.

7. A kit for detecting the circumference of a rubber tree stem, characterized in that the kit comprises the specific primer set for the SNP site according to claim 2 or 3.

8. A method for identifying the stem circumference of a rubber tree, characterized in that it comprises detecting whether the 14 th chromosome of a plant to be tested contains the SNP site according to claim 1, and detecting the genotype of the SNP site JC 09: the stem circumference of the rubber tree germplasm with the genotype of AA is larger than that of the rubber tree germplasm with the genotype of AG; detecting the genotype of the SNP locus JC 20: the stem circumference of the rubber tree germplasm with the genotype TT is larger than that of the rubber tree germplasm with the genotype CC.

9. A method for breeding rubber tree germplasm resources or rubber tree germplasm resources typing of different stem circumferences is characterized by comprising the following steps:

s1, extracting DNA of a sample to be detected;

s2, taking the sample extracted in the step S1 as a template, and adopting the specific primer group of the SNP locus as set forth in claim 2 or 3 to carry out qPCR detection;

s3, analyzing the detection result of the step S2; if the FAM fluorescence value of JC09 allelic site is close to the abscissa, the genotype is AA, and the marking is X; if the FAM fluorescence value of the equipotential site is located at the middle position of the abscissa and the ordinate, the genotype of the FAM fluorescence value is AG, and the marker position is Y; if the FAM fluorescence value of the JC20 allele is close to the abscissa, the genotype is TT, the genotype is marked as X, and if the FAM fluorescence value of the allele is close to the ordinate, the genotype is CC, and the genotype is marked as Y.

10. The method of claim 9, wherein in step S3 the stem thickness of JC09 locus is greater than the stem thickness of Y, and the stem thickness of JC20 locus is greater than the stem thickness of X.