CN109777878B - Method for selecting goose feather color by using nucleotide polymorphism molecular genetic markers - Google Patents
Method for selecting goose feather color by using nucleotide polymorphism molecular genetic markers Download PDFInfo
- Publication number
- CN109777878B CN109777878B CN201910153871.XA CN201910153871A CN109777878B CN 109777878 B CN109777878 B CN 109777878B CN 201910153871 A CN201910153871 A CN 201910153871A CN 109777878 B CN109777878 B CN 109777878B
- Authority
- CN
- China
- Prior art keywords
- breeding
- goose
- genotype
- selecting
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A method for selecting goose feather color by using nucleotide polymorphism molecular genetic marker belongs to the technical field of poultry breeding, utilizes the provided kit to carry out Polymerase Chain Reaction (PCR) and detect products, sequences the PCR products and judges the genotype, utilizes the determination of each individual of a breeding goose group at the polymorphic site of the marker gene, and selects qualified individuals for establishing the breeding group according to the genotype of the polymorphic site, thereby ensuring that the breeding goose groups are almost consistent in the feather color, the accuracy rate of judging the feather color according to the genotype of the site reaches 100 percent, the breeding goose group is completely homozygous at the site and does not contain another allele, the phenomenon that the allele descendant of the site is heterozygous in breeding is eliminated, compared with the traditional phenotype selection method, the accuracy rate is obviously improved during the selection of the goose feather color, the breeding process is obviously accelerated, the breeding cost is obviously reduced, greatly improving the competitiveness and the economic benefit of the breeding company in the goose breeding aspect.
Description
Technical Field
The invention belongs to the technical field of poultry breeding, relates to a goose feather color selection method, and particularly relates to a method for selecting goose feather color by using nucleotide polymorphism of key genes formed by the feather color as a molecular genetic marker.
Background
The feathering is one of the economic traits of the poultry, and is commonly used for variety division, variety purity evaluation, self-sexing and the like of the poultry due to easy observation, and evidence also shows that the feathering trait can be related to some economic traits of the poultry. In addition, white feathers are more advantageous than gray feathers in the aspects of down utilization and carcass aesthetics. Thus, the feathered color has wide application in poultry production and breeding.
The gray and white feathers are the common feathers of the geese, however, the molecular genetic mechanism of the goose feather formation is not clear, so the breeding of the gray and white feathers is still based on phenotypic selection at present. According to the research in recent years, the white and gray feather properties of geese are influenced not only by major genes, but also by some modifying genes. In addition, there is a certain explicit-implicit relationship between the gray feather and the white feather. Therefore, it is not easy to obtain pure-color feather goose, especially pure white feather goose. Although the expansion of the population can improve the breeding efficiency, the breeding cost is inevitably increased, and the time and the labor are wasted. Even so, some recessive genes may be contained in the bred population, so that the population has the opportunity to reappear the non-pure-color-feather individuals in the breeding process. Although the test cross test can greatly reduce the probability of non-pure color individuals in the bred population, the breeding cost is greatly improved, the breeding time is delayed, and the breeding efficiency is reduced.
Compared with phenotype selection, the molecular genetic marker has great advantages and application values in goose pure feather breeding. A great deal of research has shown that the feather color involves many signal pathways (such as MSH/MC1R pathway, WNT/Frizzled pathway, SCF/c-Kit pathway, ET-1/ETB-R and the like) and many genes (such as MITF, TYR, TYRP1, DCT and the like), but it is still unclear which pathways and gene changes cause the change of the feather color of goose. However, breeding by using molecular genetic markers requires successful finding of molecular genetic markers associated with target traits. At present, molecular genetic markers which are closely linked with the feather color of the goose are not screened in the breeding of the feather color of the goose, so that the molecular breeding of the feather color of the goose is severely restricted.
Disclosure of Invention
The invention aims to provide a method for selecting the feather color of geese by using a nucleotide polymorphism molecular genetic marker, aiming at the defects that the phenotypic selection method commonly adopted in the goose feather color breeding at present needs to enlarge the breeding population scale and carry out a test cross test, which obviously increases the manpower, material resources and financial resources consumed by breeding companies in selecting the feather color characters, and the molecular genetic marker which is closely linked with the feather color of geese is not screened in the molecular genetic marker breeding, so that the molecular breeding of the feather color of geese is seriously restricted, and the like, and the method for selecting the goose feather color by using the nucleotide polymorphism molecular genetic marker is provided, the accuracy of distinguishing the feather color can reach 100 percent through the method, and the method is favorable for promoting the research and breeding work related to the goose feather color breeding.
The technical scheme of the invention is as follows: a method for selecting goose feather color by using a nucleotide polymorphism molecular genetic marker, which is characterized by comprising the following steps:
(1) selecting an individual to be tested: selecting individuals with shapes meeting the requirements from breeding groups;
(2) blood draw and DNA extraction: extracting 0.1mL of blood from the wing vein of the detected individual, and extracting a DNA template by using a DNA extraction kit;
(3) polymerase chain reaction and product detection: carrying out PCR by using the extracted DNA as a template in PCR and a provided PCR kit; taking 5 mu L of product to carry out 1.5% agarose gel electrophoresis, and if a single band with the size of 657bp is presented, carrying out sequencing detection on the PCR product;
(4) sequencing and genotyping: sequencing the PCR product and the primer, and determining the genotype according to the sequencing result;
(5) selecting qualified individuals according to the genotypes, wherein all individuals with GG genotypes at polymorphic sites 1 and AA genotypes at polymorphic sites 2 are white feathers; individuals with TT genotype at polymorphic site 1 and CC genotype at polymorphic site 2 are gray feather; individuals with a GT genotype at polymorphic site 1 and an AC genotype at polymorphic site 2 are heterozygotes;
(6) determining reserved individuals according to the breeding target of the feather color character.
The invention has the beneficial effects that: the method for selecting the goose feather color by utilizing the nucleotide polymorphism molecular genetic marker is scientific and reasonable, selects the goose population to be detected, extracts the blood of the individual to be detected and extracts DNA, utilizes the provided kit to carry out Polymerase Chain Reaction (PCR) and detect the product, carries out sequencing on the PCR product and judges the genotype, utilizes the determination of each individual of the breeding goose population at the polymorphic site of the marker gene to select the genotype individual corresponding to gray feather and white feather, thereby quickly establishing the breeding population with the gray feather or the white feather, selects qualified individuals for establishing the breeding population according to the genotype of the polymorphic site, ensures that the breeding goose populations are almost consistent in the feather color, has the accuracy rate of judging the feather color according to the genotype of the site to reach 100 percent, is completely homozygous at the site without containing another allele, eliminates the phenomenon of the heterozygosis of the allele of the site in the offspring, compared with the traditional phenotype selection method, the method has the advantages that the accuracy rate is obviously improved during goose feather color selection, the breeding process is obviously accelerated, the breeding cost is obviously reduced (for example, the scale of breeding groups can be reduced by at least half, and the number of selection generations can be reduced by at least one generation), and the competitiveness and the economic benefit of breeding companies in the goose breeding aspect are greatly improved. The method lays a foundation for establishing a molecular breeding platform of the feather color character; the problem of recessive gene residue in phenotype selection is avoided, and the condition of eliminating feathers in the breeding process of offspring is overcome.
Drawings
FIG. 1 is an electrophoresis diagram of PCR products of 2 DNA samples of Landaise geese in the example of the present invention.
FIG. 2 is a diagram of sequencing peaks corresponding to GG genotype and AA genotype of SNP site of genetic marker gene in the embodiment of the invention.
FIG. 3 is a diagram of sequencing peaks corresponding to the genotype TT and the genotype CC of the SNP site of the genetic marker gene in the embodiment of the invention.
FIG. 4 is a diagram of the corresponding sequencing peaks of the SNP sites GT genotype and AC genotype of the genetic marker gene in the embodiment of the invention.
FIG. 5 is an exemplary diagram of sequencing results of different individuals at SNP sites of a marker gene according to an embodiment of the present invention.
Detailed Description
The invention is further illustrated below by taking a batch of 34 Landaise geese as an example and by combining the following drawings:
(1) selecting a to-be-detected Langdian goose individual: 34 individuals with the shapes meeting the requirements are selected from a group of Landaise goose groups.
(2) Blood draw and DNA extraction: 0.1mL of blood was drawn from the wing vein of the test subject. And extracting the DNA template by using the DNA extraction kit.
(3) Polymerase chain reaction and product detection: the extracted DNA was used as a template in PCR and PCR was carried out using a PCR kit (the list of reagents contained therein is shown in the attached Table 1) provided (the reaction system is shown in the attached Table 2, and the reaction conditions are shown in the attached Table 3). mu.L of the product was subjected to 1.5% agarose gel electrophoresis, and if a single band of 657bp in size was present (see FIG. 1), the PCR product was sent to the sequencer for detection.
(4) Sequencing and genotyping: the PCR product and primers (the primers are shown in attached Table 1) were sequenced by sequencing company, and the genotype was determined based on the sequencing results (see FIGS. 2, 3, 4, and 5).
(5) And (3) analyzing the accuracy: in order to analyze the accuracy of the present invention in feather color selection, this example performed a genotype discrimination and a feather color comparison on this batch of Landaise geese, and calculated the accuracy of the discrimination (see the attached Table 4 for details). The result shows that the discrimination accuracy of the invention is 100%. Note: the invention can skip this step in practical application.
(6) And selecting the corresponding genotype according to the breeding target of the feather color character. All individuals with GG genotype at polymorphic site 1 and AA genotype at polymorphic site 2 are white feathers, individuals with TT genotype at polymorphic site 1 and CC genotype at polymorphic site 2 are gray feathers, and individuals with GT genotype at polymorphic site 1 and AC genotype at polymorphic site 2 are miscellaneous feathers.
Attached table 1: list of reagents in kit
Attached table 2: PCR system for genetic marker gene
Note: the above substances in the system were added to the reaction tube in order, centrifuged at 1000 rpm for 1 minute in a desktop centrifuge to allow all the added substances to settle to the bottom, and then placed in a PCR apparatus to perform PCR amplification under the reaction conditions shown in Table 3. And 5 mu.L of the product is used for gel electrophoresis, and the size and the singularity of the product are detected.
Attached table 3: PCR conditions
Attached table 4: corresponding relation and discrimination accuracy of marker gene polymorphism site genotype and feather color
The band (657bp size) in FIG. 1 is an electrophoretogram of the PCR product of 2 DNA samples of Landais geese.
The left and right sequences of SNPs in FIGS. 2-4 are:
GTCTTTTT(G/T)TATTATTATTTTTTAATAAAACAACCTGCCACATACCAAACAACCCCC(A/C)GGTTCC。
in FIG. 5, B-1 to B-11 represent white feather individuals; z-1 to Z-13 are heterofeather individuals; h-1 to H-10 are gray feather individuals. The sequence with background is mutation site, where M is heterozygote corresponding to the site.
The invention has obvious advantages in the selection of the goose feather color and has good market application prospect. Taking the breeding of a goose variety or product line as an example, the economic benefit of the application of the invention is mainly reflected in the reduced breeding population scale and the reduced required selection times due to the improvement of the selection accuracy. If a variety or a strain is bred, the number of breeding population individuals can be reduced by 2000, each goose is 100 yuan, and the cost can be saved by 20 ten thousand yuan in total. Therefore, the method obviously improves the economic benefit of goose breeding enterprises.
<110> Yangzhou university
<120> a method for selecting goose feather color by using molecular genetic markers of nucleotide polymorphisms
<140>201910153871.X
<141>2019-03-01
<160>34
<170>PatentIn version 1.0
<210>1
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
ttttgtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccaggttcc 60
<210>2
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
ttttgtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccaggttcc 60
<210>3
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
ttttgtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccaggttcc 60
<210>4
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
ttttgtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccaggttcc 60
<210>5
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
ttttgtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccaggttcc 60
<210>6
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
ttttgtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccaggttcc 60
<210>7
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
ttttgtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccaggttcc 60
<210>8
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
ttttgtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccaggttcc 60
<210>9
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
ttttgtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccaggttcc 60
<210>10
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
ttttgtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccaggttcc 60
<210>11
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
ttttgtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccaggttcc 60
<210>12
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
ttttmtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccmggttcc 60
<210>13
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
ttttmtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccmggttcc 60
<210>14
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>14
ttttmtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccmggttcc 60
<210>15
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>15
ttttmtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccmggttcc 60
<210>16
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>16
ttttmtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccmggttcc 60
<210>17
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>17
ttttmtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccmggttcc 60
<210>18
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>18
ttttmtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccmggttcc 60
<210>19
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>19
ttttmtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccmggttcc 60
<210>20
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>20
ttttmtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccmggttcc 60
<210>21
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>21
ttttmtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccmggttcc 60
<210>22
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>22
ttttmtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccmggttcc 60
<210>23
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>23
ttttmtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccmggttcc 60
<210>24
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>24
ttttmtatta ttatttttta ataaaacaac ctgccacata ccaaacaacc cccmggttcc 60
<210>25
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>25
ttttttatta ttatttttta ataaaacaac ctgccacata ccaaacaacc ccccggttcc 60
<210>26
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>26
ttttttatta ttatttttta ataaaacaac ctgccacata ccaaacaacc ccccggttcc 60
<210>27
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>27
ttttttatta ttatttttta ataaaacaac ctgccacata ccaaacaacc ccccggttcc 60
<210>28
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>28
ttttttatta ttatttttta ataaaacaac ctgccacata ccaaacaacc ccccggttcc 60
<210>29
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>29
ttttttatta ttatttttta ataaaacaac ctgccacata ccaaacaacc ccccggttcc 60
<210>30
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>30
ttttttatta ttatttttta ataaaacaac ctgccacata ccaaacaacc ccccggttcc 60
<210>31
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>31
ttttttatta ttatttttta ataaaacaac ctgccacata ccaaacaacc ccccggttcc 60
<210>32
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>32
ttttttatta ttatttttta ataaaacaac ctgccacata ccaaacaacc ccccggttcc 60
<210>33
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>33
ttttttatta ttatttttta ataaaacaac ctgccacata ccaaacaacc ccccggttcc 60
<210>34
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>34
ttttttatta ttatttttta ataaaacaac ctgccacata ccaaacaacc ccccggttcc 60
Claims (3)
1. A method for selecting goose feather color by using a single nucleotide polymorphism molecular genetic marker, which is characterized by comprising the following steps:
(1) selecting an individual to be tested: selecting individuals with shapes meeting the requirements from breeding groups; the individual is a Langder goose individual;
(2) blood draw and DNA extraction: extracting 0.1mL of blood from the wing vein of the detected individual, and extracting a DNA template by using a DNA extraction kit;
(3) polymerase chain reaction and product detection: carrying out PCR by using the extracted DNA as a template in PCR and a provided PCR kit; taking a 5 mu L product, carrying out 1.5% agarose gel electrophoresis, and if a single band with the size of 657bp is present, carrying out sequencing detection on the PCR product; the kit consists of the following reagents: an upstream primer: 5'-ACTCTGGGCATTGTAAGCCT-3', downstream primer: 5'-AGCAGAACAACAAGGTGCAG-3', 2 XTaq mix, water;
(4) sequencing and genotyping: sequencing the PCR product and the primer, and determining the genotype according to the sequencing result; in the sequencing result, the left and right sequences of SNP in the PCR product are as follows:
GTCTTTTT(G/T)TATTATTATTTTTTAATAAAACAACCTGCCACATACCAAACAACCCCC(A/C)GGTTCC；
(5) selecting qualified individuals according to the genotypes, wherein all individuals with GG genotypes at polymorphic sites 1 and AA genotypes at polymorphic sites 2 are white feathers; individuals with TT genotype at polymorphic site 1 and CC genotype at polymorphic site 2 are gray feather; individuals with a GT genotype at polymorphic site 1 and an AC genotype at polymorphic site 2 are heterozygotes; wherein, polymorphic site 1 is a site having a G/T mutation in the left and right sequences of the SNP, and polymorphic site 2 is a site having an A/C mutation in the left and right sequences of the SNP;
(6) determining reserved individuals according to the breeding target of the feather color character.
2. The method for selecting the goose feather color by using the SNP molecular genetic markers according to claim 1, wherein the PCR in the step (3) comprises the following systems: 0.5 mu L of 10 mu M upstream primer, 0.5 mu L of 10 mu M downstream primer, 10 mu L of 2 XTaq mix, 8 mu L of water and 1 mu L of 200 ng/mu L DNA.
3. The method for selecting the pinna color of geese using the molecular genetic marker of single nucleotide polymorphism according to claim 1, wherein the PCR reaction conditions in the step (3) are as follows:
(1) pre-denaturation at 95 ℃ for 5 min;
(2) cycling for 35 times at 95 ℃/30 seconds, 56 ℃/30 seconds, 72 ℃/30 seconds;
(3) 72 ℃ for 5 minutes after the circulation is finished;
(4) keep at 4 ℃ until electrophoresis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910153871.XA CN109777878B (en) | 2019-03-01 | 2019-03-01 | Method for selecting goose feather color by using nucleotide polymorphism molecular genetic markers |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910153871.XA CN109777878B (en) | 2019-03-01 | 2019-03-01 | Method for selecting goose feather color by using nucleotide polymorphism molecular genetic markers |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109777878A CN109777878A (en) | 2019-05-21 |
| CN109777878B true CN109777878B (en) | 2022-03-18 |
Family
ID=66487302
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910153871.XA Active CN109777878B (en) | 2019-03-01 | 2019-03-01 | Method for selecting goose feather color by using nucleotide polymorphism molecular genetic markers |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109777878B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110904244B (en) * | 2019-12-19 | 2022-06-03 | 四川农业大学 | Method for rapidly identifying gray feather heterozygote of Chinese goose species |
| CN111705146B (en) * | 2020-08-04 | 2022-08-12 | 四川农业大学 | Molecular marker for identifying duck jute feather character and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667429A (en) * | 2012-09-18 | 2014-03-26 | 中国农业大学 | Method of screening silky character of chicken by SNP (Single Nucleotide Polymorphism) detection |
| CN108085400A (en) * | 2017-12-29 | 2018-05-29 | 中国农业大学 | The identification of the red plumage reason mutated-genotype of white Leghorn and special marker |
| CN109022593A (en) * | 2018-08-28 | 2018-12-18 | 扬州大学 | The method that the assisted Selection of liver goose abdominal fat weight and carcass weight marks and utilizes molecular marker assisted selection |
-
2019
- 2019-03-01 CN CN201910153871.XA patent/CN109777878B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667429A (en) * | 2012-09-18 | 2014-03-26 | 中国农业大学 | Method of screening silky character of chicken by SNP (Single Nucleotide Polymorphism) detection |
| CN108085400A (en) * | 2017-12-29 | 2018-05-29 | 中国农业大学 | The identification of the red plumage reason mutated-genotype of white Leghorn and special marker |
| CN109022593A (en) * | 2018-08-28 | 2018-12-18 | 扬州大学 | The method that the assisted Selection of liver goose abdominal fat weight and carcass weight marks and utilizes molecular marker assisted selection |
Non-Patent Citations (3)
| Title |
|---|
| Association of chicken MC1R gene polymorphism with coat colour trait in Iraqi native chicken;Salah Mahdi Alsudany等;《Life Science Journal》;20171231;第14卷(第12期);第71-75页 * |
| The genetic and evolutionary basis of colour variation in vertebrates;Michael Hofreiter等;《Cellular and Molecular Life Sciences》;20100314;第67卷;第2591-2603页 * |
| 浙东白鹅和朗德鹅MC1R基因变异与定量表达研究;周兵;《中国优秀博硕士学位论文全文数据库，农业科技辑》;20110415(第04期);摘要，第二章 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109777878A (en) | 2019-05-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3741873B1 (en) | Identification of white legroms red-plucking mutagenic mutant genotype in pink shell laying hens and red plucking | |
| CN110273010B (en) | Identification and application method of MC1R gene haplotype | |
| CN112322753A (en) | SNP molecular marker related to pork intramuscular fat and application thereof | |
| CN106939342B (en) | SNP marker linked with millet beige, primer and application | |
| WO2018218857A1 (en) | Myh4 gene molecule marker for improved pork quality and use thereof in porcine genetic improvement | |
| CN108866208B (en) | SNP molecular marker related to cockscomb development traits and detection method thereof | |
| CN109777878B (en) | Method for selecting goose feather color by using nucleotide polymorphism molecular genetic markers | |
| CN109868323A (en) | A kind of kind duck egg laying performance associated gene SMAD3 method for screening molecular markers | |
| CN108753995B (en) | SNP (Single nucleotide polymorphism) site obviously related to sexual precocity traits of Eriocheir sinensis and application | |
| CN108913787A (en) | SNP marker relevant to the more lambs of sheep and its application | |
| CN112176072B (en) | Reagent, primer, kit and application for detecting intramuscular fat content of beef cattle | |
| CN114369669A (en) | Molecular marker related to pork quality traits and application thereof | |
| CN107586857B (en) | Nucleic acid, kit and method for rapidly identifying red and black hair color genes of pigs | |
| CN111334588B (en) | Molecular marker related to black and brown feather characters of duck and application thereof | |
| CN115341035A (en) | SNP molecular marker for selecting laying weight of hens | |
| CN108165635B (en) | KIAA1462 gene promoter region variant site and application thereof in improving egg laying performance of geese | |
| CN110699465B (en) | Molecular marker for rapidly improving green shell rate of duck group and application | |
| CN102732514B (en) | Identification method for chemotactic factor acceptor 9 gene used as molecular marker for bovine excellent superovulation trait and application of same | |
| CN109762925B (en) | KASP molecular marker of rice blast-resistant broad-spectrum gene pi9, detection method and application thereof | |
| CN110029174B (en) | SSR (simple sequence repeat) marker related to quality of macrobrachium rosenbergii bodies | |
| CN113718041B (en) | SNP molecular marker related to muscle drip loss character of meat rabbits and application thereof | |
| CN110819720A (en) | InDel molecular marker method for rapidly identifying south-north lateolabrax japonicus population | |
| CN110241234A (en) | A kind of 32-plex InDels composite amplification system of fluorescent marker and its application | |
| CN115820874A (en) | Transposon polymorphic molecular marker LTR/Gypsy for determining duck white feather character and identification method | |
| CN109880916B (en) | Molecular marker of NR3C2 gene related to chicken breeding traits and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |