CN109694827A - Marine fungi source azaphilones class compound and preparation method thereof and preparing the application in anti-vibrios drug - Google Patents

Marine fungi source azaphilones class compound and preparation method thereof and preparing the application in anti-vibrios drug Download PDF

Info

Publication number
CN109694827A
CN109694827A CN201910049568.5A CN201910049568A CN109694827A CN 109694827 A CN109694827 A CN 109694827A CN 201910049568 A CN201910049568 A CN 201910049568A CN 109694827 A CN109694827 A CN 109694827A
Authority
CN
China
Prior art keywords
class compound
marine fungi
silica gel
preparation
azaphilones
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201910049568.5A
Other languages
Chinese (zh)
Other versions
CN109694827B (en
Inventor
曹飞
朱华结
刘云凤
李龙飞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Heibei University
Original Assignee
Heibei University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Heibei University filed Critical Heibei University
Priority to CN201910049568.5A priority Critical patent/CN109694827B/en
Publication of CN109694827A publication Critical patent/CN109694827A/en
Application granted granted Critical
Publication of CN109694827B publication Critical patent/CN109694827B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/145—Fungal isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D311/00—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
    • C07D311/02—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
    • C07D311/76—Benzo[c]pyrans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D493/00—Heterocyclic compounds containing oxygen atoms as the only ring hetero atoms in the condensed system
    • C07D493/02—Heterocyclic compounds containing oxygen atoms as the only ring hetero atoms in the condensed system in which the condensed system contains two hetero rings
    • C07D493/10—Spiro-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/02—Oxygen as only ring hetero atoms
    • C12P17/06—Oxygen as only ring hetero atoms containing a six-membered hetero ring, e.g. fluorescein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/18—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing at least two hetero rings condensed among themselves or condensed with a common carbocyclic ring system, e.g. rifamycin
    • C12P17/181—Heterocyclic compounds containing oxygen atoms as the only ring heteroatoms in the condensed system, e.g. Salinomycin, Septamycin
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Biomedical Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Botany (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention provides a kind of marine fungi source azaphilones class compound and preparation method thereof and preparing the application in anti-vibrios drug, the marine fungi be lattice spore bacterium (PleosporalesSp.) HBU-135 bacterial strain, the deposit date is on October 18th, 2018, deposit number is CGMCC No.16379, and depositary institution is China Committee for Culture Collection of Microorganisms's common micro-organisms center, and depositary institution address is Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3.The structural formula of the compound is selected from 1 ~ formula of formula 4.By fermented and cultured lattice spore bacterium (PleosporalesSp.) HBU-135 bacterial strain, and the isolated azaphilones class compound from fermentation material, verified, which has compared with strong inhibitory activity a variety of vibrio marinopraesens, can be made into anti-vibrios agent, be with a wide range of applications.

Description

It marine fungi source azaphilones class compound and preparation method thereof and is preparing Application in anti-vibrios drug
Technical field
The present invention relates to marine natural field of medicinal chemistry, relate in particular to a kind of marine fungi source Azaphilones class compound and preparation method thereof and preparing the application in anti-vibrios drug.
Background technique
During sea-farming, various bacterial diseases annoying the development of fishery economic always, become sea-farming One of the important restriction factor of the high-quality excellent production of animal, causes huge economic loss to mariculture industry.Vibrio bacteria It (Vibrio) is to cause one of most commonly seen, maximum pathogenetic bacteria of harm, fish, shrimp in marine cultured animal bacteriosis The marine cultured animals such as class, crab class can all be done harm to by it, and caused vibriosis has the characteristics that popular area is wide, disease incidence is high.It seeks New and effective, less toxic anti-vibriosis evil lead compound is looked for have become the focal issue of mariculture industry stable development, Have become marine organisms and field of pharmaceutical chemistry research problem in science urgently to be resolved.
Marine-derived fungal microbial resources are found newly because its metabolite enriches and becomes the advantages that repeating fermentation One of most important source of the anti-agriculture pathomycete lead compound of type, wherein with marine fungi source Azaphilones class compound is the anti-vibrios reactive compound research of representative for solving puzzlement China's sea-farming at present Vibrios disease problem has a very important significance.
Currently, the type of reported marine fungi source azaphilones class compound is limited, and living to its anti-vibrios Journal of Sex Research is less, and there has been no about azaphilones class compound of the present invention and its active report of anti-vibrios at present.
Summary of the invention
An object of the present invention is just to provide a kind of marine fungi source azaphilones class compound and its preparation side Method, to solve asking for the type of marine fungi source azaphilones class compound and anti-vibrios limited activity in the prior art Topic.
The second object of the present invention is just to provide a kind of marine fungi source azaphilones class compound and is preparing anti-arc Application in bacterium drug.
The purpose of the present invention is what is be achieved through the following technical solutions: a kind of marine fungi, and the marine fungi is lattice spore Bacterium (Pleosporales sp.) HBU-135 bacterial strain, the deposit date is on October 18th, 2018, deposit number CGMCC No.16379, depositary institution are China Committee for Culture Collection of Microorganisms's common micro-organisms center, and depositary institution address is Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3.
1. sample source
Marine fungi HBU-135 strain isolation is picked up from from marine sediment, the marine sediment sample in June, 2015 Cangzhou, Hebei Province PORT OF HUANGHUA sea area.After the acquisition of bottom sediment sample, it is put in -20 DEG C of refrigerators and saves at once, and be sent to reality Test the mask work that room carries out subsequent fungi.
2. the separation of fungi
The selection of 2.1 culture mediums
(1) PDA culture medium
Potato (peeling) 200g, glucose 20g, sea salt 30g, agar 20g, water 1000mL.Add 25 μ g/ when separating fungi ML streptomycin sulphate, 25 μ g/mL ampicillins inhibit bacterial growth.
(2) salt-free PDA culture medium
Potato (peeling) 200g, glucose 20g, agar 20g, water 1000mL.Add 25 μ g/mL sulfate chains when separating fungi Mycin, 25 μ g/mL ampicillins inhibit bacterial growth (salt-free PDA is compared with salt PDA is added).
(3) rose bengal medium
Potato (peeling) 200g, glucose 20g, sea salt 30g, rose-bengal (rose Bengal) 33mg (inhibit growth Fast mould spreads growth), agar 20g, water 1000mL.
Separation, the purifying of 2.2 fungies
Above-mentioned marine sediment sample is placed in sterile glass device, 1mL sterile water is added and is adjusted to sticky shape.It takes out 0.1mL aforesaid liquid dilutes 10 times, 100 times, 1000 times with sterile water respectively, obtains the homogenate of 4 concentration gradients, use is sterile Pipette takes each concentration homogenate of 0.2mL to be separately added into PDA, salt-free PDA, in rose bengal medium, applied with spreader respectively It is even.Each concentration gradient does three in parallel respectively.It seals with sealing film, and writes number.The above separating experiment is in sterile item It is carried out under part.
The culture medium of above-mentioned addition sample is respectively put into 28 DEG C of insulating boxs, is inverted culture.5-8d of general culture just have bacterium It falls or mycelium is longer (bacterial growth is fast, and 2-3d just have bacterium colony to grow out) from culture medium or the small block edge of tissue. It with transfer needle picking colony or mycelium tip, moves on new plate, after isolating and purifying several times, can get the pure bacterium of fungi Strain.Fungi mask work generally carries out 35d.The last fortnight checks once daily, checks later every 3-4d primary.Once it was found that having New bacterium colony or mycelium is grown, and should be transferred on new plate at once.
3, the screening of bacterial strain
Aimed strain is screened using the method for screening active ingredients combination Chemical Screening.By being fermented on a small scale to bacterial strain (2 bottles) obtain coarse extract, carry out antibacterial activity test to coarse extract, using the inhibitory activity to vibrios as screening aimed strain One of investigation factor；And HPLC fingerprint map analyzing is carried out to coarse extract, using secondary metabolite amount as screening object bacteria The two of the investigation factor of strain, it is final to determine that bacteriostatic activity is high and secondary metabolite bacterial strain HBU-135 abundant is aimed strain, And it is identified.
4, the identification of bacterial strain
3-7d is cultivated on PDA medium plate, grows to the fungi of optimum state, in sterilizing pipette tips picking single colonie A small amount of mycelia is to being equipped in the EP pipe of 50 μ L Lysis buffer (lysate), the thermal denaturation 15min in 80 DEG C of water-baths, so 8000rpm is centrifuged 1min afterwards, and taking 3 μ L supernatants is the template DNA of PCR reaction.
Primer for expanding and being sequenced is ITS1 and ITS4, upper and lower primer sequence are as follows:
ITS1:TCCGTAGGTGAACCTGCGG
ITS4:TCCTCCGCTTATTGATATGC
PCR reaction system is 40 μ L systems, comprising:
Amplification condition are as follows:
Amplified production with 0.8% Ago-Gel, 0.5 × TBE electrophoretic buffer sample, 5V/cm voltage, 5 μ L electricity of loading Swimming detection, DNA Marker indication molecule amount, gel imager are observed and are taken a picture.Beijing three is sent to win Radix Polygalae pcr amplification product Company is sequenced, and is finally accredited as lattice spore bacterium (Pleosporales sp.).
A kind of marine fungi source azaphilones class compound, the structure of the compound are as follows:
A kind of preparation method of above-mentioned marine fungi source azaphilones class compound, includes the following steps:
(1) above-mentioned lattice spore bacterium (Pleosporales sp.) HBU-135 strain inoculated is carried out in bacterium culture medium Spawn incubation；
(2) it after the completion of Spawn incubation, is inoculated in fermentation medium and is fermented, obtain fermentation material；
(3) fermentation material is carried out extraction 2-4 times with ethyl acetate, is concentrated under reduced pressure to give after combined ethyl acetate extract liquor thick Medicinal extract；
(4) chromatographic isolation is carried out up to the azaphilones class compound, the chromatographic isolation to gained coarse extract Successively to carry out normal phase silica gel column chromatography separation, reversed-phase silica gel column chromatography separation, gel column chromatography separation and high performance liquid chromatography Separation.
In step (1), the bacterium culture medium are as follows: 1.0-10wt% of glucose, 0.1-4.0wt% of yeast extract, peptone 0.2-4.0wt%, 1.0-6.0wt% of agar, 3.0-10wt% of coarse sea salt, remaining is water；Spawn incubation temperature is 15-35 DEG C, Incubation time is 3-10 days.
In step (2), the fermentation medium of per unit part includes: that (boiling removes 40-120g of potato after twenty minutes Slag), 10-30g of glucose, MgCl25-20g, 200-600mL of water；Fermentation culture conditions are the stationary culture 20-at 15-35 DEG C 50 days.
In step (4), the normal phase silica gel column chromatography separation are as follows: first use stationary phase for 100~200 mesh silica gel, flow It is mutually that 1.5-3vol% ethanol/methylene mixed solutions are eluted, elution volume is 3-5 column volume, and gained is eluted Use stationary phase for 200~300 mesh silica gel again after liquid concentration, mobile phase is that the mixing of 40-50vol% ethyl acetate/petroleum ethers is molten Liquid is eluted, and elution volume is 2-3 column volume.
In step (4), the stationary phase that the reversed-phase silica gel column chromatography separation uses is C18Silica gel, mobile phase are 60- 70vol% methanol/water mixed solution, elution volume are 2-3 column volume.
In step (4), the stationary phase of the gel column chromatography separation is sephadex LH-20, and mobile phase is methanol, is washed Lift-off product is 3-5 column volume.
In step (4), the chromatographic column used in the high performance liquid chromatography separation partly to prepare silica gel chromatographic column, ViridisTMSilica 2-Ethylpyridine, 5 μm, 10 × 250mm, mobile phase is mixed for 90-95vol% petroleum ethers/ethyl alcohol Close solution；Daicel IA column is partly prepared, 5 μm, 10 × 250mm, mobile phase is that 75-85vol% petroleum ethers/ethyl alcohol mixing is molten Liquid.
A kind of marine fungi source azaphilones class compound is preparing the application in anti-vibrios drug, the anti-arc Bacterium drug is using above-mentioned compound or its pharmaceutically acceptable salt as effective component.
A kind of marine fungi source azaphilones class compound or its pharmaceutically acceptable salt preparation prevention and/ Or treatment is by Vibrio anguillarum (Vibrio anguillarum), vibrio parahaemolytious (Vibrio parahemolyticus) He Rongzao arc Application in the drug of vibrios disease caused by bacterium (Vibrio alginolyticus).
Term " pharmaceutically acceptable salt " refers to the addition of atoxic inorganic or organic acid and/or alkali in the present invention Salt, for details, reference can be made to " Salt selection for basic drugs ", Int.J.Pharm. (1986), 33,201-217.
The present invention obtains azaphilones class compound 1-4 by marine fungi HBU-135 strain fermentation, to Vibrio anguillarum (Vibrio anguillarum), vibrio parahaemolytious (Vibrio parahemolyticus) and vibrio alginolyticus (Vibrio Alginolyticus) there is preferable inhibitory activity, can be used as anti-vibrios agent, have a extensive future.
Specific embodiment
Embodiment 1
(1) culture of marine fungi HBU-135 strain
Culture medium used in the Spawn incubation of marine fungi HBU-135 contain glucose 1.0wt%, yeast extract 0.1wt%, Peptone 0.2wt%, agar 1.0wt%, coarse sea salt 3.0wt%, remaining is water, and test tube slant, marine fungi is made in when use HBU-135 bacterial strain is cultivated 3 days at 28 DEG C.
(2) fermented and cultured of marine fungi HBU-135
Fermentation medium used in the fermented and cultured of marine fungi HBU-135 is to contain potato in each 1000mL conical flask 80g (boiling removes soil dynamic test after twenty minutes), glucose 20g, MgCl213g, water 400mL, bacterial strain are cultivated in 28 DEG C of standing for fermentation 45 days, obtain fermentation material；It is fermented altogether using 200 1000mL conical flasks.
(3) the separation analysis of Azaphilones class
Step (2) resulting fermentation material is taken, is extracted with ethyl acetate 3 times, combined ethyl acetate extract liquor is concentrated under reduced pressure To coarse extract, first carry out normal phase silica gel column chromatography separation, stationary phase: 100~200 mesh silica gel, mobile phase be 1.5vol% methanol/ Methylene chloride mixed solution elutes 5 column volumes, carries out normal phase silica gel column chromatography separation again after eluent concentration, stationary phase: 200~300 mesh silica gel, mobile phase are the ethyl acetate/petroleum ether mixed solution of 40vol%, elute 2 column volumes.
Reversed-phase silica gel column chromatography separation is carried out after eluent concentration, stationary phase is preferably C18Silica gel, mobile phase are preferably 70vol% methanol/water mixed solution elutes 3 column volumes.Sephadex LH20 gel column chromatography is carried out after eluent concentration Separation, mobile phase: methanol, elute 3 column volumes, carry out high performance liquid chromatography separation after eluent concentration, stationary phase: half prepares Silica gel chromatographic column, ViridisTMSilica 2-Ethylpyridine, 5 μm, 10 × 250mm, mobile phase is 90vol% petroleum Ether/alcohol mixed solution；Daicel IA column is partly prepared, 5 μm, 10 × 250mm, mobile phase is mixed for 75vol% petroleum ether/ethyl alcohol Solution is closed, preparative separation obtains compound 1 (9.5mg), compound 2 (9.0mg), compound 3 (8.4mg), compound 4 (8.0mg), structural identification data difference are as follows:
Compound 1Yellow oily；[α]D 20+13.6(c 0.20,MeOH)；UV(MeOH), λmax(logε)218(5.11),263(4.23),308(3.60)nm；CD(MeOH),λmax(Δε)226(3.94),236 (2.30),255(4.97),337(-2.70)nm；IR(KBr),vmax 3392,2923,1718,1640,1447,1249,1153, 989cm-1；1H NMR(CD3OD, 500Hz) δ: 6.15 (1H, d, J=2.0Hz, H-6 '), 6.13 (1H, d, J=2.0Hz, H- 4 '), 5.86 (1H, s, H-5), 5.18 (1H, d, J=7.6Hz, H-8), 4.03 (1H, m, H-11), 3.86 (2H, d, J= 10.2Hz, H-12), 3.78 (2H, dd, J=10.2/4.8Hz, H-12), 3.75 (2H, dd, J=10.0/7.2Hz, H-1), 3.66 (2H, dd, J=10.0/10.0Hz, H-1), 3.20 (3H, s, H-13), 3.08 (1H, m, H-8a), 2.74 (2H, d, J= 14.4Hz, H-4), 2.59 (2H, d, J=14.4Hz, H-4), 2.44 (3H, s, H-8 '), 2.29 (2H, dd, J=14.2/ 6.8Hz, H-10), 1.85 (2H, dd, J=14.2/2.7Hz, H-10), 1.22 (3H, s, H-9)；13C NMR(CD3OD,125Hz) δ:198.4(C,C-6),172.0(C,C-1’),166.4(C,C-3’),164.1(C,C-5’),158.9(C,C-4a),145.2 (C,C-7’),124.3(CH,C-5),113.1(CH,C-6’),108.0(C,C-3),105.3(C,C-2’),102.1(CH,C- 4’),81.8(CH,C-11),76.8(CH,C-8),75.1(C,C-7),72.7(CH2,C-12),63.9(CH2,C-1),57.4 (CH3,C-13),45.6(CH2,C-10),43.0(CH2,C-4),40.9(CH,C-8a),25.2(CH3,C-8’),20.4(CH3, C-9).HRESIMS m/z 435.1646[M+H]+(calcd.for C22H27O9,435.1650).
Compound 2Yellow oily；[α]D 20+10.8(c 0.20,MeOH)；UV(MeOH) λmax(logε)218(4.98),263(4.01),308(3.47)nm；CD(MeOH),λmax(Δε)227(3.55),235 (2.96),252(5.35),338(-2.68)nm；IR(KBr),vmax 3390,2925,1722,1645,1449,1252,1160, 982cm-1；1H NMR(CD3OD, 500Hz) δ: 6.14 (1H, d, J=2.0Hz, H-6 '), 6.08 (1H, d, J=2.0Hz, H- 4 '), 5.81 (1H, s, H-5), 5.16 (1H, d, J=7.6Hz, H-8), 4.06 (2H, dd, J=9.4/6.4Hz, H-12), 4.01 (1H, m, H-11), 3.77 (2H, dd, J=10.9/6.6Hz, H-1), 3.67 (2H, m, H-12), 3.65 (2H, m, H-1), 3.19 (3H, s, H-13), 3.06 (1H, m.H-8a), 2.71 (2H, d, J=14.5Hz, H-4), 2.44 (2H, d, J=14.5Hz, H- 4), 2.42 (3H, s, H-8 '), 2.05 (2H, dd, J=14.2/1.6Hz, H-10), 1.99 (2H, dd, J=14.2/7.7Hz, H- 10),1.20(3H,s,H-9)；13C NMR(CD3OD,125Hz)δ:198.4(C,C-6),172.0(C,C-1’),166.4(C,C- 3’),164.1(C,C-5’),159.1(C,C-4a),145.2(C,C-7’),124.3(CH,C-5),113.1(CH,C-6’), 107.5(C,C-3),105.3(C,C-2’),102.1(CH,C-4’),81.1(CH,C-11),76.8(CH,C-8),75.1(C, C-7),73.9(CH2,C-12),63.6(CH2,C-1),58.0(CH3,C-13),44.3(CH2,C-10),42.7(CH2,C-4), 40.9(CH,C-8a),25.2(CH3,C-8’),20.4(CH3,C-9).HRESIMS m/z 435.1643[M+H]+ (calcd.for C22H27O9,435.1650).
Compound 3Yellow oily；[α]D 20+75.2(c1.00,MeOH)；UV(MeOH), λmax(logε)219(4.06),270(3.78),316(3.98)nm；CD(MeOH),λmax(Δε)215(2.76),241(- 1.70),261(2.65),326(-1.00),364(4.96)nm；IR(KBr),vmax 3529,2923,1612,1456,1261, 1051cm-1；1H NMR(Acetone-d6,500Hz)δ:6.33(1H,brs,H-6’),6.26(1H,s,H-4),5.70(1H, Brs, H-4 '), 5.66 (1H, s, H-5), 5.27 (1H, d, J=9.9Hz, H-8), 4.49 (2H, dd, J=10.8/5.1Hz, H- 1), 3.85 (2H, dd, J=12.6/10.8Hz, H-1), 3.54 (2H, m, H-12), 3.52 (1H, m, H-11), 3.46 (3H, s, H-13),3.46(1H,m,H-8a),2.60(3H,s,H-8'),2.42(2H,m,H-10),1.29(3H,s,H-9)；13C NMR (Acetone-d6,125Hz)δ:195.4(C,C-6),171.6(C,C-1’),166.3(C,C-5’),165.5(C,C-3), 164.0(C,C-3’),151.0(C,C-4a),145.1(C,C-7’),116.0(CH,C-5),112.8(CH,C-6’),104.8 (C,C-2’),103.1(CH,C-4’),101.8(CH,C-4),80.3(CH,C-11),76.5(CH,C-8),74.6(C,C-7), 69.1(CH2,C-1),63.8(CH2,C-12),57.8(CH3,C-13),37.4(CH2,C-10),35.5(CH,C-8a),24.8 (CH3,C-8’),19.9(CH3,C-9).HRESIMS m/z 457.1454[M+H]+(calcd.for C22H26O9Na, 457.1469).
Compound 4Yellow oily；[α]D 20+91.0(c1.00,MeOH)；UV(MeOH), λmax(logε)219(4.05),271(3.76),317(4.00)nm；CD(MeOH),λmax(Δε)215(2.61),241(- 1.62),261(2.52),325(-0.96),365(4.71)nm；IR(KBr),vmax 3530,2923,1610,1455,1263, 1049cm-1；1H NMR(Acetone-d6,500Hz)δ:6.32(1H,brs,H-6’),6.26(1H,s,H-4),5.71(1H, Brs, H-4 '), 5.66 (1H, s, H-5), 5.24 (1H, d, J=9.9Hz, H-8), 4.47 (2H, dd, J=10.8/5.1Hz, H- 1), 3.84 (2H, dd, J=12.6/10.8Hz, H-1), 3.53 (2H, m, H-12), 3.50 (1H, m, H-11), 3.42 (1H, m, ), H-8a 3.35 (3H, s, H-13), 2.58 (3H, s, H-8 '), 2.43 (2H, d, J=4.2Hz, H-10), 1.29 (3H, s, H- 9).13C NMR(Acetone-d6,125Hz)δ:195.6(C,C-6),171.5(C,C-1’),166.1(C,C-5’),165.6 (C,C-3),164.0(C,C-3’),151.2(C,C-4a),144.9(C,C-7’),116.0(CH,C-5),112.7(CH,C- 6’),104.7(C,C-2’),103.1(CH,C-4’),101.7(CH,C-4),80.3(CH,C-11),76.4(CH,C-8), 74.6(C,C-7),69.0(CH2,C-1),63.7(CH2,C-12),57.6(CH3,C-13),37.1(CH2,C-10),35.4 (CH,C-8a),2 4.7(CH3,C-8’),19.8(CH3,C-9).HRESIMS m/z 457.1454[M+H]+(calcd.for C22H26O9Na,457.1469).
Embodiment 2
(1) culture of marine fungi HBU-135 strain
Culture medium 10wt% containing glucose, yeast extract 4.0wt%, egg used in the Spawn incubation of marine fungi HBU-135 White peptone 4.0wt%, agar 6.0wt%, coarse sea salt 10wt%, remaining is water, and test tube slant is made in when use, and fungal bacterial strain is 35 It is cultivated 5 days at DEG C.
(2) fermented and cultured of marine fungi HBU-135
Fermentation medium used in the fermented and cultured of marine fungi HBU-135 is to contain potato in each 1000mL conical flask 120g (boiling removes soil dynamic test after twenty minutes), glucose 30g, MgCl220g, water 600mL；Fermentation culture conditions are at 35 DEG C Stationary culture 50 days, obtain fermentation material.
(3) the separation analysis of Azaphilones class compound
Step (2) resulting fermentation material is taken, is extracted with ethyl acetate 4 times, combined ethyl acetate extract liquor is concentrated under reduced pressure To coarse extract, first carry out normal phase silica gel column chromatography separation, stationary phase: 100~200 mesh silica gel, mobile phase are 3vol% methanol/bis- Chloromethanes mixed solution elutes 3 column volumes, carries out normal phase silica gel column chromatography separation again after eluent concentration, stationary phase: 200~300 mesh silica gel, mobile phase are the ethyl acetate/petroleum ether mixed solution of 50vol%, elute 3 column volumes.
Reversed-phase silica gel column chromatography separation is carried out after eluent concentration, stationary phase is preferably C18Silica gel, mobile phase are preferably 60vol% methanol/water mixed solution elutes 3 column volumes.Sephadex LH20 gel column chromatography is carried out after eluent concentration Separation, mobile phase: methanol, elute 5 column volumes, carry out high performance liquid chromatography separation after eluent concentration, stationary phase: half prepares Silica gel chromatographic column, ViridisTMSilica 2-Ethylpyridine, 5 μm, 10 × 250mm, mobile phase is 95vol% petroleum Ether/alcohol mixed solution；Daicel IA column is partly prepared, 5 μm, 10 × 250mm, mobile phase is mixed for 80vol% petroleum ether/ethyl alcohol Solution is closed, preparative separation obtains compound 1-4, and structural identification data and embodiment 1 are consistent.
Other Spawn incubations for not particularly pointed out in Examples 1 and 2, fermentation condition and normal phase silica gel column chromatography separation, Reversed-phase silica gel column chromatography separation, gel column chromatography separation, efficient liquid phase chiral chromatogram separation etc. other experimental operating conditions be The experimental operating conditions of this field routine, those skilled in the art can reasonably be selected according to actual needs.
The anti-vibrios activity of gained azaphilones class compound
(1) antibacterial activity is tested
Using gradient dilution method to Vibrio anguillarum (Vibrio anguillarum), vibrio parahaemolytious (Vibrio Parahemolyticus) and vibrio alginolyticus (Vibrio alginolyticus) carries out active testing.
(2) activity test method
In aseptic superclean bench, takes appropriate bacteria culture liquid medium to be added in blank culture solution and is diluted, Dilution is generally 1:1000 or 1:500.Diluted liquid spawn 198 is taken with sterile liquid-transfering gun (pipette tips pass through sterilization treatment) μ L is added on 96 orifice plates, and 2 μ L samples to be tested are added in first hole, and (crude extract or monomeric compound of DMSO configuration are molten Liquid), doubling dilution is taken turns doing to the 8th concentration gradient with liquid-transfering gun, is shaken and is mixed after dilution, 37 DEG C of culture 12h -20h, Absorbance is measured with microplate reader (630nm), obtains the minimal inhibitory concentration (MIC) of sample.The ultimate density of DMSO is maintained at 1%.Each sample concentration sets three Duplicate Samples, in addition sets blank control, negative control (DMSO) and positive control (cyclopropyl Sha Xing), the results are shown in Table 1 for the minimal inhibitory concentration (MIC) of measurement.
(3) active testing result
Table 1:
Test result shows that compound 1-4 shows different inhibitory activity to three plants of vibrio marinopraesens.Compound 1 and 2 pair Vibrio alginolyticus V.alginolyticus has certain inhibitory activity, and minimum inhibitory concentration MIC value is 25.0 μ g/mL.Chemical combination Object 3 and 4 pair Vibrio anguillarum V.anguillarum and vibrio parahaemolytious V.parahemolyticus show stronger inhibitory activity, Wherein compound 3 is 12.5 and 6.25 μ g/mL respectively to the minimum inhibitory concentration MIC value of two plants of vibrios, and compound 4 is to two plants of arcs The minimum inhibitory concentration MIC value of bacterium is 6.25 and 25.0 μ g/mL respectively.Experiment shows azaphilones class chemical combination of the invention Object has inhibitory activity to Vibrio, can be made into anti-vibrios agent, be with a wide range of applications.

Claims (10)

1. a kind of marine fungi, characterized in that the marine fungi be lattice spore bacterium (Pleosporales Sp.) HBU-135 bacterium Strain, the deposit date is on October 18th, 2018, deposit number was CGMCC No.16379, and depositary institution is Chinese microorganism strain Preservation administration committee common micro-organisms center, depositary institution address are Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3.
2. a kind of marine fungi source azaphilones class compound, characterized in that the structural formula of the compound are as follows:
、、Or。
3. a kind of preparation method of azaphilones class compound in marine fungi source as claimed in claim 2, characterized in that Include the following steps:
(1) by lattice spore bacterium described in claim 1 (Pleosporales Sp.) HBU-135 strain inoculated is in bacterium culture medium Carry out Spawn incubation；
(2) it after the completion of Spawn incubation, is inoculated in fermentation medium and is fermented, obtain fermentation material；
(3) fermentation material is carried out extraction 2-4 times with ethyl acetate, thick leaching is concentrated under reduced pressure to give after combined ethyl acetate extract liquor Cream；
(4) chromatographic isolation is carried out up to the azaphilones class compound to gained coarse extract, the chromatographic isolation be according to Secondary progress normal phase silica gel column chromatography separation, reversed-phase silica gel column chromatography separation, gel column chromatography separation and high performance liquid chromatography separation.
4. the preparation method of azaphilones class compound in marine fungi source according to claim 3, characterized in that In step (1), the bacterium culture medium are as follows: 1.0-10wt% of glucose, 0.1-4.0wt% of yeast extract, 0.2-4.0wt% of peptone, 1.0-6.0wt% of agar, 3.0-10wt% of coarse sea salt, remaining is water；Spawn incubation temperature is 15-35 DEG C, and incubation time is 3-10 It.
5. the preparation method of azaphilones class compound in marine fungi source according to claim 3, characterized in that In step (2), the fermentation medium of per unit part includes: 40-120 g of potato, glucose 10-30 g, MgCl2 5– 20 g, 200-600 mL of water；Fermentation culture conditions are stationary culture 20-50 days at 15-35 DEG C.
6. the preparation method of azaphilones class compound in marine fungi source according to claim 3, characterized in that In step (4), the normal phase silica gel column chromatography separation are as follows: first use stationary phase for 100 ~ 200 mesh silica gel, mobile phase is 1.5- 3vol% ethanol/methylene mixed solution is eluted, and elution volume is 35 column volumes, after gained eluent is concentrated again Use stationary phase for 200 ~ 300 mesh silica gel, mobile phase is that 40-50vol% ethyl acetate/petroleum ether mixed solutions are eluted, and is washed Lift-off product is 23 column volumes.
7. the preparation method of azaphilones class compound in marine fungi source according to claim 3, characterized in that In step (4), the stationary phase that the reversed-phase silica gel column chromatography separation uses is C18Silica gel, mobile phase are 60-70vol% methanol/waters Mixed solution, elution volume are 23 column volumes.
8. the preparation method of azaphilones class compound in marine fungi source according to claim 3, characterized in that In step (4), the stationary phase of the gel column chromatography separation is sephadex LH-20, and mobile phase is methanol, elution volume 3 5 column volumes.
9. the preparation method of azaphilones class compound in marine fungi source according to claim 3, characterized in that In step (4), the chromatographic column that uses in the high performance liquid chromatography separation is partly prepares silica gel chromatographic column, ViridisTM Silica 2-Ethylpyridine, 5 μm, 10 × 250 mm, mobile phase is 90-95vol% petroleum ethers/alcohol mixed solution； Daicel IA column is partly prepared, 5 μm, 10 × 250 mm, mobile phase is 75-85vol% petroleum ethers/alcohol mixed solution.
10. a kind of marine fungi source azaphilones class compound is preparing the application in anti-vibrios drug, characterized in that The anti-vibrios drug is using compound as claimed in claim 2 or its pharmaceutically acceptable salt as effective component.
CN201910049568.5A 2019-01-18 2019-01-18 Marine fungus-derived azaphilones compound, preparation method thereof and application thereof in preparation of anti-vibrio drugs Active CN109694827B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910049568.5A CN109694827B (en) 2019-01-18 2019-01-18 Marine fungus-derived azaphilones compound, preparation method thereof and application thereof in preparation of anti-vibrio drugs

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910049568.5A CN109694827B (en) 2019-01-18 2019-01-18 Marine fungus-derived azaphilones compound, preparation method thereof and application thereof in preparation of anti-vibrio drugs

Publications (2)

Publication Number Publication Date
CN109694827A true CN109694827A (en) 2019-04-30
CN109694827B CN109694827B (en) 2022-08-12

Family

ID=66234080

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910049568.5A Active CN109694827B (en) 2019-01-18 2019-01-18 Marine fungus-derived azaphilones compound, preparation method thereof and application thereof in preparation of anti-vibrio drugs

Country Status (1)

Country Link
CN (1) CN109694827B (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110776518A (en) * 2019-11-28 2020-02-11 云南大学 Azaphilone spiro compounds and preparation method and application thereof
CN111321083A (en) * 2020-03-27 2020-06-23 河北大学 Marine fungus-derived azaphilones dimer compound and application thereof in antitumor agent
CN111411045A (en) * 2020-03-27 2020-07-14 河北大学 Marine fungus-derived azaphilones dimer compound and preparation method thereof
CN111423987A (en) * 2020-03-27 2020-07-17 河北大学 Marine fungus-derived azaphilones dimer compound and application thereof in antituberculosis drugs
CN114606135B (en) * 2022-01-24 2023-09-29 宁波大学 Sponge coanda fungus and application thereof in preparation of sterols

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108660082A (en) * 2018-06-15 2018-10-16 河北大学 A kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and the application in preparing antiseptic
CN108753627A (en) * 2018-06-15 2018-11-06 河北大学 A kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and the application in preparing antitumor agent

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108660082A (en) * 2018-06-15 2018-10-16 河北大学 A kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and the application in preparing antiseptic
CN108753627A (en) * 2018-06-15 2018-11-06 河北大学 A kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and the application in preparing antitumor agent

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
丁爽爽: "一株真菌Talaromyces aculeatus中azaphilones类次级代谢产物及其生物活性", 《中国优秀硕士学位论文全文数据库（电子期刊》, no. 3, 15 March 2017 (2017-03-15), pages 10 *
曹飞等: "1株渤海来源真菌Pleosporales sp.中azaphilones类化合物及其生物活性", 《中国海洋药物》, vol. 35, no. 03, 15 June 2016 (2016-06-15), pages 6 - 11 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110776518A (en) * 2019-11-28 2020-02-11 云南大学 Azaphilone spiro compounds and preparation method and application thereof
CN111321083A (en) * 2020-03-27 2020-06-23 河北大学 Marine fungus-derived azaphilones dimer compound and application thereof in antitumor agent
CN111411045A (en) * 2020-03-27 2020-07-14 河北大学 Marine fungus-derived azaphilones dimer compound and preparation method thereof
CN111423987A (en) * 2020-03-27 2020-07-17 河北大学 Marine fungus-derived azaphilones dimer compound and application thereof in antituberculosis drugs
CN111321083B (en) * 2020-03-27 2023-05-16 河北大学 Ocean fungus source azaphilines dimer compound and application thereof in antitumor agent
CN114606135B (en) * 2022-01-24 2023-09-29 宁波大学 Sponge coanda fungus and application thereof in preparation of sterols

Also Published As

Publication number Publication date
CN109694827B (en) 2022-08-12

Similar Documents

Publication Publication Date Title
CN109694827A (en) Marine fungi source azaphilones class compound and preparation method thereof and preparing the application in anti-vibrios drug
LU501210B1 (en) Streptomyces antibioticus, preparation of metabolite thereof, and use thereof in antibacterial aspect
CN109706086A (en) A kind of marine fungi source azaphilones class compound and its preparation method and application
CN108753627A (en) A kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and the application in preparing antitumor agent
CN108660082A (en) A kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and the application in preparing antiseptic
CN101974464A (en) Streptomyces and process for preparing antimycin antibiotics by fermentation using same
CN103740606A (en) Streptomyces phytohabitans, method for producing new antibiotics Novonestmycin from Streptomyces phytohabitans, and application of Novonestmycin
CN102030791A (en) Four tiacumicin compounds as well as preparation methods and applications thereof in preparing antimicrobial agents
CN113005048B (en) Streptomyces nigricans CYS22, metabolite thereof and application thereof
CN111423987B (en) Marine fungus-derived azaphilones dimer compound and application thereof in antituberculosis drugs
CN111411045B (en) Marine fungus-derived azaphilones dimer compound and preparation method thereof
CN108794368A (en) A kind of alkaloid compound and preparation method and application with various bacteriostatic activity
CN111072670B (en) Diketopiperazine compound and preparation method and application thereof
CN108660093B (en) Marine streptomycete and tunicamycin compound and preparation method thereof
CN109400444B (en) Sesquiterpenoids for inhibiting plant pathogenic fungi and preparation method thereof
CN106047751B (en) Separation method and the application of one plant of quasi- promise Cattell actinomyces and its active metabolite
CN109234175A (en) The Fusarium oxysporum DCLZJ-4 bacterial strain and application thereof of one plant of production chonglou saponin
CN108467398A (en) A kind of diketopiperazine compound and its preparation and application
CN108727169A (en) A kind of preparation method of the biphenyl ether compound in marine fungi source and the application as antiseptic
CN102993168B (en) Streptonigrin analog and preparation method thereof, purposes
CN100465188C (en) Novel antibiotic Chemomycin A, B, C, D and preparation method thereof
CN115247131B (en) Trichoderma atroviride and metabolite and application thereof
JPH0374388A (en) Novel microbiologically transformed l-683, 590 products
CN109576319B (en) Fermentation medium without viable bacteria
CN111321083B (en) Ocean fungus source azaphilines dimer compound and application thereof in antitumor agent

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant