CN111411045A - Marine fungus-derived azaphilones dimer compound and preparation method thereof - Google Patents
Marine fungus-derived azaphilones dimer compound and preparation method thereof Download PDFInfo
- Publication number
- CN111411045A CN111411045A CN202010232233.XA CN202010232233A CN111411045A CN 111411045 A CN111411045 A CN 111411045A CN 202010232233 A CN202010232233 A CN 202010232233A CN 111411045 A CN111411045 A CN 111411045A
- Authority
- CN
- China
- Prior art keywords
- strain
- azaphilones
- silica gel
- chromatographic separation
- derived
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D311/00—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
- C07D311/02—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
- C07D311/76—Benzo[c]pyrans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D311/00—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
- C07D311/02—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
- C07D311/94—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems condensed with rings other than six-membered or with ring systems containing such rings
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/16—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing two or more hetero rings
- C12P17/162—Heterorings having oxygen atoms as the only ring heteroatoms, e.g. Lasalocid
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Tropical Medicine & Parasitology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention provides an azaphilones dimer compound derived from marine fungi and a preparation method thereof, wherein the marine fungi is Grifola frondosa (Grifola frondosa)Pleosporalessp.) HBU-135 strain with preservation date of 2018, 10 and 18 months, preservation number of CGMCC No.16379, preservation unit of China general microbiological culture Collection center, and preservation unit address of No. 3 of Xilu No.1 of Beijing Korean district. The structural formula of the compound is shown as formula 1 orAnd (3) shown in formula 2. Culturing Geobacillus by fermentation (Pleosporalessp.) HBU-135 strain and isolating the above compound from the fermentation product.
Description
Technical Field
The invention relates to the field of marine natural medicinal chemistry, in particular to an azaphilones dimer compound derived from marine fungi and a preparation method thereof.
Background
The ocean accounts for about 71 percent of the total surface area of the earth, contains abundant and various biological resources, and is a valuable resource bank for human to research and develop medicines. Since the 40's of the 20 th century, various marine-derived drugs represented by cephalosporin, cytarabine and ET-743 have been successfully used clinically. Almost all marine organisms produce biologically active secondary metabolites. Among them, marine fungus microbial resources are one of the most important sources of marine drugs because of the advantages of abundant metabolites and repeatable fermentation. Antineoplastic active compounds represented by azaphilones compounds derived from marine fungi have become a bright spot in modern marine medicine research. However, no reports on [2+2] dimerized azaphilones compounds derived from marine fungi and antitumor activities thereof are found at home and abroad up to now.
Disclosure of Invention
The invention aims to provide a marine fungus-derived azaphilones dimer compound and a preparation method thereof, and aims to solve the problems that the type and anti-tumor activity of the marine fungus-derived azaphilones compound are limited in the prior art.
The purpose of the invention is realized by the following technical scheme: the marine fungus is a botrytis cinerea (Pleospora sp.) HBU-135 strain, the preservation date is 2018, 10 and 18 days, the preservation number is CGMCC No.16379, the preservation unit is the China general microbiological culture Collection center, and the preservation unit address is No. 3 of Xilu No.1 Kyor of Indormiton, Beijing.
1. Sample source
The marine fungus HBU-135 strain was isolated from a marine sediment sample collected from Huang Ye hong Kong sea area of Cangzhou, Hebei, 2015 at 6 months. And (3) immediately storing the collected seabed sediment sample in a refrigerator at the temperature of-20 ℃, and sending the sample to a laboratory for subsequent fungus separation.
2. Isolation of fungi
2.1 selection of the culture Medium
(1) PDA culture medium
200g of potato (peeled), 20g of glucose, 30g of sea salt, 20g of agar and 1000m of water L, 25 mu g/m of streptomycin sulfate L and 25 mu g/m of L ampicillin are added when the fungus is separated, and the growth of bacteria is inhibited.
(2) Salt-free PDA culture medium
200g of potato (peeled), 20g of glucose, 20g of agar and 1000m of water L. when the fungus is isolated, 25 μ g/m L streptomycin sulfate and 25 μ g/m L ampicillin are added to inhibit bacterial growth (no salt PDA compared with salt PDA).
(3) Monglara red medium
200g of potato (peeled), 20g of glucose, 30g of sea salt, 33mg of rose Bengal (rose Bengal) (inhibiting the spread and growth of fast-growing moulds), 20g of agar and 1000m of water L.
2.2 separation and purification of fungi
Placing the marine sediment sample in a sterile glass container, adding 1m L sterile water to adjust to be sticky, taking out 0.1m L of the liquid, diluting the liquid by 10 times, 100 times and 1000 times respectively by the sterile water to obtain homogenate with 4 concentration gradients, respectively taking 0.2m L of the homogenate with a sterile pipette, respectively adding the homogenate into PDA, salt-free PDA and Bengal culture media, uniformly coating the homogenate with a coater, respectively making three parallels for each concentration gradient, sealing the parallels with sealing films, writing numbers, and performing the separation experiments under sterile conditions.
And respectively putting the culture mediums added with the samples into a constant temperature box with the temperature of 28 ℃, and carrying out inverted culture. Generally, colonies or mycelia grow out of the edge of the culture medium or tissue pieces after 5-8 days of culture (the bacteria grow fast, and colonies grow out after 2-3 days). The bacterial colony or mycelium tip is picked up by an inoculating needle, transferred to a new plate, and separated and purified for several times to obtain the pure fungus strain. The fungus isolation work was typically carried out for 35 d. The examination was performed every day for the first two weeks and every 3-4 d thereafter. Once new colonies or mycelia are found to grow, they are transferred to new plates.
3. Screening of strains
The method comprises the steps of adopting an activity screening and chemical screening combined method to screen a target strain, carrying out small-scale fermentation (2 bottles) on the strain to obtain a crude extract, carrying out an antibacterial activity test on the crude extract, taking the inhibitory activity on tumor cells as one of investigation factors for screening the target strain, carrying out HP L C fingerprint analysis on the crude extract, taking the secondary metabolite amount as the second investigation factor for screening the target strain, finally determining the strain HBU-135 with high antibacterial activity and rich secondary metabolites as the target strain, and identifying the target strain.
4. Identification of strains
Culturing on PDA culture medium plate for 3-7 days, growing fungus to optimum state, picking a small amount of hypha on single colony with sterilizing gun head, placing into EP tube containing 50 μ L L ysis buffer, thermally denaturing in 80 deg.C water bath for 15min, centrifuging at 8000rpm for 1min, and collecting supernatant of 3 μ L as template DNA of PCR reaction.
Primers used for amplification and sequencing were ITS1 and ITS4, with the top and bottom primer sequences:
ITS1：TCCGTAGGTGAACCTGCGG
ITS4：TCCTCCGCTTATTGATATGC
the PCR reaction system is a 40 mu L system and comprises:
the amplification conditions were:
the PCR amplification product was sequenced by 0.8% agarose gel, 0.5 × TBE electrophoresis buffer sample, 5V/cm voltage, loading 5 μ L electrophoresis detection, DNA Marker indicating molecular weight, gel imager observation and photography, and finally identified as Geospora sp.
A marine fungus-derived azaphilones dimer compound has a structural formula as follows:
the preparation method of the azaphilones compound derived from the marine fungi comprises the following steps:
(1) inoculating the Geospora sp (Pleosporales sp.) HBU-135 strain of claim 1 into a seed culture medium for seed culture;
(2) after the strain is cultured, inoculating the strain into a fermentation medium for fermentation to obtain a fermented product;
(3) extracting the fermented product with ethyl acetate for 2-4 times, mixing ethyl acetate extractive solutions, and concentrating under reduced pressure to obtain crude extract;
(4) and (3) carrying out chromatographic separation on the obtained crude extract to obtain the azaphilones dimer compound, wherein the chromatographic separation is sequentially carrying out normal phase silica gel column chromatographic separation, reverse phase silica gel column chromatographic separation, gel column chromatographic separation and high performance liquid chromatographic separation.
In the step (1), the strain culture medium is as follows: 1.0-10 wt% of glucose, 0.1-4.0 wt% of yeast extract, 0.2-4.0 wt% of peptone, 1.0-6.0 wt% of agar, 3.0-10 wt% of crude sea salt and the balance of water; the culture temperature of the strain is 15-35 deg.C, and the culture time is 3-10 days.
In the step (2), each unit of the fermentation culture medium comprises 40-120 g of potatoes (dregs are removed after boiling for 20 minutes), 10-30 g of glucose and CaCl25-40 g of water 200-600 m L, and the fermentation culture condition is that the mixture is cultured for 10-20 days at 15-35 ℃ by a shaking table.
In the step (4), the normal phase silica gel column chromatographic separation is as follows: eluting by using 100-200-mesh silica gel as a stationary phase and 1.5-3 vol% of methanol/dichloromethane mixed solution as a mobile phase, wherein the elution volume is 3-5 column volumes, concentrating the obtained eluent, eluting by using 200-300-mesh silica gel as a stationary phase and 25-30 vol% of ethyl acetate/petroleum ether mixed solution as a mobile phase, and the elution volume is 2-3 column volumes.
In the step (4), the stationary phase of the gel column chromatographic separation is sephadex L H-20, the mobile phase is 40-60 vol% methanol/dichloromethane mixed solution for elution, and the elution volume is 3-5 column volumes.
In the step (4), the stationary phase adopted by the reversed phase silica gel column chromatographic separation is C18Silica gel, mobile phase is 60-70 vol% AMixed alcohol/water solution, elution volume is 2-3 column volumes.
In the step (4), the chromatographic column adopted in the high performance liquid chromatography separation is semi-preparative C18Column, XBridgeOBD, 5 μm,10 × 250mm, mobile phase 70-90 vol% methanol/water mixed solution.
In another embodiment of the present invention, there is provided an antitumor agent characterized by comprising a compound of formula 1 or 2 or a pharmaceutically acceptable salt thereof as an active ingredient.
The invention also provides application of the compounds shown in the formulas 1 and 2 or pharmaceutically acceptable salts thereof in preparing medicines for preventing and/or treating tumor diseases caused by human breast cancer cells (MDA-MB-231 and MCF-7), gastric cancer cells (MGC-803), cervical cancer cells (He L a) and lung epithelial cancer cells (A-549).
The use of a compound of formulae 1 and 2, or a pharmaceutically acceptable salt thereof, as hereinbefore described in the manufacture of an anti-tumour agent.
The term "pharmaceutically acceptable salts" as used herein refers to non-toxic inorganic or organic acid and/or base addition salts, as described in "Salt selection for basic drugs", int.J.pharm. (1986),33, 201-217.
The azaphilones dimer compounds shown in formula 1 and formula 2 obtained from marine fungi Pleosporales sp have strong inhibitory activity on human breast cancer cells (MDA-MB-231 and MCF-7), gastric cancer cells (MGC-803), cervical cancer cells (He L a) and lung epithelial cancer cells (A-549), and can be used as antitumor drugs, so that the application prospect is wide.
Detailed Description
Example 1
(1) Culture of marine fungus HBU-135 strain
A culture medium used for culturing the strain of the marine fungus HBU-135 contains 1.0 wt% of glucose, 0.1 wt% of yeast extract, 0.2 wt% of peptone, 1.0 wt% of agar, 3.0 wt% of crude sea salt and the balance of water, a test tube inclined plane is prepared when the culture medium is used, and the strain of the marine fungus HBU-135 is cultured for 3 days at the temperature of 28 ℃.
(2) Fermentation culture of marine fungus HBU-135
Fermentation culture of marine fungus HBU-135The fermentation medium used is 100g of potato (removing potato dregs after boiling in water for 20 min), 20g of glucose, CaCl in each 1000m L conical flask233g and 500m of water L, and carrying out shake fermentation culture on the strains at 28 ℃ for 14 days to obtain a fermentation product, and fermenting by using 20 conical flasks of 1000m L in total.
(3) Isolation analysis of Azaphilones dimers
Extracting the fermentation product obtained in the step (2) with ethyl acetate for 3 times, combining ethyl acetate extraction liquids, concentrating under reduced pressure to obtain a crude extract, and performing normal phase silica gel column chromatographic separation firstly, wherein the stationary phase is as follows: 100-200 mesh silica gel, wherein the mobile phase is 1.5 vol% methanol/dichloromethane mixed solution, 5 column volumes are eluted, the eluent is concentrated and then normal phase silica gel column chromatographic separation is carried out again, and the stationary phase: 200-300 mesh silica gel, the mobile phase is 25 vol% ethyl acetate/petroleum ether mixed solution, 2 column volumes elute.
Concentrating the eluate, separating with Sephadex L H20 gel column chromatography, eluting with 50 vol% methanol/dichloromethane mixed solution as mobile phase, eluting for 3 column volumes, concentrating the eluate, separating with reverse phase silica gel column chromatography, preferably with stationary phase C18Silica gel, mobile phase is preferably 70vol% methanol/water mixture, elution 3 column volumes. Concentrating the eluent, separating by high performance liquid chromatography, and fixing the phases: semi-preparation of C18The column, XBridge OBD,5 μm,10 × 250mm, mobile phase 80 vol% methanol/water mixed solution, was prepared and isolated to give compound 1(10.6mg), compound 2(22.0mg), the structure confirmation data of which are as follows:
compound 1
Yellow oil [ α]D 20+160(c 1.00,MeOH)；UV(MeOH),λmax(log)216(3.00),267(1.91),308(1.07)nm；ECD(c 0.02，MeOH)，λmax(Δ)222(-46.0)，249(31.8)，331(19.5)nm；11H NMR(DMSO-d6,600MHz):10.39,(1H,brs，17-OH),10.34,(1H,brs,17′-OH)，9.85,(1H,brs,15-OH),9.85,(1H,brs,15′-OH),6.18,(1H,brs,H-16),6.18,(1H,brs,H-18),6.18,(1H,brs,H-16′),6.18,(1H,brs，H-18′)，5.95，(1H，dt，J＝15.6/4.8Hz，H-11),5.89,(1H,d,J＝15.6Hz,H-10),5.74，(1H,brs,H-4′),5.71,(1H,brs,H-5′),5.05,(1H,d,J＝9.6Hz,H-8′),4.93,(1H,d,J＝12.0Hz,H-8),4.80,(1H,brs,12′-OH),4.77,(1H,brs,H-4),4.75,(1H,brs,12-OH),4.67,(1H,dd,J＝10.8/4.8Hz,H-1′a),4.43,(1H,d,J＝10.8Hz,H-1a),3.99,(2H,brs,H-12),3.71,(1H,dd,J＝13.2/10.8Hz,H-1′b),3.50,(1H,d,J＝10.8Hz,H-1b),3.45,(1H,m,H-12′a),3.37,(1H,m,H-12′b),3.28,(1H,m,H-11′),3.17,(1H,m,H-8a′),3.02,(1H,d,J＝12.0Hz,H-8a),2.96,(1H,d,J＝10.2Hz,H-10′),2.70,(1H,d,J＝9.6Hz,H-5),2.29,(3H,s,H-20),2.26,(3H,s,H-20′),1.20，(3H，s，H-9′)，1.16，(3H,s,H-9)；13C NMR(DMSO-d6,150MHz):206.3,(C,C-6),194.7,(C,C-6′),168.5,(C,C-13′),168.0，(C,C-13),162.5,(C,C-3′),160.4,(C,C-15)，160.3，(C,C-15′)，159.2，(C，C-17)，158.6,(C,C-17′),150.2,(C,C-3),149.3,(C,C-4a′),140.0,(C,C-19),139.2,(C,C-19′),131.1，(CH,C-11),123.5,(CH,C-10),115.9,(CH,C-5′),109.9,(CH,C-16),109.6,(CH,C-16′),109.3,(C,C-14′),109.3,(C,C-14),107.4,(CH,C-4),102.7,(CH,C-4′),100.3,(CH,C-18),100.2,(CH,C-18′),75.7,(C,C-7),74.9,(CH,C-8),73.3,(C,C-7′),73.0,(CH,C-8′),67.3,(CH2,C-1′),63.1,(CH2,C-1),60.7,(CH2,C-12),60.1,(CH2,C-12′),49.5,(CH,C-5),49.1,(CH,C-10′),41.5,(CH,C-11′),40.6,(C,C-4a),34.2,(CH,C-8a′),31.4,(CH,C-8a)，20.9，(CH3，C-20′)，21.2，(CH3，C-20)，19.6,(CH3,C-9),19.2,(CH3,C-9′).HRESIMS m/z 803.2512[M-H]-(calcd for C42H43O16,803.2557).
Compound 2
Yellow oil [ α]D 20+62(c 1.00,MeOH)；UV(MeOH),λmax(log)217(2.87),268(1.82),312(2.40)nm；ECD(c 0.02,MeOH),λmax(Δ)267(13.1),305(-93.4),338(35.7)nm；1H NMR(DMSO-d6,600MHz):10.44,(1H,brs,17/17′-OH),9.89,(1H,brs,15/15′-OH),6.19,(1H,brs,H-18/18′),6.18，(1H，brs，H-16/16′)，5.71,(1H,brs,H-4/4′),5.68,(1H,brs,H-5/5′),5.03,(1H,dt，J＝10.2Hz,H-8/8′),4.65，(1H，dt,J＝10.8/4.8Hz,H-1a/1′a)，4.61，(1H，brs，12/12′-OH)，3.74，(1H，dt，J＝13.2/10.8Hz，H-1b/1′b),3.41,(2H,brs,H-12/12′),3.19,(1H,m,H-8a/8a′),2.89,(1H,d,J＝8.4Hz,H-10/10′),2.26，(1H,m,H-11/11′),2.29,(1H,s,H-20/20′)，1.19，(3H,s，H-9/9′)；13C NMR(DMSO-d6,150MHz):194.6,(C,C-6/6′),168.6,(C,C-13/13′),166.1,(C,C-3/3′),160.5,(C,C-15/15′),159.2,(C,C-17/17′),150.0,(C,C-4a/4a′),115.4,(CH,C-5/5′),109.6,(CH,C-16/16′),109.2,(C,C-14/14′),100.3,(CH,C-18/18′),100.2,(CH,C-4/4′),75.0,(CH,C-8/8′),73.2,(C,C-7/7′),67.8,(CH2,C-1/1′),61.5,(CH2,C-12/12′),40.6,(CH,C-10/10′),40.2,(CH,C-11/11′),34.3,(CH,C-8a/8a′),21.2，(CH3，C-20/20′)，19.2，(CH3，C-9/9′).HRESIMS m/z 805.2709[M+H]+(calcd for C42H45O16，805.2702).
Example 2
(1) Culture of marine fungus HBU-135 strain
A culture medium for culturing the strain of marine fungus HBU-135 contains glucose 10wt%, yeast extract 4.0wt%, peptone 4.0wt%, agar 6.0wt%, crude sea salt 10wt%, and water in balance, and is prepared into a test tube slant when used, and the fungus strain is cultured at 35 deg.C for 5 days.
(2) Fermentation culture of marine fungus HBU-135
The fermentation culture medium for fermentation culture of marine fungus HBU-135 comprises 120g of potato (removing potato residue after boiling in water for 20 min), 30g of glucose, and CaCl in each 1000m L conical flask240g of water 600m L, and the fermentation culture condition is that the mixture is cultured for 20 days at 35 ℃ by a shaking table to obtain a fermentation product.
(3) Isolation analysis of Azaphilones dimer compounds
Extracting the fermentation product obtained in the step (2) with ethyl acetate for 4 times, combining ethyl acetate extraction liquids, concentrating under reduced pressure to obtain a crude extract, and performing normal phase silica gel column chromatographic separation firstly, wherein the stationary phase is as follows: 100-200 mesh silica gel, the mobile phase is 3vol% methanol/dichloromethane mixed solution, 3 column volumes are eluted, normal phase silica gel column chromatographic separation is carried out again after the eluent is concentrated, and the stationary phase: 200-300 mesh silica gel, the mobile phase is 30vol% ethyl acetate/petroleum ether mixed solution, and 3 column volumes are eluted.
Concentrating the eluate, separating with Sephadex L H20 gel column chromatography, eluting with 60vol% methanol/dichloromethane mixed solution as mobile phase, eluting for 5 column volumes, concentrating the eluate, separating with reverse phase silica gel column chromatography, preferably with stationary phase C18Silica gel, the mobile phase is preferably a 60vol% methanol/water mixture, eluting 5 column volumes. Concentrating the eluent, separating by high performance liquid chromatography, and fixing the phases: semi-preparation of C18The column, XBridge OBD,5 μm,10 × 250mm, mobile phase 90vol% methanol/water mixed solution, was prepared to isolate compounds 1 and 2, the structure confirmation data of which is consistent with example 1.
The conditions for culturing and fermenting other strains, which are not specifically indicated in examples 1 and 2, and other experimental operating conditions such as normal phase silica gel column chromatographic separation, reverse phase silica gel column chromatographic separation, high performance liquid chiral chromatographic separation and the like are conventional experimental operating conditions in the art, and can be reasonably selected by a person skilled in the art according to actual needs.
The obtained azaphilones dimer compound has antitumor activity
(1) Antitumor Activity test
The MTT method was used to test the in vitro inhibitory activity against human breast cancer cells (MDA-MB-231 and MCF-7), gastric cancer cells (MGC-803), cervical cancer cells (He L a) and lung epithelial cancer cells (A-549).
(2) Activity test method
According to the cell growth rate, a certain number of cells in the logarithmic growth phase are inoculated into a 96-well culture plate at the concentration of 90 mu L/well, a sample to be tested is added into the 96-well culture plate at the concentration of 10 mu L/well after the cells are cultured for 24h, each concentration gradient is performed in three parallels for each cell strain, the cells are cultured at the temperature of 37 ℃ and the concentration of 5 percent CO2After culturing for 48h under the condition, adding MTT (Sigma) solution 5mg/m L, preparing 2 with physiological saline0 mu L per well, culturing for 4h, adding triple solution (10% SDS-5% isobutanol-0.01 mol/L HCl)50 mu L per well, and placing in CO2The incubator was overnight. The OD 570 values were then measured with a microplate reader. Doxorubicin served as a positive control.
(3) Results of Activity test
IC for inhibiting tumor cell line50The values (. mu.M) are shown in Table 1.
Table 1:
test results show that the compound 1 can selectively inhibit the growth of lung epithelial cancer cells (A-549), and the compound 2 has strong inhibition effects on human breast cancer cells (MDA-MB-231 and MCF-7), gastric cancer cells (MGC-803), cervical cancer cells (He L a) and lung epithelial cancer cells (A-549).
Claims (6)
1. A marine fungus, which is characterized in that the marine fungus is Geospora (Grifola Frondosa)Pleosporalessp.) HBU-135 strain with preservation date of 2018, 10 and 18 months, preservation number of CGMCC No.16379, preservation unit of China general microbiological culture Collection center, and preservation unit address of No. 3 of Xilu No.1 of Beijing Korean district.
2. The azaphilones dimer compound derived from marine fungi is characterized in that the structural formula of the compound is shown in the specification
3. The preparation method of the marine fungus-derived azaphilones dimer compound as claimed in claim 2, which is characterized by comprising the following steps:
(1) will rightGrifola according to claim 1 (A)Pleosporalessp.) the HBU-135 strain is inoculated in a strain culture medium for strain culture;
(2) after the strain is cultured, inoculating the strain into a fermentation medium for fermentation to obtain a fermented product;
(3) extracting the fermented product with ethyl acetate for 2-4 times, mixing ethyl acetate extractive solutions, and concentrating under reduced pressure to obtain crude extract;
(4) and (3) carrying out chromatographic separation on the obtained crude extract to obtain the azaphilones dimer compound, wherein the chromatographic separation is sequentially carrying out normal phase silica gel column chromatographic separation, reverse phase silica gel column chromatographic separation and high performance liquid chromatographic separation.
4. The method for preparing marine fungus-derived azaphilones dimer compounds as claimed in claim 3, wherein in step (1), the strain culture medium is: 1.0-10 wt% of glucose, 0.1-4.0 wt% of yeast extract, 0.2-4.0 wt% of peptone, 1.0-6.0 wt% of agar, 3.0-10 wt% of crude sea salt and the balance of water; the culture temperature of the strain is 15-35 deg.C, and the culture time is 3-10 days.
5. The method for preparing marine fungus-derived azaphilones dimers as claimed in claim 3, wherein in the step (2), the fermentation medium comprises per unit serving: 40-120 g of potato, 10-30 g of glucose and CaCl25-40 g of water 200-600 m L, and the fermentation culture condition is that the mixture is cultured for 10-20 days at 15-35 ℃ by a shaking table.
6. The method for preparing marine fungus-derived azaphilones dimer compounds as claimed in claim 3, wherein the step (4):
the normal phase silica gel column chromatographic separation is as follows: eluting by using 100-200-mesh silica gel as a stationary phase and 1.5-3 vol% of methanol/dichloromethane mixed solution as a mobile phase, wherein the elution volume is 3-5 column volumes, concentrating the obtained eluent, eluting by using 200-300-mesh silica gel as a stationary phase and 25-30 vol% of ethyl acetate/petroleum ether mixed solution as a mobile phase, and the elution volume is 2-3 column volumes;
the stationary phase of the gel column chromatographic separation is sephadex L H-20, the mobile phase is 40-60 vol% methanol/dichloromethane mixed solution for elution, and the elution volume is 3-5 column volumes;
the stationary phase adopted by the reverse phase silica gel column chromatographic separation is C18Silica gel, wherein the mobile phase is 60-70 vol% methanol/water mixed solution, and the elution volume is 2-3 column volumes;
the chromatographic column adopted in the high performance liquid chromatography separation is semi-preparative C18Column, XBridge OBD,5 μm,10 × 250mm, mobile phase 70-90 vol% methanol/water mixed solution.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010232233.XA CN111411045B (en) | 2020-03-27 | 2020-03-27 | Marine fungus-derived azaphilones dimer compound and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010232233.XA CN111411045B (en) | 2020-03-27 | 2020-03-27 | Marine fungus-derived azaphilones dimer compound and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111411045A true CN111411045A (en) | 2020-07-14 |
| CN111411045B CN111411045B (en) | 2022-10-04 |
Family
ID=71489348
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010232233.XA Active CN111411045B (en) | 2020-03-27 | 2020-03-27 | Marine fungus-derived azaphilones dimer compound and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111411045B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114606134A (en) * | 2021-03-10 | 2022-06-10 | 宁波大学 | Sponge epiphyte and application thereof in preparation of oxaanthraquinone compounds |
| WO2023019821A1 (en) * | 2021-08-18 | 2023-02-23 | 中国热带农业科学院热带作物品种资源研究所 | Azaphilone polymer compound, and preparation method therefor and use thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103911407A (en) * | 2014-02-28 | 2014-07-09 | 中山大学 | Marine fungus-derived Azaphilone dimer compound, and preparation method and application thereof |
| CN108101878A (en) * | 2016-12-22 | 2018-06-01 | 扬州大学 | Azaphilones classes compound and its application as anti-MRSA drugs in marine fungi HK1-6 |
| CN109694827A (en) * | 2019-01-18 | 2019-04-30 | 河北大学 | Marine fungi source azaphilones class compound and preparation method thereof and preparing the application in anti-vibrios drug |
| CN109706086A (en) * | 2019-01-18 | 2019-05-03 | 河北大学 | A kind of marine fungi source azaphilones class compound and its preparation method and application |
-
2020
- 2020-03-27 CN CN202010232233.XA patent/CN111411045B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103911407A (en) * | 2014-02-28 | 2014-07-09 | 中山大学 | Marine fungus-derived Azaphilone dimer compound, and preparation method and application thereof |
| CN108101878A (en) * | 2016-12-22 | 2018-06-01 | 扬州大学 | Azaphilones classes compound and its application as anti-MRSA drugs in marine fungi HK1-6 |
| CN109694827A (en) * | 2019-01-18 | 2019-04-30 | 河北大学 | Marine fungi source azaphilones class compound and preparation method thereof and preparing the application in anti-vibrios drug |
| CN109706086A (en) * | 2019-01-18 | 2019-05-03 | 河北大学 | A kind of marine fungi source azaphilones class compound and its preparation method and application |
Non-Patent Citations (1)
| Title |
|---|
| 曹飞等: "1株渤海来源真菌Pleosporales sp.中azaphilones类化合物及其生物活性", 《中国海洋药物》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114606134A (en) * | 2021-03-10 | 2022-06-10 | 宁波大学 | Sponge epiphyte and application thereof in preparation of oxaanthraquinone compounds |
| CN114606134B (en) * | 2021-03-10 | 2023-11-14 | 宁波大学 | Sponge coanda fungus and application thereof in preparation of oxaanthraquinone compounds |
| WO2023019821A1 (en) * | 2021-08-18 | 2023-02-23 | 中国热带农业科学院热带作物品种资源研究所 | Azaphilone polymer compound, and preparation method therefor and use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111411045B (en) | 2022-10-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108660082B (en) | Marine aspergillus derived oxaanthraquinone compound, preparation method thereof and application thereof in preparation of antibacterial agent | |
| CN108753627B (en) | Marine aspergillus derived oxaanthraquinone compound, preparation method thereof and application thereof in preparation of antitumor agent | |
| CN109694827B (en) | Marine fungus-derived azaphilones compound, preparation method thereof and application thereof in preparation of anti-vibrio drugs | |
| CN109706086B (en) | Marine fungus-derived azaphilones compound as well as preparation method and application thereof | |
| CN101974464B (en) | Streptomyces and process for preparing antimycin antibiotics by fermentation using same | |
| CN111411045B (en) | Marine fungus-derived azaphilones dimer compound and preparation method thereof | |
| CN106010980B (en) | A kind of endogenetic fungus Brazil class shell roundlet spore bacterial strain and its application | |
| CN105602994B (en) | A kind of extractive from fermentative and its preparation method and application of marine fungi Trichoderma harzianum DLEN2008005 | |
| CN110863021B (en) | Preparation method and application of cytochalasin compound | |
| CN114606134A (en) | Sponge epiphyte and application thereof in preparation of oxaanthraquinone compounds | |
| CN111423987B (en) | Marine fungus-derived azaphilones dimer compound and application thereof in antituberculosis drugs | |
| CN107298669B (en) | Selenolonic acid I from penicillium oxalicum and application of medicine for resisting human oral epidermoid carcinoma | |
| CN105754875B (en) | One plant of marine fungi Trichoderma harzianum DLEN2008005 and its application | |
| JPS6122099A (en) | Antitumoral antibiotic compound | |
| CN107686817B (en) | Chrysanthemum bud endophytic fungus CYSK-4 and application of Ascomylactam compound produced by same | |
| CN111321083B (en) | Ocean fungus source azaphilines dimer compound and application thereof in antitumor agent | |
| CN109134416B (en) | Application of seclenic acid H derived from penicillium oxalicum in preparation of human cervical cancer drugs | |
| CN116103161A (en) | Plant endophytic fungus for producing eupatorium and application thereof | |
| CN110790660B (en) | Polyketide, preparation method, bacterial strain and application | |
| CN114213428A (en) | Indole alkaloid compound and preparation method and application thereof | |
| CN108727169A (en) | A kind of preparation method of the biphenyl ether compound in marine fungi source and the application as antiseptic | |
| CN102584615A (en) | Alkaloid compound as well as preparation method and application thereof | |
| CN103570744B (en) | A kind of alkaloid compound and preparation method thereof and the application as growth of tumour cell inhibitor | |
| CN107354182B (en) | A kind of method that ash green soy bean endogenetic fungus fermentation prepares (R) -4- benzyl -2- oxazolidinone compounds | |
| CN109280041A (en) | A kind of preparation method of the separation and Extraction noval chemical compound from A.terreus secondary metabolite |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |