CN109706086B - Marine fungus-derived azaphilones compound as well as preparation method and application thereof - Google Patents
Marine fungus-derived azaphilones compound as well as preparation method and application thereof Download PDFInfo
- Publication number
- CN109706086B CN109706086B CN201910049570.2A CN201910049570A CN109706086B CN 109706086 B CN109706086 B CN 109706086B CN 201910049570 A CN201910049570 A CN 201910049570A CN 109706086 B CN109706086 B CN 109706086B
- Authority
- CN
- China
- Prior art keywords
- strain
- azaphilones
- chromatographic separation
- compound
- silica gel
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention provides an azaphilones compound derived from marine fungi, a preparation method thereof and application thereof in preparing agricultural pathogenic fungi resistant medicines, wherein the marine fungi is Grifola frondosa (Grifola frondosa)Pleosporales sp.) HBU-135 strain with preservation date of 2018, 10 and 18 months, preservation number of CGMCC No.16379, preservation unit of China general microbiological culture Collection center, and preservation unit address of No. 3 of Xilu No.1 of Beijing Korean district. The structural formula of the compound is shown as formula 1 or formula 2. Culturing Geobacillus by fermentation (Pleosporales sp.) HBU-135 strain, and separating the compound from the fermentation product, and the compound has stronger inhibitory activity to various agricultural pathogenic fungi, can be prepared into an antibacterial agent and has wide application prospect.
Description
Technical Field
The invention relates to the field of marine natural pharmaceutical chemistry, in particular to an azaphilones compound derived from marine fungi and a preparation method and application thereof.
Background
In recent years, with global warming and changes of cultivation systems and modes, the problem of infectious diseases of crops is in a spreading and expanding trend, and great economic loss is brought to the development of human agriculture. Among the crop infectious diseases, there are two main fungal diseases and bacterial diseases, wherein the fungal diseases account for about 80% of the diseases. For a long time, the main means for preventing and treating agricultural fungal diseases is chemical bactericide, and chemical pesticide not only brings environmental pollution and potential harm to human health, but also brings the problems of influence of non-target organisms, enhancement of resistance of phytopathogen and the like, so that the use of the chemical pesticide is limited. The search for a lead compound with high-efficiency and low-toxicity medicament for resisting agricultural fungal diseases becomes a focus problem of agricultural sustainable development, and also becomes a major scientific problem to be solved urgently in the field of medicinal chemistry.
The marine fungus microbial resource becomes one of the most important sources for searching novel agricultural pathogenic fungus resistant medicament lead compounds due to the advantages of rich metabolites, repeatable fermentation and the like of the marine fungus microbial resource, wherein the research of the agricultural pathogenic fungus resistant active compounds represented by the marine fungus derived azaphilones compounds has very important significance for solving the problem of various major crop diseases which are puzzling the agricultural development at present.
At present, the variety of azaphilones compounds derived from marine fungi is limited, and the research on the activity of the azaphilones compounds against agricultural pathogenic fungi is less, so that no report on the azaphilones compounds and the activity of the azaphilones compounds against agricultural pathogenic fungi is provided at present.
Disclosure of Invention
The invention aims to provide a marine fungus-derived azaphilones compound and a preparation method thereof, and solves the problems that the variety and the agricultural pathogenic fungus resistance activity of the marine fungus-derived azaphilones compound are limited in the prior art.
The second purpose of the invention is to provide the application of the azaphilones compound derived from the marine fungi in preparing the agricultural pathogenic fungi resistant medicines.
The purpose of the invention is realized by the following technical scheme: the marine fungus is a botrytis cinerea (Pleospora sp.) HBU-135 strain, the preservation date is 2018, 10 and 18 days, the preservation number is CGMCC No.16379, the preservation unit is the China general microbiological culture Collection center, and the preservation unit address is No. 3 of Xilu No.1 of Xingyang district, Beijing.
1. Sample source
The marine fungus HBU-135 strain was isolated from a marine sediment sample collected from Huang Ye hong Kong sea area of Cangzhou, Hebei, 2015 at 6 months. And (3) immediately storing the collected seabed sediment sample in a refrigerator at the temperature of-20 ℃, and sending the sample to a laboratory for subsequent fungus separation.
2. Isolation of fungi
2.1 selection of the culture Medium
(1) PDA culture medium
200g of potato (peeled), 20g of glucose, 30g of sea salt, 20g of agar and 1000mL of water. When fungus is separated, streptomycin sulfate 25 ug/mL and ampicillin 25 ug/mL are added to inhibit bacterial growth.
(2) Salt-free PDA culture medium
200g of potato (peeled), 20g of glucose, 20g of agar and 1000mL of water. When fungus was isolated, 25. mu.g/mL streptomycin sulfate and 25. mu.g/mL ampicillin inhibited bacterial growth (no salt PDA vs. salt PDA).
(3) Monglara red medium
200g of potato (peeled), 20g of glucose, 30g of sea salt, 33mg of rose Bengal (rose Bengal) (inhibiting the spread and growth of fast-growing moulds), 20g of agar and 1000mL of water.
2.2 separation and purification of fungi
The marine sediment sample is placed in a sterile glass container, and 1mL of sterile water is added to adjust the marine sediment sample to be viscous. 0.1mL of the above liquid was diluted 10 times, 100 times, and 1000 times with sterile water to obtain 4 homogenates with concentration gradients, and 0.2mL of each homogenate was added to PDA, salt-free PDA, and Bengal red medium with a sterile pipette, and applied with an applicator. Three replicates of each concentration gradient were made. Seal with sealing film and write the number. The above isolation experiments were all performed under aseptic conditions.
And respectively putting the culture mediums added with the samples into a constant temperature box with the temperature of 28 ℃, and carrying out inverted culture. Generally, colonies or mycelia grow out of the edge of the culture medium or tissue pieces after 5-8 days of culture (the bacteria grow fast, and colonies grow out after 2-3 days). The bacterial colony or mycelium tip is picked up by an inoculating needle, transferred to a new plate, and separated and purified for several times to obtain the pure fungus strain. The fungus isolation work was typically carried out for 35 d. The examination was performed every day for the first two weeks and every 3-4 d thereafter. Once new colonies or mycelia are found to grow, they are transferred to new plates.
3. Screening of strains
The target strain is screened by combining an activity screening method with a chemical screening method. Performing small-scale fermentation (2 bottles) on the strains to obtain a crude extract, performing an antibacterial activity test on the crude extract, and taking the inhibitory activity on agricultural pathogenic fungi as one of investigation factors for screening target strains; and performing HPLC fingerprint analysis on the crude extract, taking the secondary metabolite amount as the second investigation factor for screening the target strain, finally determining the strain HBU-135 with high bacteriostatic activity and rich secondary metabolites as the target strain, and identifying the target strain.
4. Identification of strains
Culturing on PDA culture medium plate for 3-7 days, growing fungus to optimum state, picking out a small amount of hypha on single colony with sterilizing gun head, placing into EP tube containing 50 μ L lysine buffer, thermally denaturing in 80 deg.C water bath for 15min, centrifuging at 8000rpm for 1min, and collecting 3 μ L supernatant as template DNA of PCR reaction.
Primers used for amplification and sequencing were ITS1 and ITS4, with the top and bottom primer sequences:
ITS1：TCCGTAGGTGAACCTGCGG
ITS4：TCCTCCGCTTATTGATATGC
the PCR reaction system is a 40-mu L system and comprises:
the amplification conditions were:
the amplified product was detected by electrophoresis with 5. mu.L of 0.8% agarose gel, 0.5 XTBE electrophoresis buffer sample, 5V/cm voltage, DNA Marker to indicate molecular weight, and observed and photographed by gel imager. The PCR amplification product was sequenced by Tribock Polygala tenuifolia, Beijing, and finally identified as Geospora sp.
A marine fungus-derived azaphilones compound has a structural formula as follows:
the preparation method of the azaphilones compound derived from the marine fungi comprises the following steps:
(1) inoculating the Geospora sp (Pleosporales sp.) HBU-135 strain of claim 1 into a seed culture medium for seed culture;
(2) after the strain is cultured, inoculating the strain into a fermentation medium for fermentation to obtain a fermented product;
(3) extracting the fermented product with ethyl acetate for 2-4 times, mixing ethyl acetate extractive solutions, and concentrating under reduced pressure to obtain crude extract;
(4) and carrying out chromatographic separation on the obtained crude extract to obtain the azaphilones compound, wherein the chromatographic separation is sequentially carried out by normal phase silica gel column chromatographic separation, reverse phase silica gel column chromatographic separation, gel column chromatographic separation and high performance liquid chromatographic separation.
In the step (1), the strain culture medium is as follows: 1.0-10 wt% of glucose, 0.1-4.0 wt% of yeast extract, 0.2-4.0 wt% of peptone, 1.0-6.0 wt% of agar, 3.0-10 wt% of crude sea salt and the balance of water; the culture temperature of the strain is 15-35 deg.C, and the culture time is 3-10 days.
In the step (2), each unit of the fermentation medium comprises 40-120 g of potato (dregs are removed after boiling for 20 minutes), 10-30 g of glucose and MgCl 2 5-20 g of water, 200-; the fermentation culture condition is static culture at 15-35 deg.C for 20-50 days.
In the step (4), the normal phase silica gel column chromatographic separation is as follows: eluting by using 100-200-mesh silica gel as a stationary phase and 1.5-3 vol% of methanol/dichloromethane mixed solution as a mobile phase, wherein the elution volume is 3-5 column volumes, concentrating the obtained eluent, eluting by using 200-300-mesh silica gel as a stationary phase and 25-30 vol% of ethyl acetate/petroleum ether mixed solution as a mobile phase, and the elution volume is 2-3 column volumes.
In the step (4), the stationary phase adopted by the reversed phase silica gel column chromatographic separation is C 18 Silica gel, mobile phase is 60-70 vol% methanol/water mixed solution, and elution volume is 2-3 column volumes.
In the step (4), the stationary phase of the gel column chromatographic separation is sephadex LH-20, the mobile phase is methanol, and the elution volume is 3-5 column volumes.
In the step (4), the chromatographic column adopted in the high performance liquid chromatography separation is semi-preparative C 18 Column, Xbridge OBD,5 μm, 10X 250mm, mobile phase 60-65 vol% methanol/water mixed solution.
The application of the azaphilones compound derived from the marine fungi in preparing the agricultural pathogenic fungi resisting medicine takes the compound or pharmaceutically acceptable salts thereof as active ingredients.
The application of the azaphilones compound or the pharmaceutically acceptable salt thereof derived from the marine fungi in preparing pesticides for preventing and/or treating agricultural pathogenic fungal diseases caused by Alternaria brasiliensis (Alternaria brasiliensis), verticillium pomorum (botryosphaera dothidea) and Fusarium oxysporum (Fusarium oxysporum).
The term "pharmaceutically acceptable salts" as used herein refers to non-toxic inorganic or organic acid and/or base addition salts, as exemplified by "Salt selection for basic drugs", int.J.Pharm (1986),33, 201-217.
The azaphilones compounds 1 and 2 are obtained by fermenting a marine fungus HBU-135 strain, have good inhibitory activity on Alternaria brassicae (Alternaria brassicola), Alternaria mali (Botryosphaeria dothidea) and Fusarium oxysporum (Fusarium oxysporum), can be used as an agricultural pathogenic fungus resistant medicament, and have wide application prospects.
Detailed Description
Example 1
(1) Culture of marine fungus HBU-135 strain
A culture medium used for culturing the strain of the marine fungus HBU-135 contains 1.0 wt% of glucose, 0.1 wt% of yeast extract, 0.2 wt% of peptone, 1.0 wt% of agar, 3.0 wt% of crude sea salt and the balance of water, a test tube inclined plane is prepared when the culture medium is used, and the strain of the marine fungus HBU-135 is cultured for 3 days at the temperature of 28 ℃.
(2) Fermentation culture of marine fungus HBU-135
The fermentation culture medium for fermentation culture of marine fungus HBU-135 comprises 80g of potato (removing potato residue after boiling in water for 20 min), 20g of glucose, and MgCl in 1000mL conical flask 2 13g and 400mL of water, and standing, fermenting and culturing the strain at 28 ℃ for 45 days to obtain a fermented product; a total of 200 1000mL Erlenmeyer flasks were used for fermentation.
(3) Isolation analysis of Azaphilones species
Extracting the fermentation product obtained in the step (2) with ethyl acetate for 3 times, combining ethyl acetate extraction liquids, concentrating under reduced pressure to obtain a crude extract, and performing normal phase silica gel column chromatographic separation firstly, wherein the stationary phase is as follows: 100-200 mesh silica gel, wherein the mobile phase is 1.5 vol% methanol/dichloromethane mixed solution, 5 column volumes are eluted, the eluent is concentrated and then normal phase silica gel column chromatographic separation is carried out again, and the stationary phase: 200-300 mesh silica gel, the mobile phase is 25 vol% ethyl acetate/petroleum ether mixed solution, 2 column volumes elute.
Concentrating the eluate, and separating with reverse phase silica gel column chromatography, preferably with stationary phase C 18 Silica gel, mobile phase is preferably 70vol% methanol/water mixture, elution 3 column volumes. Concentrating the eluent, and then carrying out Sephadex LH20 gel column chromatographic separation, wherein the mobile phase: methanol, 3 column volumes eluted. Concentrating the eluent, separating by high performance liquid chromatography, and fixing the phases: semi-preparation of C 18 The preparative separations on a column, XBridge OBD,5 μm,10 × 250mm, mobile phase of a 65vol% methanol/water mixed solution gave compound 1(5.6mg), compound 2(6.2mg), the structure confirmation data of which were as follows, respectively:
compound 1
Yellow oil; [ alpha ] to] D 20 –96.0(c 0.50,MeOH)；UV(MeOH),λ max (logε)224(4.40),346(3.90)nm；CD(MeOH),λ max (Δε)215(5.31),296(1.22),366(–5.00)nm；IR(KBr),v max 2926,1742,1676,1643,1450,1238,1126,1022cm -1 ； 1 H NMR(CDCl 3 ,500Hz)δ:7.91(1H,s,H-1),6.66(1H,s,H-4),5.69(1H,q,J＝6.5Hz,H-5’),5.35(1H,d,J＝11.0Hz,H-3’),2.95(1H,dq,J＝11.0/6.5Hz,H-2),2.54(2H,m,H-12),2.52(2H,m,H-14),2.12(3H,s,H-2”),2.09(3H,s,H-16),2.01(2H,m,H-13),1.63(3H,d,J＝6.9Hz,H-6’),1.58(3H,s,H-8’),1.57(3H,s,H-9),1.10(3H,d,J＝6.9Hz,H-7’)； 13 C NMR(CDCl 3 ,125MHz)δ:196.0(C,C-15),191.3(C,C-8),186.5(C,C-6),173,8(C,C-1’),171.4(C,C-1”),166.5(C,C-3),155.9(C,C-11),153.6(CH,C-1),138.4(C,C-4a),130.5(C,C-4’),130.3(C,C-10),127.7(CH,C-5’),114.9(C,C-8a),111.4(CH,C-4),111.4(CH,C-5),84.9(C,C-7),81.0(CH,C-3’),41.4(CH,C-2’),37.3(CH 2 ,C-14),32.8(CH 2 ,C-12),23.1(CH 3 ,C-16),22.3(CH 3 ,C-9),21.6(CH 2 ,C-13),21.4(CH 3 ,C-2”),14.0(CH 3 ,C-7’),13.3(CH 3 ,C-6’),10.7(CH 3 ,H-8’).HRESIMS m/z 517.1630[M+H] + (calcd.for C 27 H 30 ClO 8 ,517.1624).
Compound 2
Yellow oil; [ alpha ] to] D 20 +120.0(c 0.50,MeOH)；UV(MeOH),λ max (logε)219(4.05),337(3.53)nm；CD(MeOH),λ max (Δε)275(–4.21),291(6.45)nm；IR(KBr),v max 3608,2931,1728,1672,1453,1376,1237,1149,1034cm -1 ； 1 H NMR(CD 3 OD,500Hz)δ:8.21(1H,s,H-1),7.19(1H,dd,J＝8.0/7.5Hz,H-13),6.78(1H,d,J＝7.5Hz,H-12),6.74(1H,d,J＝8.0Hz,H-14),.6.61(1H,s,H-4),5.67(1H,q,J＝6.5Hz,H-5’),5.49(1H,s,H-5),5.25(1H,d,J＝11.0Hz,H-3’),2.95(1H,dq,J＝11.0/6.5Hz,H-2’),2.29(3H,s,H-16),2.10(3H,s,H-2”),1.65(3H,d,J＝6.9Hz,H-6’),1.62(3H,s,H-8’),1.57(3H,s,H-9),1.05(3H,d,J＝6.9Hz,H-7’)； 13 C NMR(CD 3 OD,125Hz)δ:194.8(C,C-6),194.1(C,C-8),175.0(C,C-1’),172.0(C,C-1”),158.3(C,C-3),157.3(C,C-15),156.8(CH,C-1),145.9(C,C-4a),139.9(C,C-11),132.5(CH,C-13),132.1(C,C-4’),128.3(CH,C-5’),122.4(CH,C-12),120.4(C,C-10),116.4(C,C-8a),115.0(CH,C-4),114.3(CH,C-14),106.8(CH,C-5),86.1(C,C-7),82.4(CH,C-3’),42.4(CH,C-2’),22.8(CH 3 ,C-9),21.3(CH 3 ,C-2”),19.9(CH 3 ,C-16),14.2(CH 3 ,C-7’),13.2(CH 3 ,C-6’),10.7(CH 3 ,C-8’).HRESIMS m/z 481.1847[M+H] + (calcd.for C 27 H 29 O 8 ,481.1857).
Example 2
(1) Culture of marine fungus HBU-135 strain
A culture medium for culturing the strain of marine fungus HBU-135 contains glucose 10wt%, yeast extract 4.0wt%, peptone 4.0wt%, agar 6.0wt%, crude sea salt 10wt%, and water in balance, and is prepared into a test tube slant when used, and the fungus strain is cultured at 35 deg.C for 5 days.
(2) Fermentation culture of marine fungus HBU-135
The fermentation culture medium for fermentation culture of marine fungus HBU-135 comprises 120g of potato (removing potato residue after boiling in water for 20 min), 30g of glucose, and MgCl in each 1000mL conical flask 2 20g and 600mL of water; the fermentation culture condition is static culture at 35 deg.C for 50 days to obtain fermented product.
(3) Isolation and analysis of Azaphilones compounds
Extracting the fermentation product obtained in the step (2) with ethyl acetate for 4 times, combining ethyl acetate extraction liquids, concentrating under reduced pressure to obtain a crude extract, and performing normal phase silica gel column chromatographic separation firstly, wherein the stationary phase is as follows: 100-200 mesh silica gel, the mobile phase is 3vol% methanol/dichloromethane mixed solution, 3 column volumes are eluted, normal phase silica gel column chromatographic separation is carried out again after the eluent is concentrated, and the stationary phase: 200-300 mesh silica gel, the mobile phase is 30vol% ethyl acetate/petroleum ether mixed solution, and 3 column volumes are eluted.
Concentrating the eluate, and separating with reverse phase silica gel column chromatography, preferably with stationary phase C 18 Silica gel, the mobile phase is preferably a 60 vol% methanol/water mixtureSolution, eluting 3 column volumes. Concentrating the eluent, and then carrying out Sephadex LH20 gel column chromatographic separation, wherein the mobile phase: methanol is used for eluting 5 column volumes, the eluent is concentrated and then is subjected to high performance liquid chromatography separation, and the stationary phase: semi-preparation of C 18 The preparative separation on a column, Xbridge OBD,5 μm, 10X 250mm, mobile phase of 60 vol% methanol/water mixed solution gave compounds 1 and 2, the structure confirmation data of which was consistent with example 1.
The conditions for culturing and fermenting other strains, which are not specifically indicated in examples 1 and 2, and other experimental operating conditions such as normal phase silica gel column chromatographic separation, reverse phase silica gel column chromatographic separation, high performance liquid chiral chromatographic separation and the like are conventional experimental operating conditions in the art, and can be reasonably selected by a person skilled in the art according to actual needs.
The obtained azaphilones compounds have activity of resisting agricultural pathogenic fungi
(1) Activity test against agricultural pathogens
Activity tests were performed on Alternaria brassicae (Alternaria brassicola), verticillium malorum (Botryosphaeria dothidea) and Fusarium oxysporum (Fusarium oxysporum) using a gradient dilution method.
(2) Activity test method
In a sterile ultra-clean workbench, a proper amount of bacterial strain liquid culture solution is added into a blank culture solution for dilution, and the dilution degree is generally 1:1000 or 1: 500. And (2) taking 198 mu L of diluted liquid strain by using a sterile pipette (the pipette head is subjected to sterilization treatment) and adding the liquid strain into a 96-well plate, adding 2 mu L of sample to be detected (crude extract or monomer compound solution prepared by DMSO) into the first well, sequentially carrying out double dilution by using the pipette to reach the 8 th concentration gradient, shaking and uniformly mixing after dilution is finished, culturing for 24-48 h at 28 ℃, and measuring absorbance by using a microplate reader (630nm) to obtain the Minimum Inhibitory Concentration (MIC) of the sample. The final concentration of DMSO was maintained at 1%. Three replicates were set for each sample concentration, and a blank control, a negative control (DMSO), and a positive control (ketoconazole) were additionally set, and the results of the Minimum Inhibitory Concentration (MIC) measurement are shown in table 1.
(3) Results of Activity test
Table 1:
the test results show that the compounds 1 and 2 have certain inhibitory activity on three agricultural pathogenic fungi. Especially, compound 1 showed the strongest activity against Alternaria brassicae (Alternaria brassicola) and Fusarium oxysporum (Fusarium oxysporum), with the minimum inhibitory concentration MIC values of 1.56 μ g/mL, which are stronger than that of the positive control drug, ketoconazole. Experiments show that the azaphilones compound has inhibitory activity on multiple strains of agricultural pathogenic fungi, can be prepared into agricultural pathogenic fungi resistant preparations, and has wide application prospects.
Claims (6)
1. A marine fungus, which is characterized in that the marine fungus is Geospora (Grifola Frondosa)Pleosporalessp.) HBU-135 strain with preservation date of 2018, 10 and 18 months, preservation number of CGMCC No.16379, preservation unit of China general microbiological culture Collection center, and preservation unit address of No. 3 of Xilu No.1 of Beijing Korean district.
2. A preparation method of azaphilones compounds derived from marine fungi is characterized in that the structural formula of the compounds is shown in the specification
The preparation method of the compound comprises the following steps:
(1) grifola frondosa (G) according to claim 1Pleosporalessp.) the HBU-135 strain is inoculated in a strain culture medium for strain culture;
(2) after the strain is cultured, inoculating the strain into a fermentation medium for fermentation to obtain a fermented product;
(3) extracting the fermented product with ethyl acetate for 2-4 times, mixing ethyl acetate extractive solutions, and concentrating under reduced pressure to obtain crude extract;
(4) and carrying out chromatographic separation on the obtained crude extract to obtain the azaphilones compound, wherein the chromatographic separation is sequentially carried out by normal phase silica gel column chromatographic separation, reverse phase silica gel column chromatographic separation, gel column chromatographic separation and high performance liquid chromatographic separation.
3. The method for preparing azaphilones compounds derived from marine fungi according to claim 2, wherein in the step (1), the strain culture medium is: 1.0-10 wt% of glucose, 0.1-4.0 wt% of yeast extract, 0.2-4.0 wt% of peptone, 1.0-6.0 wt% of agar, 3.0-10 wt% of crude sea salt and the balance of water; the culture temperature of the strain is 15-35 deg.C, and the culture time is 3-10 days.
4. The method for preparing azaphilones compounds derived from marine fungi according to claim 2, wherein in the step (2), the fermentation medium comprises per unit portion: 40-120 g of potato, 10-30 g of glucose and MgCl 2 5-20 g of water, 200-; the fermentation culture condition is static culture at 15-35 deg.C for 20-50 days.
5. The method for preparing azaphilones compounds derived from marine fungi according to claim 2, wherein in the step (4):
the normal phase silica gel column chromatographic separation is as follows: eluting by using 100-200-mesh silica gel as a stationary phase and 1.5-3 vol% of methanol/dichloromethane mixed solution as a mobile phase, wherein the elution volume is 3-5 column volumes, concentrating the obtained eluent, eluting by using 200-300-mesh silica gel as a stationary phase and 25-30 vol% of ethyl acetate/petroleum ether mixed solution as a mobile phase, and the elution volume is 2-3 column volumes;
the stationary phase adopted by the reverse phase silica gel column chromatographic separation is C 18 Silica gel, wherein the mobile phase is 60-70 vol% methanol/water mixed solution, and the elution volume is 2-3 column volumes;
the stationary phase of the gel column chromatographic separation is sephadex LH-20, the mobile phase is methanol, and the elution volume is 3-5 column volumes;
the chromatographic column adopted in the high performance liquid chromatography separation is semi-preparative C 18 Column, Xbridge OBD,5 μm, 10X 250mm, mobile phase 60-65 vol% methanol/water mixed solution.
6. The application of the azaphilones compound derived from marine fungi prepared by the method of any one of claims 2-5 in preparing agricultural pathogenic fungi resistant medicines; the agricultural pathogenic fungus refers to cabbage black spot pathogen (A)Alternaria brassicicola) Apple ring rot bacteria (1)Botryosphaeria dothidea) And cotton wilt bacteria: (Fusarium oxysporum）。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910049570.2A CN109706086B (en) | 2019-01-18 | 2019-01-18 | Marine fungus-derived azaphilones compound as well as preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910049570.2A CN109706086B (en) | 2019-01-18 | 2019-01-18 | Marine fungus-derived azaphilones compound as well as preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109706086A CN109706086A (en) | 2019-05-03 |
| CN109706086B true CN109706086B (en) | 2022-08-12 |
Family
ID=66261498
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910049570.2A Active CN109706086B (en) | 2019-01-18 | 2019-01-18 | Marine fungus-derived azaphilones compound as well as preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109706086B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111423987B (en) * | 2020-03-27 | 2023-01-06 | 河北大学 | Marine fungus-derived azaphilones dimer compound and application thereof in antituberculosis drugs |
| CN111321083B (en) * | 2020-03-27 | 2023-05-16 | 河北大学 | Ocean fungus source azaphilines dimer compound and application thereof in antitumor agent |
| CN111411045B (en) * | 2020-03-27 | 2022-10-04 | 河北大学 | Marine fungus-derived azaphilones dimer compound and preparation method thereof |
| CN113527247B (en) * | 2021-08-18 | 2023-02-03 | 中国热带农业科学院热带作物品种资源研究所 | Azophilone polymer compound and preparation method and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2005220040A (en) * | 2004-02-03 | 2005-08-18 | Ajinomoto Co Inc | New antifungal agent fa200b |
| CN103910708A (en) * | 2014-02-28 | 2014-07-09 | 中山大学 | Marine fungus-derived Azaphilones compound, and preparation method and application thereof |
| CN105017203A (en) * | 2015-07-28 | 2015-11-04 | 海南医学院 | Azaphilones derivative compound from marine fungi as well as preparation method and application of azaphilones derivate compound |
| CN108660082A (en) * | 2018-06-15 | 2018-10-16 | 河北大学 | A kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and the application in preparing antiseptic |
| CN108753627A (en) * | 2018-06-15 | 2018-11-06 | 河北大学 | A kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and the application in preparing antitumor agent |
-
2019
- 2019-01-18 CN CN201910049570.2A patent/CN109706086B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2005220040A (en) * | 2004-02-03 | 2005-08-18 | Ajinomoto Co Inc | New antifungal agent fa200b |
| CN103910708A (en) * | 2014-02-28 | 2014-07-09 | 中山大学 | Marine fungus-derived Azaphilones compound, and preparation method and application thereof |
| CN105017203A (en) * | 2015-07-28 | 2015-11-04 | 海南医学院 | Azaphilones derivative compound from marine fungi as well as preparation method and application of azaphilones derivate compound |
| CN108660082A (en) * | 2018-06-15 | 2018-10-16 | 河北大学 | A kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and the application in preparing antiseptic |
| CN108753627A (en) * | 2018-06-15 | 2018-11-06 | 河北大学 | A kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and the application in preparing antitumor agent |
Non-Patent Citations (1)
| Title |
|---|
| 1株渤海来源真菌Pleosporales sp.中azaphilones类化合物及其生物活性;曹飞等;《中国海洋药物》;20160615;第35卷(第03期);第6-10页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109706086A (en) | 2019-05-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109706086B (en) | Marine fungus-derived azaphilones compound as well as preparation method and application thereof | |
| CN109694827B (en) | Marine fungus-derived azaphilones compound, preparation method thereof and application thereof in preparation of anti-vibrio drugs | |
| CN108660082B (en) | Marine aspergillus derived oxaanthraquinone compound, preparation method thereof and application thereof in preparation of antibacterial agent | |
| CN108753627B (en) | Marine aspergillus derived oxaanthraquinone compound, preparation method thereof and application thereof in preparation of antitumor agent | |
| CN109957515B (en) | Phomopsis strain and application thereof in biotransformation of tripterine | |
| CN115806881B (en) | Penicillium fungus and application thereof in preparation of antibacterial drugs | |
| CN106010980B (en) | A kind of endogenetic fungus Brazil class shell roundlet spore bacterial strain and its application | |
| CN108353906B (en) | Application of indole-3-formaldehyde and derivatives thereof in preventing and treating plant diseases caused by plant pathogenic fungi | |
| CN111423987B (en) | Marine fungus-derived azaphilones dimer compound and application thereof in antituberculosis drugs | |
| CN111411045B (en) | Marine fungus-derived azaphilones dimer compound and preparation method thereof | |
| CN110590769B (en) | Pair of quinazolinone alkaloid enantiomers, preparation method and application thereof | |
| Hao et al. | Isolation and identification of swainsonine-producing fungi found in locoweeds and their rhizosphere soil | |
| CN108102933A (en) | One plant of white yellow black streptomycete bacterial strain and its application | |
| CN110790660B (en) | Polyketide, preparation method, bacterial strain and application | |
| CN111321083B (en) | Ocean fungus source azaphilines dimer compound and application thereof in antitumor agent | |
| CN107973803B (en) | Seven-membered lactonofuran derivative and preparation method and application thereof | |
| CN107354182B (en) | A kind of method that ash green soy bean endogenetic fungus fermentation prepares (R) -4- benzyl -2- oxazolidinone compounds | |
| CN110642823A (en) | Pyran derivative and preparation method and application thereof | |
| CN105837590A (en) | Compound with anti-Candida albicans activity, preparation method and application thereof | |
| CN118063425B (en) | Fusarium oxysporum-resistant active sesquiterpene penicilliuene A and preparation method and application thereof | |
| CN118879505A (en) | Novel 1, 3-ring-opening azaphilones compounds derived from marine fungi and application thereof in preparation of agricultural pathogenic fungi resistant agent | |
| CN114874915B (en) | Cordycepin A-producing endophytic fungus and application thereof | |
| CN111849791B (en) | Aspergillus ochraceus strain L1295 and application thereof | |
| CN108660169A (en) | A method of fermentation prepares spine spore bacteriums antibiotic | |
| CN109971655B (en) | Astragalus membranaceus endophytic Chaetomium sp HQ-1 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |