CN111411045B - Marine fungus-derived azaphilones dimer compound and preparation method thereof - Google Patents
Marine fungus-derived azaphilones dimer compound and preparation method thereof Download PDFInfo
- Publication number
- CN111411045B CN111411045B CN202010232233.XA CN202010232233A CN111411045B CN 111411045 B CN111411045 B CN 111411045B CN 202010232233 A CN202010232233 A CN 202010232233A CN 111411045 B CN111411045 B CN 111411045B
- Authority
- CN
- China
- Prior art keywords
- strain
- silica gel
- chromatographic separation
- culture
- azaphilones
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D311/00—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
- C07D311/02—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
- C07D311/76—Benzo[c]pyrans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D311/00—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
- C07D311/02—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
- C07D311/94—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems condensed with rings other than six-membered or with ring systems containing such rings
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/16—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing two or more hetero rings
- C12P17/162—Heterorings having oxygen atoms as the only ring heteroatoms, e.g. Lasalocid
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Tropical Medicine & Parasitology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention provides an azaphilones dimer compound derived from marine fungi and a preparation method thereof, wherein the marine fungi is Grifola frondosa (Grifola frondosa)Pleosporalessp.) HBU-135 strain with a preservation date of 2018, 10 and 18 months, a preservation number of CGMCC No.16379, a preservation unit of China general microbiological culture Collection center, and a preservation unit address of No. 3 of Xilu No.1 Beijing, chaoyang district, beijing. The structural formula of the compound is shown as formula 1 or formula 2. Culturing Geobacillus by fermentation (Pleosporalessp.) HBU-135 strain and isolating the above compound from the fermentation product.
Description
Technical Field
The invention relates to the field of marine natural medicinal chemistry, in particular to an azaphilones dimer compound derived from marine fungi and a preparation method thereof.
Background
The ocean accounts for about 71 percent of the total surface area of the earth, contains abundant and various biological resources, and is a valuable resource bank for human to research and develop medicines. Since the 40's of the 20 th century, various marine-derived drugs represented by cephalosporin, cytarabine and ET-743 have been successfully used clinically. Almost all marine organisms produce biologically active secondary metabolites. Among them, the marine fungus microbial resources are one of the most important sources of marine drugs due to the advantages of abundant metabolites and repeatable fermentation. Antineoplastic active compounds represented by azaphilones compounds derived from marine fungi have become a bright spot in modern marine medicine research. However, so far, no Azaphilones compound containing [2+2] dimerization and anti-tumor activity reports thereof for marine fungus sources are found at home and abroad.
Disclosure of Invention
The invention aims to provide a marine fungus-derived azaphilones dimer compound and a preparation method thereof, and aims to solve the problems that the type and anti-tumor activity of the marine fungus-derived azaphilones compound are limited in the prior art.
The purpose of the invention is realized by the following technical scheme: the marine fungus is a bacillus coli (Pleosporales sp.) HBU-135 strain, the preservation date is 2018, 10 and 18 days, the preservation number is CGMCC No.16379, the preservation unit is the common microorganism center of China Committee for culture Collection of microorganisms, and the preservation unit address is No. 3 of Xilu No.1 of Chaozhou Yang district in Beijing.
1. Sample source
The marine fungus HBU-135 strain was isolated from a marine sediment sample collected from Huang Ye Hong Hao area, cangzhou, hebei, 2015 6 months. After the collection of the seabed sediment sample, the seabed sediment sample is immediately stored in a refrigerator at the temperature of minus 20 ℃ and is sent to a laboratory for subsequent fungus separation work.
2. Isolation of fungi
2.1 selection of the culture Medium
(1) PDA culture medium
200g of potato (peeled), 20g of glucose, 30g of sea salt, 20g of agar and 1000mL of water. When fungus is separated, streptomycin sulfate 25 ug/mL and ampicillin 25 ug/mL are added to inhibit bacterial growth.
(2) Salt-free PDA culture medium
200g of potato (peeled), 20g of glucose, 20g of agar and 1000mL of water. When fungus was isolated, 25. Mu.g/mL streptomycin sulfate and 25. Mu.g/mL ampicillin inhibited bacterial growth (no salt PDA vs. salt PDA).
(3) Monglara red medium
200g of potato (peeled), 20g of glucose, 30g of sea salt, 33mg of rose Bengal (rose Bengal) (inhibiting the spread and growth of fast-growing moulds), 20g of agar and 1000mL of water.
2.2 separation and purification of fungi
The marine sediment sample is placed in a sterile glass container, and 1mL of sterile water is added to adjust the mixture to be viscous. 0.1mL of the above liquid was diluted 10 times, 100 times, and 1000 times with sterile water to obtain 4 homogenates with concentration gradients, and 0.2mL of each homogenate was added to PDA, salt-free PDA, and Bengal red medium with a sterile pipette, and applied with an applicator. Three replicates of each concentration gradient were made. Seal with sealing film and write the number. The above isolation experiments were all performed under aseptic conditions.
And respectively putting the culture mediums added with the samples into a constant temperature box with the temperature of 28 ℃, and carrying out inverted culture. Generally, colonies or mycelia grow out of the edge of the culture medium or tissue after 5-8 days of culture (the bacteria grow fast, and colonies grow out after 2-3 days). The bacterial colony or mycelium tip is picked up by an inoculating needle, transferred to a new plate, and separated and purified for several times to obtain the pure fungus strain. The fungus isolation work was typically carried out for 35d. The examination was performed every day for the first two weeks and every 3-4d thereafter. Once new colonies or mycelia are found to grow, they are transferred to new plates.
3. Screening of strains
The target strain is screened by adopting a method combining activity screening and chemical screening. Performing small-scale fermentation (2 bottles) on the strains to obtain a crude extract, performing an antibacterial activity test on the crude extract, and taking the inhibitory activity on tumor cells as one of investigation factors for screening target strains; and performing HPLC fingerprint analysis on the crude extract, taking the secondary metabolite amount as the second investigation factor for screening the target strain, finally determining the strain HBU-135 with high bacteriostatic activity and rich secondary metabolites as the target strain, and identifying the target strain.
4. Identification of the strains
Culturing the fungi on a PDA culture medium plate for 3-7 days to grow to the best state, picking a small amount of hyphae on a single colony by using a sterilizing gun head to an EP tube filled with 50 mu L lysine buffer, performing thermal denaturation for 15min in a water bath kettle at 80 ℃, then centrifuging for 1min at 8000rpm, and taking 3 mu L supernatant as template DNA of PCR reaction.
Primers used for amplification and sequencing are ITS1 and ITS4, and the upper and lower primer sequences are as follows:
ITS1：TCCGTAGGTGAACCTGCGG
ITS4：TCCTCCGCTTATTGATATGC
the PCR reaction system is a 40-mu L system and comprises:
the amplification conditions were:
the amplified product was detected by electrophoresis with 5. Mu.L of 0.8% agarose gel, 0.5 XTBE electrophoresis buffer sample, 5V/cm voltage, DNA Marker to indicate molecular weight, and observed and photographed by gel imager. The PCR amplification product was sequenced by Tribock Polygala tenuifolia, beijing, and finally identified as Geospora sp.
A marine fungus-derived azaphilones dimer compound has a structural formula as follows:
the preparation method of the azaphilones compound derived from the marine fungi comprises the following steps:
(1) Inoculating a Geobacillus (Pleosporales sp.) HBU-135 strain into a strain culture medium for strain culture;
(2) After the strain is cultured, inoculating the strain into a fermentation medium for fermentation to obtain a fermented product;
(3) Extracting the fermented product with ethyl acetate for 2-4 times, mixing ethyl acetate extractive solutions, and concentrating under reduced pressure to obtain crude extract;
(4) And (3) carrying out chromatographic separation on the obtained crude extract to obtain the azaphilones dimer compound, wherein the chromatographic separation is sequentially carrying out normal phase silica gel column chromatographic separation, reverse phase silica gel column chromatographic separation, gel column chromatographic separation and high performance liquid chromatographic separation.
In the step (1), the strain culture medium is as follows: 1.0-10wt% of glucose, 0.1-4.0wt% of yeast extract, 0.2-4.0wt% of peptone, 1.0-6.0wt% of agar, 3.0-10wt% of crude sea salt and the balance of water; the culture temperature of the strain is 15-35 deg.C, and the culture time is 3-10 days.
In the step (2), each unit of the fermentation medium comprises 40-120g of potatoes (dregs are removed after boiling in water for 20 minutes), 10-30g of glucose and CaCl 2 5-40g and 200-600mL of water; the fermentation culture condition is shake culture at 15-35 deg.C for 10-20 days.
In the step (4), the normal phase silica gel column chromatographic separation is as follows: firstly, adopting 100-200 meshes of silica gel as a stationary phase, adopting 1.5-3vol% of methanol/dichloromethane mixed solution as a mobile phase for elution, wherein the elution volume is 3-5 column volumes, concentrating the obtained eluent, then adopting 200-300 meshes of silica gel as the stationary phase, adopting 25-30vol% of ethyl acetate/petroleum ether mixed solution as the mobile phase for elution, and the elution volume is 2-3 column volumes.
In the step (4), the stationary phase of the gel column chromatographic separation is sephadex LH-20, the mobile phase is 40-60vol% methanol/dichloromethane mixed solution for elution, and the elution volume is 3-5 column volumes.
In the step (4), the stationary phase adopted by the reversed phase silica gel column chromatographic separation is C 18 Silica gel, mobile phase is 60-70vol% methanol/water mixed solution, and elution volume is 2-3 column volumes.
In the step (4), the chromatographic column adopted in the high performance liquid chromatography separation is semi-preparative C 18 Column, xbridge OBD,5 μm, 10X 250mm, mobile phase 70-90vol% methanol/water mixed solution.
In another embodiment of the present invention, there is provided an antitumor agent characterized by comprising a compound of formula 1 or 2 or a pharmaceutically acceptable salt thereof as an active ingredient.
The invention also provides application of the compounds shown in the formulas 1 and 2 or pharmaceutically acceptable salts thereof in preparing medicaments for preventing and/or treating tumor diseases caused by human breast cancer cells (MDA-MB-231 and MCF-7), gastric cancer cells (MGC-803), cervical cancer cells (HeLa) and lung epithelial cancer cells (A-549).
The use of a compound of formulae 1 and 2, or a pharmaceutically acceptable salt thereof, as hereinbefore described in the manufacture of an anti-tumour agent.
The term "pharmaceutically acceptable salts" as used herein refers to non-toxic inorganic or organic acid and/or base addition salts, as described in "Salt selection for basic drugs", int.j.pharm. (1986), 33,201-217.
The azaphilones dimer compounds shown in the formula 1 and the formula 2 obtained from marine fungi Pleosporales sp have strong inhibitory activity on human breast cancer cells (MDA-MB-231 and MCF-7), gastric cancer cells (MGC-803), cervical cancer cells (HeLa) and lung epithelial cancer cells (A-549), can be used as antitumor drugs, and have wide application prospects.
Detailed Description
Example 1
(1) Culture of marine fungus HBU-135 strain
A culture medium used for culturing the strain of the marine fungus HBU-135 contains 1.0wt% of glucose, 0.1wt% of yeast extract, 0.2wt% of peptone, 1.0wt% of agar, 3.0wt% of crude sea salt and the balance of water, a test tube inclined plane is prepared when the culture medium is used, and the strain of the marine fungus HBU-135 is cultured for 3 days at the temperature of 28 ℃.
(2) Fermentation culture of marine fungus HBU-135
The fermentation culture medium for fermentation culture of the marine fungus HBU-135 comprises 100g of potatoes (removing potato residue after boiling in water for 20 min), 20g of glucose and CaCl in each 1000mL conical flask 2 33g and 500mL of water, and performing shake culture on the strains for 14 days at 28 ℃ to obtain a fermentation product; a total of 20 1000mL Erlenmeyer flasks were used for fermentation.
(3) Isolation analysis of Azaphilones dimers
Extracting the fermentation product obtained in the step (2) with ethyl acetate for 3 times, combining ethyl acetate extraction liquids, concentrating under reduced pressure to obtain a crude extract, and performing normal phase silica gel column chromatographic separation firstly, wherein the stationary phase is as follows: 100-200 mesh silica gel, the mobile phase is 1.5vol% methanol/dichloromethane mixed solution, 5 column volumes are eluted, the eluent is concentrated and then is subjected to normal phase silica gel column chromatographic separation again, the stationary phase is: 200-300 mesh silica gel, the mobile phase is 25vol% ethyl acetate/petroleum ether mixed solution, and 2 column volumes are eluted.
After the eluent is concentratedAnd (3) carrying out Sephadex LH20 gel column chromatographic separation, eluting with a mobile phase of 50vol% methanol/dichloromethane mixed solution, and eluting by 3 column volumes. Concentrating the eluate, and separating with reverse phase silica gel column chromatography, preferably with stationary phase C 18 Silica gel, mobile phase is preferably 70vol% methanol/water mixture, elution 3 column volumes. Concentrating the eluent, separating by high performance liquid chromatography, and fixing the phases: semi-preparation of C 18 The preparative separations on a column, XBridge OBD,5 μm,10 × 250mm, mobile phase 80vol% methanol/water mixed solution gave compound 1 (10.6 mg), compound 2 (22.0 mg), the structure confirmation data of which were as follows:
compound 1
Yellow oil; [ alpha ] to] D 20 +160(c 1.00,MeOH)；UV(MeOH),λ max (logε)216(3.00),267(1.91),308(1.07)nm；ECD(c 0.02,MeOH),λ max (Δε)222(-46.0),249(31.8),331(19.5)nm； 11 H NMR(DMSO-d 6 ,600MHz)δ:10.39,(1H,brs,17-OH),10.34,(1H,brs,17′-OH),9.85,(1H,brs,15-OH),9.85,(1H,brs,15′-OH),6.18,(1H,brs,H-16),6.18,(1H,brs,H-18),6.18,(1H,brs,H-16′),6.18,(1H,brs,H-18′),5.95,(1H,dt,J＝15.6/4.8Hz,H-11),5.89,(1H,d,J＝15.6Hz,H-10),5.74,(1H,brs,H-4′),5.71,(1H,brs,H-5′),5.05,(1H,d,J＝9.6Hz,H-8′),4.93,(1H,d,J＝12.0Hz,H-8),4.80,(1H,brs,12′-OH),4.77,(1H,brs,H-4),4.75,(1H,brs,12-OH),4.67,(1H,dd,J＝10.8/4.8Hz,H-1′a),4.43,(1H,d,J＝10.8Hz,H-1a),3.99,(2H,brs,H-12),3.71,(1H,dd,J＝13.2/10.8Hz,H-1′b),3.50,(1H,d,J＝10.8Hz,H-1b),3.45,(1H,m,H-12′a),3.37,(1H,m,H-12′b),3.28,(1H,m,H-11′),3.17,(1H,m,H-8a′),3.02,(1H,d,J＝12.0Hz,H-8a),2.96,(1H,d,J＝10.2Hz,H-10′),2.70,(1H,d,J＝9.6Hz,H-5),2.29,(3H,s,H-20),2.26,(3H,s,H-20′),1.20,(3H,s,H-9′),1.16,(3H,s,H-9)； 13 C NMR(DMSO-d 6 ,150MHz)δ:206.3,(C,C-6),194.7,(C,C-6′),168.5,(C,C-13′),168.0,(C,C-13),162.5,(C,C-3′),160.4,(C,C-15),160.3,(C,C-15′),159.2,(C,C-17),158.6,(C,C-17′),150.2,(C,C-3),149.3,(C,C-4a′),140.0,(C,C-19),139.2,(C,C-19′),131.1,(CH,C-11),123.5,(CH,C-10),115.9,(CH,C-5′),109.9,(CH,C-16),109.6,(CH,C-16′),109.3,(C,C-14′),109.3,(C,C-14),107.4,(CH,C-4),102.7,(CH,C-4′),100.3,(CH,C-18),100.2,(CH,C-18′),75.7,(C,C-7),74.9,(CH,C-8),73.3,(C,C-7′),73.0,(CH,C-8′),67.3,(CH 2 ,C-1′),63.1,(CH 2 ,C-1),60.7,(CH 2 ,C-12),60.1,(CH 2 ,C-12′),49.5,(CH,C-5),49.1,(CH,C-10′),41.5,(CH,C-11′),40.6,(C,C-4a),34.2,(CH,C-8a′),31.4,(CH,C-8a),20.9,(CH 3 ,C-20′),21.2,(CH 3 ,C-20),19.6,(CH 3 ,C-9),19.2,(CH 3 ,C-9′).HRESIMS m/z 803.2512[M-H] - (calcd for C 42 H 43 O 16 ,803.2557).
Compound 2
Yellow oil; [ alpha ] to] D 20 +62(c 1.00,MeOH)；UV(MeOH),λ max (logε)217(2.87),268(1.82),312(2.40)nm；ECD(c 0.02,MeOH),λ max (Δε)267(13.1),305(-93.4),338(35.7)nm； 1 H NMR(DMSO-d 6 ,600MHz)δ:10.44,(1H,brs,17/17′-OH),9.89,(1H,brs,15/15′-OH),6.19,(1H,brs,H-18/18′),6.18,(1H,brs,H-16/16′),5.71,(1H,brs,H-4/4′),5.68,(1H,brs,H-5/5′),5.03,(1H,dt,J＝10.2Hz,H-8/8′),4.65,(1H,dt,J＝10.8/4.8Hz,H-1a/1′a),4.61,(1H,brs,12/12′-OH),3.74,(1H,dt,J＝13.2/10.8Hz,H-1b/1′b),3.41,(2H,brs,H-12/12′),3.19,(1H,m,H-8a/8a′),2.89,(1H,d,J＝8.4Hz,H-10/10′),2.26,(1H,m,H-11/11′),2.29,(1H,s,H-20/20′),1.19,(3H,s,H-9/9′)； 13 C NMR(DMSO-d 6 ,150MHz)δ:194.6,(C,C-6/6′),168.6,(C,C-13/13′),166.1,(C,C-3/3′),160.5,(C,C-15/15′),159.2,(C,C-17/17′),150.0,(C,C-4a/4a′),115.4,(CH,C-5/5′),109.6,(CH,C-16/16′),109.2,(C,C-14/14′),100.3,(CH,C-18/18′),100.2,(CH,C-4/4′),75.0,(CH,C-8/8′),73.2,(C,C-7/7′),67.8,(CH 2 ,C-1/1′),61.5,(CH 2 ,C-12/12′),40.6,(CH,C-10/10′),40.2,(CH,C-11/11′),34.3,(CH,C-8a/8a′),21.2,(CH 3 ,C-20/20′),19.2,(CH 3 ,C-9/9′).HRESIMS m/z 805.2709[M+H] + (calcd for C 42 H 45 O 16 ,805.2702).
Example 2
(1) Culture of marine fungus HBU-135 strain
A culture medium for culturing the strain of marine fungus HBU-135 contains glucose 10wt%, yeast extract 4.0wt%, peptone 4.0wt%, agar 6.0wt%, crude sea salt 10wt%, and water in balance, and is prepared into a test tube slant when used, and the fungus strain is cultured at 35 deg.C for 5 days.
(2) Fermentation culture of marine fungus HBU-135
The fermentation culture medium for fermentation culture of marine fungus HBU-135 comprises 120g of potato (removing potato residue after boiling in water for 20 min), 30g of glucose and CaCl in each 1000mL conical flask 2 40g and 600mL of water; the fermentation culture condition is shake culture at 35 deg.C for 20 days to obtain fermented product.
(3) Isolation analysis of Azaphilones dimer compounds
Extracting the fermentation product obtained in the step (2) with ethyl acetate for 4 times, combining ethyl acetate extraction solutions, concentrating under reduced pressure to obtain a crude extract, and performing normal phase silica gel column chromatographic separation firstly, wherein the stationary phase is as follows: 100-200 mesh silica gel, 3 column volumes of elution are carried out by using a mobile phase of 3vol% methanol/dichloromethane mixed solution, normal phase silica gel column chromatographic separation is carried out again after eluent is concentrated, and the stationary phase: 200-300 mesh silica gel, the mobile phase is 30vol% ethyl acetate/petroleum ether mixed solution, and 3 column volumes are eluted.
Concentrating the eluent, carrying out Sephadex LH20 gel column chromatographic separation, eluting with a mobile phase of 60vol% methanol/dichloromethane mixed solution, and eluting for 5 column volumes. Concentrating the eluate, and separating with reverse phase silica gel column chromatography, preferably with stationary phase C 18 Silica gel, the mobile phase is preferably a 60vol% methanol/water mixture, eluting 5 column volumes. Concentrating the eluent, separating by high performance liquid chromatography, and fixing the phases: semi-preparation of C 18 The column, XBridge OBD,5 μm,10 × 250mm, mobile phase 90vol% methanol/water mixed solution, was prepared to isolate compounds 1 and 2, the structure confirmation data of which is consistent with example 1.
The conditions for culturing and fermenting other strains, which are not specifically indicated in examples 1 and 2, and other experimental operating conditions such as normal phase silica gel column chromatographic separation, reverse phase silica gel column chromatographic separation, high performance liquid chiral chromatographic separation and the like are conventional experimental operating conditions in the art, and can be reasonably selected by a person skilled in the art according to actual needs.
The obtained azaphilones dimer compound has antitumor activity
(1) Antitumor Activity test
The in vitro inhibitory activity of human breast cancer cells (MDA-MB-231 and MCF-7), gastric cancer cells (MGC-803), cervical cancer cells (HeLa) and lung epithelial cancer cells (A-549) was tested using the MTT method.
(2) Activity test method
According to the cell growth rate, a certain number of cells in the logarithmic growth phase are inoculated into a 96-well culture plate at the concentration of 90 mu L/well, a sample to be tested is added at the concentration of 10 mu L/well after the cells are cultured for 24h, and three concentration gradients are made for each cell strain in parallel. Cells at 37 deg.C, 5% 2 After culturing for 48h under the conditions, adding 5mg/mL of MTT (Sigma) solution, and preparing 20 mu L/well with physiological saline; after further culturing for 4 hours, the triple solution (10% SDS-5% isobutanol-0.01 mol/L HCl) was added at 50. Mu.L/well, and the cells were placed in CO 2 The incubator was overnight. The OD 570 values were then measured with a microplate reader. Doxorubicin served as a positive control.
(3) Results of Activity test
IC for inhibiting tumor cell line 50 The values (. Mu.M) are shown in Table 1.
Table 1:
test results show that the compound 1 can selectively inhibit the growth of lung epithelial cancer cells (A-549), and the compound 2 has strong inhibition effects on human breast cancer cells (MDA-MB-231 and MCF-7), gastric cancer cells (MGC-803), cervical cancer cells (HeLa) and lung epithelial cancer cells (A-549).
Claims (5)
1. The azaphilones dimer compound derived from marine fungi is characterized in that the structural formula of the compound is shown in the specification
Or
。
2. A method for preparing the marine fungus-derived azaphilones dimer compound as claimed in claim 1, which is characterized by comprising the following steps:
(1) Geospora sp. ((II))Pleosporalessp.) inoculating the HBU-135 strain in a strain culture medium for strain culture; wherein the content of the first and second substances, geospora bacteria (A), (B), (C)Pleosporalessp.) HBU-135 strain, the preservation date is 2018, 10 and 18 months, the preservation number is CGMCC No.16379, the preservation unit is the common microorganism center of China Committee for culture Collection of microorganisms, and the preservation unit address is No. 3 of Xilu No.1 Beichen of Chaoyang district in Beijing;
(2) After the strain is cultured, inoculating the strain into a fermentation medium for fermentation to obtain a fermented product;
(3) Extracting the fermented product with ethyl acetate for 2-4 times, mixing ethyl acetate extractive solutions, and concentrating under reduced pressure to obtain crude extract;
(4) And (3) carrying out chromatographic separation on the obtained crude extract to obtain the azaphilones dimer compound, wherein the chromatographic separation is sequentially carrying out normal phase silica gel column chromatographic separation, reverse phase silica gel column chromatographic separation and high performance liquid chromatographic separation.
3. The method as claimed in claim 2, wherein in step (1), the strain culture medium is: 1.0-10wt% of glucose, 0.1-4.0wt% of yeast extract, 0.2-4.0wt% of peptone, 1.0-6.0wt% of agar, 3.0-10wt% of crude sea salt and the balance of water; the culture temperature of the strain is 15-35 deg.C, and the culture time is 3-10 days.
4. The method of claim 2, wherein in step (2), each unit serving of the fermentation medium comprises: 40-120g of potato, 10-30g of glucose and CaCl 2 5-40g of water and 200-600mL of water; the fermentation culture condition is shake culture at 15-35 deg.C for 10-20 days.
5. The method as claimed in claim 2, wherein in step (4):
the normal phase silica gel column chromatographic separation is as follows: eluting by using 100-200-mesh silica gel as a stationary phase and 1.5-3vol% of methanol/dichloromethane mixed solution as a mobile phase, wherein the elution volume is 3-5 column volumes, concentrating the obtained eluent, eluting by using 200-300-mesh silica gel as a stationary phase and 25-30vol% of ethyl acetate/petroleum ether mixed solution as a mobile phase, and the elution volume is 2-3 column volumes;
the stationary phase of the gel column chromatographic separation is sephadex LH-20, the mobile phase is 40-60vol% methanol/dichloromethane mixed solution for elution, and the elution volume is 3-5 column volumes;
the stationary phase adopted by the reverse phase silica gel column chromatographic separation is C 18 Silica gel, wherein the mobile phase is 60-70vol% methanol/water mixed solution, and the elution volume is 2-3 column volumes;
the chromatographic column adopted in the high performance liquid chromatography separation is semi-preparative C 18 Column, XBridge OBD,5 μm,10 × 250mm, mobile phase 70-90vol% methanol/water mixed solution.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010232233.XA CN111411045B (en) | 2020-03-27 | 2020-03-27 | Marine fungus-derived azaphilones dimer compound and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010232233.XA CN111411045B (en) | 2020-03-27 | 2020-03-27 | Marine fungus-derived azaphilones dimer compound and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111411045A CN111411045A (en) | 2020-07-14 |
| CN111411045B true CN111411045B (en) | 2022-10-04 |
Family
ID=71489348
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010232233.XA Active CN111411045B (en) | 2020-03-27 | 2020-03-27 | Marine fungus-derived azaphilones dimer compound and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111411045B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114606134B (en) * | 2021-03-10 | 2023-11-14 | 宁波大学 | Sponge coanda fungus and application thereof in preparation of oxaanthraquinone compounds |
| CN113527247B (en) * | 2021-08-18 | 2023-02-03 | 中国热带农业科学院热带作物品种资源研究所 | Azophilone polymer compound and preparation method and application thereof |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103911407B (en) * | 2014-02-28 | 2016-07-06 | 中山大学 | The preparation method of the Azaphilone class dimer compound in a kind of marine fungi source and application |
| CN108101878B (en) * | 2016-12-22 | 2021-04-09 | 扬州大学 | Azaphilones compounds in marine fungus HK1-6 and application thereof as MRSA resistant drugs |
| CN109706086B (en) * | 2019-01-18 | 2022-08-12 | 河北大学 | Marine fungus-derived azaphilones compound as well as preparation method and application thereof |
| CN109694827B (en) * | 2019-01-18 | 2022-08-12 | 河北大学 | Marine fungus-derived azaphilones compound, preparation method thereof and application thereof in preparation of anti-vibrio drugs |
-
2020
- 2020-03-27 CN CN202010232233.XA patent/CN111411045B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN111411045A (en) | 2020-07-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108660082B (en) | Marine aspergillus derived oxaanthraquinone compound, preparation method thereof and application thereof in preparation of antibacterial agent | |
| CN108753627B (en) | Marine aspergillus derived oxaanthraquinone compound, preparation method thereof and application thereof in preparation of antitumor agent | |
| CN101974464B (en) | Streptomyces and process for preparing antimycin antibiotics by fermentation using same | |
| CN109694827B (en) | Marine fungus-derived azaphilones compound, preparation method thereof and application thereof in preparation of anti-vibrio drugs | |
| CN109706086B (en) | Marine fungus-derived azaphilones compound as well as preparation method and application thereof | |
| CN102168044B (en) | Streptomyces sp. and process for preparing various antibiotics by using same | |
| CN111411045B (en) | Marine fungus-derived azaphilones dimer compound and preparation method thereof | |
| CN108048369B (en) | Marine streptomycete for producing staurosporine and preparation method thereof | |
| CN110863021B (en) | Preparation method and application of cytochalasin compound | |
| CN104694401A (en) | Penicillium verrucosum LPPV001 and method for producing ergosterol peroxide by same | |
| CN106010980A (en) | Endophytic fungus paraconiothyrium brasiliense strain and application thereof | |
| CN111423987B (en) | Marine fungus-derived azaphilones dimer compound and application thereof in antituberculosis drugs | |
| CN116042744A (en) | Antitumor active compound and preparation method thereof | |
| CN109810919B (en) | Ansha all-carbon cyclic polyketone antibiotics and application thereof in preparation of antibacterial drugs or antitumor drugs | |
| CN110218200B (en) | Cyclic depsipeptide compound in mangrove endophytic fungi and preparation method and application thereof | |
| US9322040B2 (en) | Pseudonocardia sp. and method for preparing deoxynyboquinone by utilizing same | |
| CN117106595A (en) | Industrial cannabis endophytic fungus HMY07 capable of producing flavonoid compounds and application thereof | |
| JPS6122099A (en) | Antitumoral antibiotic compound | |
| CN111321083B (en) | Ocean fungus source azaphilines dimer compound and application thereof in antitumor agent | |
| CN108727169A (en) | A kind of preparation method of the biphenyl ether compound in marine fungi source and the application as antiseptic | |
| CN115109023A (en) | Macrolide compound FWYZ52-A, and fermentation strain, fermentation method and application thereof | |
| CN110790660B (en) | Polyketide, preparation method, bacterial strain and application | |
| CN110527631B (en) | Unsaturated fatty acid compound from marine fungus HK1-22, preparation method and application thereof | |
| CN110642863B (en) | 5,5,6 type PTM compound and preparation method and application thereof | |
| CN114213428A (en) | Indole alkaloid compound and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |