CN108753627A - A kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and the application in preparing antitumor agent - Google Patents

A kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and the application in preparing antitumor agent Download PDF

Info

Publication number
CN108753627A
CN108753627A CN201810622689.XA CN201810622689A CN108753627A CN 108753627 A CN108753627 A CN 108753627A CN 201810622689 A CN201810622689 A CN 201810622689A CN 108753627 A CN108753627 A CN 108753627A
Authority
CN
China
Prior art keywords
aspergillus
oxa
marine
analog compound
anthraquinone analog
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201810622689.XA
Other languages
Chinese (zh)
Other versions
CN108753627B (en
Inventor
曹飞
朱华结
朱奡
刘莉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Heibei University
Original Assignee
Heibei University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Heibei University filed Critical Heibei University
Priority to CN201810622689.XA priority Critical patent/CN108753627B/en
Publication of CN108753627A publication Critical patent/CN108753627A/en
Application granted granted Critical
Publication of CN108753627B publication Critical patent/CN108753627B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/66—Aspergillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/145—Fungal isolates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/18—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing at least two hetero rings condensed among themselves or condensed with a common carbocyclic ring system, e.g. rifamycin

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Mycology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • Botany (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Application the present invention provides a kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and in preparing antitumor agent, the marine aspergillus are aspergillus（Aspergillussp.）ZA-01 bacterial strains, the deposit date is on January 25th, 2018, deposit number was CGMCC No.15270, and depositary institution is China Committee for Culture Collection of Microorganisms's common micro-organisms center, and depositary institution address is Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3.The structural formula of the compound is selected from formula 1- formulas 6, passes through fermented and cultured aspergillus（Aspergillussp.）ZA-01 bacterial strains, and the isolated above compound from tunning, verified, the compounds of this invention has stronger inhibitory activity to tumour cell, can be used as antitumor drug, has a extensive future.

Description

It a kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and is preparing Application in antitumor agent
Technical field
The present invention relates to marine natural medicinal chemistry arts, relate in particular to a kind of marine aspergillus source oxa- Anthraquinones Compound and preparation method thereof and the application in preparing antitumor agent.
Background technology
Ocean accounts for about the 71% of earth total surface area, has contained rich and varied living resources, is that the mankind carry out drug The precious resources library of research and development.Since the 1940s, using cephalosporin, cytarabine and ET-743 as a variety of seas of representative Foreign derived drug is by Successful utilization to clinically.Marine-derived fungal microbial resources are because its metabolite is abundant and repeatable The advantages that fermentation, becomes one of most important source of marine drug, wherein with the oxa- anthraquinone analog compound in marine fungi source Have become the important topic of modern marine drug research for the active compound for anti tumor of representative.
Currently, the type for the marine fungi source oxa- anthraquinone analog compound reported is limited, antitumous effect is also deposited In certain limitation, there has been no about oxa- anthraquinone analog compound of the present invention and its active report of anti-kinds of tumor cells at present Road.
Invention content
An object of the present invention is just to provide a kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof, To solve the problems, such as that the type of marine fungi source oxa- anthraquinone analog compound and antitumor activity are limited in the prior art.
The second object of the present invention be just to provide a kind of marine aspergillus source oxa- anthraquinone analog compound prepare it is antitumor Application in agent.
The purpose of the present invention is what is be achieved through the following technical solutions：A kind of marine aspergillus, the marine aspergillus are aspergillus (Aspergillus sp.) ZA-01 bacterial strains, the deposit date is on January 25th, 2018, deposit number was CGMCC No.15270, Depositary institution is China Committee for Culture Collection of Microorganisms's common micro-organisms center, and depositary institution address is Beijing's southern exposure The institute 3 of area North Star West Road 1.
1. sample source
Marine aspergillus ZA-01 strain isolations pick up from river from marine sediment, the marine sediment sample in June, 2015 The Cangzhou Cities Bei Sheng PORT OF HUANGHUA marine site.It after bottom sediment sample collection, is put in -20 DEG C of refrigerators and preserves at once, and be sent to experiment Room carries out the mask work of follow-up fungi.
2. the separation of fungi
The selection of 2.1 culture mediums
(1) PDA culture medium
Potato (peeling) 200g, glucose 20g, sea salt 30g, agar 20g, water 1000mL.Add 25 μ when detaching fungi G/mL streptomycin sulphates, 25 μ g/mL ampicillins inhibit bacterial growth.
(2) salt-free PDA culture medium
Potato (peeling) 200g, glucose 20g, agar 20g, water 1000mL.Add 25 μ g/mL sulfuric acid when detaching fungi Streptomysin, 25 μ g/mL ampicillins inhibit bacterial growth (salt-free PDA is compared with salt PDA is added).
(3) rose bengal medium
Potato (peeling) 200g, glucose 20g, sea salt 30g, rose-bengal (rose Bengal) 33mg (inhibit growth Fast mould sprawling growth), agar 20g, water 1000mL.
Separation, the purifying of 2.2 fungies
Above-mentioned marine sediment sample is placed in sterile glass device, 1mL sterile waters are added and are adjusted to sticky shape.It takes out 0.1mL aforesaid liquids dilute 10 times, 100 times, 1000 times with sterile water respectively, obtain the homogenate of 4 concentration gradients, use is sterile Pipette takes each concentration homogenates of 0.2mL to be separately added into PDA, salt-free PDA, rose bengal medium respectively, is applied with spreader It is even.Each concentration gradient do respectively three it is parallel.It is sealed with sealed membrane, and writes number.The above separating experiment is in sterile item It is carried out under part.
The culture medium of above-mentioned addition sample is respectively put into 28 DEG C of insulating boxs, is inverted culture.5-8d of general culture just have bacterium It falls either mycelium and grows (bacterial growth is fast, and 2-3d just have bacterium colony to grow out) from culture medium or the small block edge of tissue. It with transfer needle picking colony or mycelium tip, moves on new tablet, after isolating and purifying several times, can get the pure bacterium of fungi Strain.Fungi mask work generally carries out 35d.The last fortnight checks once daily, is checked later every 3-4d primary.Once it was found that having New bacterium colony or mycelium is grown, and should be transferred on new tablet at once.
3, the screening of bacterial strain
Aimed strain is screened using the method for screening active ingredients combination Chemical Screening.By being fermented on a small scale to bacterial strain (2 bottles), obtain coarse extract, to coarse extract carry out cytotoxic activity test, using to the inhibitory activity of tumour cell as screen mesh Mark one of the investigation factor of bacterial strain；And HPLC fingerprint map analyzings are carried out to coarse extract, using secondary metabolite amount as target The two of the investigation factor of bacterial strain, it is final to determine that the bacterial strain ZA-01 that inhibition activity of tumor cells is high and secondary metabolite is abundant is Aimed strain, and it is identified.
4, the identification of bacterial strain
3-7d is cultivated on PDA medium plate, grows to the fungi of optimum state, in sterilizing pipette tips picking single bacterium colony In a small amount of mycelia to the EP pipes equipped with 50 μ L Lysis buffer (lysate), the thermal denaturation 15min in 80 DEG C of water-baths, so 8000 rpm centrifuge 1min afterwards, and it is the template DNA of PCR reactions to take 3 μ L supernatants.
Primer for expanding and being sequenced is ITS1 and ITS4, and upper and lower primer sequence is：
ITS1：TCCGTAGGTGAACCTGCGG
ITS4：TCCTCCGCTTATTGATATGC
PCR reaction systems are 40 μ L systems, including：
Amplification condition is：
0.8% Ago-Gel of amplified production, 0.5 × TBE electrophoretic buffer samples, 5V/cm voltages, 5 μ L electricity of loading Swimming detection, DNA Marker indication molecule amounts, gel imager are observed and are taken a picture.Beijing three is sent to win Radix Polygalae pcr amplification product Company is sequenced, and is finally accredited as aspergillus (Aspergillus sp.).
A kind of marine aspergillus source oxa- anthraquinone analog compound, the structural formula of the compound are
A kind of preparation method of above-mentioned marine aspergillus source oxa- anthraquinone analog compound, includes the following steps：
(1) above-mentioned aspergillus (Aspergillus sp.) ZA-01 inoculations are subjected to strain training in bacterium culture medium It supports；
(2) it after the completion of Spawn incubation, is inoculated in fermentation medium and is fermented, obtain fermentate；
(3) extraction 2-4 times is carried out to fermentate with ethyl acetate, is concentrated under reduced pressure to give after combined ethyl acetate extract liquor thick Medicinal extract；
(4) chromatographic isolation is carried out up to the oxa- anthraquinone analog compound to gained coarse extract, the chromatographic isolation is Normal phase silica gel column chromatography separation, reversed-phase silica gel column chromatography separation, gel column chromatography separation and high performance liquid chromatography point are carried out successively From.
Bacterium culture medium is described in step (1)：1.0-10wt% of glucose, 0.1-4.0wt% of yeast extract, peptone 0.2-4.0wt%, 1.0-6.0wt% of agar, 3.0-10wt% of coarse sea salt, remaining is water；Spawn incubation temperature is 15-35 DEG C, Incubation time is 3-10 days.
The fermentation medium of per unit part includes 60-150g of rice, NaNO in step (2)30.1–0.6g、KH2PO4 0.05–0.2g、MgSO4·7H2O 0.02–0.1g、NaCl 0.02–0.1g、FeSO40.01-0.05g, 2-6g of sucrose, water 50- 150mL；Fermentation culture conditions are stationary culture 20-50 days at 15-35 DEG C.
Normal phase silica gel column chromatography is separated into described in step (4)：First use stationary phase for 100~200 mesh silica gel, mobile phase It is eluted for 15-25vol% ethyl acetate/petroleum ether mixed solutions, elution volume is 3-5 column volume, and gained is eluted Use stationary phase for 200~300 mesh silica gel again after liquid concentration, mobile phase is 65-75vol% methylene chloride/methanol mixed solutions It is eluted, elution volume is 2-3 column volume.
The stationary phase that the separation of reversed-phase silica gel column chromatography described in step (4) uses is C18Silica gel, mobile phase are 60- 70vol% methanol/water mixed solutions, elution volume are 2-3 column volume.
The stationary phase of the separation of gel column chromatography described in step (4) is sephadex LH-20, and mobile phase is dichloromethane, Elution volume is 3-5 column volume.
The chromatographic column used in high performance liquid chromatography separation described in step (4) prepares C for half18Chromatographic column, XBridge OBD, 5 μm, 10 × 250mm, mobile phase is the methanol/water mixed solution of 75-80vol%；Silica gel chromatographic column is partly prepared, ViridisTMSilica 2-Ethylpyridine, 5 μm, 10 × 250mm, mobile phase is mixed for 80-85vol% petroleum ethers/ethyl alcohol Close solution.
A kind of application of marine aspergillus source oxa- anthraquinone analog compound in preparing antitumor agent, the antitumor agent with Above-mentioned compound or its pharmaceutically acceptable salt are active ingredient.
The above-mentioned oxa- anthraquinone analog compound or its pharmaceutically acceptable salt in a kind of marine aspergillus source prevent preparing And/or treatment is by human breast cancer cell (MDA-MB-231 and MCF-7), stomach cancer cell (MGC-803), cervical cancer cell (HeLa) With the application in the drug of tumor disease caused by lung epithelial cancer cell (A-549).
Term " pharmaceutically acceptable salt " refers to the addition of atoxic inorganic or organic acid and/or alkali in the present invention Salt, reference can be made to " Salt selection for basic drugs ", Int.J.Pharm. (1986), 33,201-217.
The present invention obtains oxa- anthraquinone analog compound 1-6 by marine fungi ZA-01 strain fermentations, to human breast cancer cell (MDA-MB-231 and MCF-7), stomach cancer cell (MGC-803), cervical cancer cell (HeLa) and lung epithelial cancer cell (A-549) It with strong inhibitory activity, can be used as antitumor drug, have a extensive future.
Specific implementation mode
Embodiment 1
(1) culture of marine fungi ZA-01 strains
Culture medium used in the Spawn incubation of marine fungi ZA-01 contains glucose 1.0wt%, yeast extract 0.1wt%, egg White peptone 0.2wt%, agar 1.0wt%, coarse sea salt 3.0wt%, remaining is water, and test tube slant, marine fungi is made in when use ZA-01 bacterial strains are cultivated 3 days at 28 DEG C.
(2) fermented and cultured of marine fungi ZA-01
Fermentation medium used in the fermented and cultured of marine fungi ZA-01 is to contain rice in each 1000mL conical flasks 60g、 NaNO30.1g、KH2PO40.05g、MgSO4·7H2O 0.02g、NaCl 0.02g、FeSO40.01g, sucrose 2g, water 50mL, bacterial strain are cultivated 28 days in 28 DEG C of standing for fermentation, obtain fermentate；80 1000mL conical flasks are used to ferment altogether.
(3) the separation analysis of oxa- anthraquinone analog compound
The fermentate obtained by step (2) is taken, is extracted with ethyl acetate 2 times, combined ethyl acetate extract liquor is concentrated under reduced pressure To coarse extract, normal phase silica gel column chromatography separation, stationary phase are first carried out：100~200 mesh silica gel, mobile phase are 15vol% acetic acid second Ester/petroleum ether mixed solution elutes 5 column volumes, normal phase silica gel column chromatography separation is carried out again after eluent concentration, fixed Phase：200~300 mesh silica gel, mobile phase are the methylene chloride/methanol mixed solution of 65vol%, elute 2 column volumes.
Reversed-phase silica gel column chromatography separation is carried out after eluent concentration, stationary phase is preferably C18Silica gel, mobile phase are preferably 60vol% methanol/water mixed solutions elute 3 column volumes.Sephadex LH20 gel column chromatographies are carried out after eluent concentration Separation, mobile phase：Dichloromethane elutes 3 column volumes, high performance liquid chromatography separation, stationary phase is carried out after eluent concentration：Half Prepare C18Chromatographic column, XBridge OBD, 5 μm, 10 × 250mm, mobile phase is the methanol/water mixed solution of 75vol%, and partly Prepare silica gel chromatographic column, ViridisTMSilica 2-Ethylpyridine, 5 μm, 10 × 250mm, mobile phase is 80vol%'s Petroleum ether/alcohol mixed solution, preparative separation obtain compound 1 (15.0mg), compound 2 (4.5mg), 3 (5.0mg), 4 (5.2 Mg), 5 (5.0mg), 6 (4.5mg), 7 (5.0mg), 8 (4.7mg), structural identification data difference are as follows：
Compound 1Yellow amorphous powder；[α]D 20-97(c0.1,MeOH)；IR(KBr) νmax 3445,2929,2355,1635,1591,1475,1246,1065,895cm–1；1H NMR(CDCl3,600Hz)δ:12.97 (1H, brs, 1-OH), 7.66 (1H, d, J=8.4Hz, H-3), 7.24 (1H, s, H-5), 6.89 (1H, brs, H-25), 6.82 (1H, d, J=8.4Hz, H-2), 5.10 (1H, brs, H-14), 4.80 (1H, s, Ha-22), 4.75 (1H, s, Hb-22), 4.54 (1H, brd, J=10.8 Hz, Ha-19), 4.31 (1H, dd, J=10.8,2.4Hz, Hb-19), 3.45 (1H, brs, H-15), 3.28(1H,s,14-OCH3), 2.73(1H,brs,15-OH),2.71(1H,brs,H-20),2.35(3H,s,H-24),2.07 (3H,s,25-OAc),1.88(3H,s, H-23),1.40(3H,s,H-18),1.25(3H,s,H-17).13C NMR(CDCl3, 150MHz)δ:183.0(C,C-13), 170.0(C,25-COOCH3),161.7(C,C-1),152.2(C,C-10),151.5 (C,C-11),150.2(C,C-7),141.5(C, C-21),137.6(C,C-6),135.3(CH,C-3),120.2(CH,C- 5),116.3(C,C-12),115.2(C,C-8),115.0(C, C-4),112.7(CH2,C-22),110.4(CH,C-2), 109.0(C,C-9),78.3(CH,C-15),76.2(CH,C-14),72.9 (C,C-16),65.4(CH,C-25),63.8 (CH2,C-19),56.6(CH3,14-OCH3),42.5(CH,C-20),26.5(CH3, C-18),26.5(CH3,C-17),22.3 (CH3,C-23),21.2(CH3,25-COOCH3 ),17.2(CH3,C-24)HRESIMS m/z 535.1935([M+Na]+, C28H32O9Na；calc.535.1939).
Compound 2Yellow amorphous powder；[α]D 20=-120 (c0.1, CH3OH)；IR (KBr) νmax3442,2929,2358,1639,1593,1471,1242,1072,894cm–1；1H NMR(CDCl3,600MHz) δ:12.71 (1H, brs, 1-OH), 7.72 (1H, d, J=8.4Hz, H-3), 7.21 (1H, s, H-5), 6.86 (1H, d, J= 8.4Hz, H-2), 5.40 (1H, brs, H-25), 5.13 (1H, d, J=2.4Hz, H-14), 4.94 (3H, d, J=2.4Hz, 25- ), OAc 4.78 (1H, s, Ha-22), 4.56 (1H, s, Hb-22), 4.43 (1H, brd, J=10.8Hz, Ha-19), 4.35 (1H, Dd, J=10.8,2.4 Hz, Hb-19), 3.46 (1H, brs, H-15), 3.29 (1H, s, 14-OCH3),2.95(1H,brs,15- OH),2.72(1H,brs, H-20),2.35(3H,s,H-24),1.84(3H,s,H-23),1.42(3H,s,H-18),1.25 (3H,s,H-17).13C NMR (CDCl3,150MHz)δ:184.2(C,C-13),161.5(C,C-1),152.4(C,C-10), 151.7(C,C-11),149.6(C, C-7),142.5(C,C-21),138.6(C,C-6),135.9(CH,C-3),121.2 (CH,C-8),119.0(C,C-5),116.9(C, C-12),115.5(C,C-4),112.2(CH2,C-22),110.5(CH,C- 2),108.9(C,C-9),78.2(CH,C-15),76.2 (CH,C-14),72.9(C,C-16),65.4(CH2,C-19),63.1 (CH,C-25),56.6(CH3,14-OCH3),44.8(CH, C-20),26.5(CH3,C-17),26.5(CH3,C-18),22.5 (CH3,C-23),17.3(CH3,C-24).HRESIMS m/z 493.1839([M+Na]+,C26H30O9Na； calc.493.1833).
Compound 3Yellow amorphous powder；[α]D 20=-107 (c0.1, CH3OH)；IR (KBr) νmax3419,2966,2358,1737,1733,1473,1238,1020,829cm–1；1H NMR(DMSO-d6,600Hz) δ:12.78 (1H, brs, 1-OH), 7.82 (1H, d, J=8.4Hz, H-3), 7.50 (1H, s, H-5), 6.81 (1H, brs, H- 25), 6.77 (1H, d, J=8.4Hz, H-2), 5.47 (1H, d, J=2.8Hz, H-14), 5.19 (1H, d, J=5.4Hz, 14- ), OH 4.79 (1H, s, Ha-22), 4.61 (1H, s, Hb-22), 4.56 (1H, brd, J=11.4Hz, Ha-19), 4.55 (1H, Brs, 16-OH), 4.44 (1H, brd, J=7.2Hz, 14-OCH3), 4.20 (1H, dd, J=11.4,2.4Hz, Hb-19), 3.27 (1H, brd, J=7.2Hz, H-15), 2.68 (1H, brs, H-20), 2.31 (3H, s, H-24), 1.99 (1H, s, 25- OH),1.81(3H,s,H-23),1.28(3H,s, H-18),1.21(3H,s,H-17).13C NMR(DMSO-d6,150Hz)δ: 183.1(C,C-13),169.3(C, 25-COOCH3),159.6(C,C-1),151.4(C,C-10),150.5(C,C-11), 149.9(C,C-7),141.8(C,C-21), 137.6(C,C-6),135.8(CH,C-3),122.3(CH,C-4),120.7(C, C-5),115.5(C,C-12),114.7(C,C-8), 112.6(CH2,C-22),109.2(CH,C-2),108.1(C,C-9), 78.0(CH,C-15),72.7(CH,C-16),65.3(C, C-14),64.8(CH,C-25),63.5(CH2,C-19),41.7 (CH,C-20),27.5(CH3,C-18),26.2(CH3,C-17), 22.1(CH3,C-23),21.0(CH3,25-COOCH3 ), 16.9(CH3,C-24).HRESIMS m/z 521.1784([M+Na]+, C27H30O9Na；calc.521.1782).
Compound 4Yellow amorphous powder；[α]D 20=+39 (c0.1, CH3OH)；IR (KBr) νmax3421,2964,2356,1726,1718,1475,1236,1016,835cm–1；1H NMR(DMSO-d6,600Hz) δ:12.84 (1H, brs, 1-OH), 7.83 (1H, d, J=8.4Hz, H-3), 7.40 (1H, s, H-5), 6.78 (1H, d, J= 8.4Hz, H-2), 5.81 (1H, brs, H-25), 5.48 (1H, brs, H-14), 5.26 (1H, d, J=3.6Hz, 25-OH), 5.17 (1H, d, J=3.6Hz, 14-OH), 4.74 (1H, s, Ha-22), 4.55 (1H, s, Hb-22), 4.54 (1H, brs, 16- ), OH 4.46 (1H, brs, J=11.4Hz, Ha-19), 4.46 (1H, brd, J=6.6Hz, 15-OH), 4.34 (1H, dd, J= 11.4,2.4Hz, Hb-19), 3.27 (1H, brd, J=6.6Hz, H-15), 2.51 (1H, brs, H-20), 2.29 (3H, s, H- 24),1.78(3H,s,H-23),1.29(3H, s,H-18),1.22(3H,s,H-17).13C NMR(DMSO-d6,150Hz)δ: 183.4(C,C-13),159.6(C,C-1), 151.1(C,C-10),150.5(C,C-11),148.7(C,C-7),142.8(C, C-21),137.2(C,C-6),135.6(CH,C-3), 122.2(CH,C-4),121.0(C,C-8),119.1(C,C-5), 115.8(C,C-12),111.9(CH2,C-22),109.0(CH, C-2),108.1(C,C-9),78.0(CH,C-15),72.7 (CH,C-16),65.2(C,C-14),63.5(CH2,C-19),60.9 (CH,C-25),44.4(CH,C-20),27.5(CH3,C- 18),26.2(CH3,C-17),22.4(CH3,C-23),16.9(CH3, C-24).HRESIMS m/z 457.1857([M+H]+, C25H29O8；calc.457.1857).
Compound 5Yellow amorphous powder；[α]D 20=-92 (c0.1, CH3OH)；IR (KBr) νmax3432,2926,2357,1662,1587,1465,1236,1064,847cm–1；1H NMR(CDCl3,600Hz)δ: 12.97 (1H, brs, 1-OH), 7.59 (1H, d, J=8.4Hz, H-3), 7.24 (1H, s, H-5), 6.88 (1H, brs, H-25), 6.77 (1H, d, J=8.4Hz, H-2), 5.41 (1H, d, J=1.8Hz, H-14), 5.00 (1H, d, J=2.4Hz, H-15), 4.80 (1H, s, Ha-22), 4.74 (1H, s, Hb-22), 4.54 (1H, brd, J=10.8Hz, Ha-19), 4.32 (1H, dd, J =10.8,3.0Hz, Hb-19), 3.34 (3H, s, 14-OCH3),2.72(1H,brs,H-20),2.36(3H,s,H-24), 2.10(3H,s,25-COOCH3),1.92 (3H,s,15-COOCH3),1.88(3H,s,H-23),1.56(3H,s,H-18), 1.22(3H,s,H-17).13C NMR(CDCl3, 150Hz)δ:183.0(C,C-13),170.2(C,15-COOCH3),170.1 (C,25-COOCH3),162.0(C,C-1), 152.2(C,C-10),151.5(C,C-11),150.3(C,C-7),141.6(C, C-21),137.6(C,C-6),134.1(C,C-3), 120.3(CH,C-5),116.5(C,C-12),115.1(C,C-8), 113.4(C,C-4),112.7(CH2,C-22),110.0(CH, C-2),109.1(C,C-9),77.0(CH,C-15),76.4 (CH,C-14),72.7(C,C-16),65.4(CH,C-25),63.8 (CH2,C-19),57.1(CH3,14-OCH3),42.5 (CH,C-20),27.9(CH3,C-18),26.9(CH3,C-17),22.4 (CH3,C-23),21.3(CH3,25-COOCH3 ), 20.5(CH3,15-COOCH3 ),17.3(CH3,C-24).HRESIMS m/z 577.2048([M+Na]+,C30H34O10Na； calc.577.2044).
Compound 6Yellow amorphous powder；[α]D 20=-73 (c0.1, CH3OH)；IR (KBr) νmax3434,2929,2354,1665,1587,1466,1232,1069,852cm–1；1H NMR(CDCl3,600Hz)δ: 12.74 (1H, brs, 1-OH), 7.65 (1H, d, J=8.4Hz, H-3), 7.22 (1H, s, H-5), 6.82 (1H, d, J= 8.4Hz, H-2), 5.42 (1H, d, J=1.2Hz, H-14), 5.40 (1H, brs, H-25), 5.02 (1H, d, J=2.4Hz, H- 15), 4.86 (1H, d, J=3.0 Hz, 25-OH), 4.78 (1H, s Ha-22), 4.55 (1H, s, Hb-22), 4.43 (1H, brd, J=10.8Hz, Ha-19), 4.36 (1H, dd, J=10.8,3.0Hz, Hb-19), 3.34 (3H, s, 14-OCH3),2.73(1H, brs,H-20),2.37(3H,s,H-24),1.91 (3H,s,15-COOCH3),1.84(3H,s,H-23),1.56(3H,s,H- 18),1.22(3H,s,H-17).13C NMR(CDCl3, 150Hz)δ:184.2(C,C-13),170.2(C,25-COOCH3), 161.8(C,C-1),152.4(C,C-10),151.7(C, C-11),149.7(C,C-7),142.6(C,C-21),138.6(C, C-6),134.6(C,C-3),121.2(CH,C-8),119.1(C, C-5),117.0(C,C-12),113.8(C,C-4), 112.2(CH2,C-22),110.1(CH,C-2),109.0(C,C-25),57.1 (CH3,14-OCH3),44.8(CH,C-20), 27.9(CH3,C-18),26.9(CH3,C-17),22.5(CH3,C-23),20.4 (CH3,15-COOCH3 ),17.4(CH3,C- 24).HRESIMS m/z 535.1939([M+Na]+,C28H32O9Na；cacl. 535.1939).
Compound 7Yellow amorphous powder；[α]D 20=-56 (c0.1, CH3OH)；IR(KBr) νmax3446,2972,2368,1733,1645,1471,1249,1029,831cm–1；1H NMR(CDCl3,600Hz)δ:13.00 (1H, brs, 1-OH), 7.73 (1H, d, J=8.4Hz, H-3), 7.24 (1H, s, H-5), 6.90 (1H, brs, H-25), 6.79 (1H, d, J=8.4Hz, H-2), 5.28 (1H, brs, H-14), 4.85 (1H, s, Ha-22), 4.82 (2H, s, H-17), 4.77 (1H, s, Hb-22), 4.55 (1H, brd, J=10.8Hz, Ha-19), 4.27 (1H, dd, J=10.8,2.4Hz, Hb-19), 4.27 (1H, d, J=8.4Hz, H-15) 2.76 (1H, brs, 14-OH), 2.72 (1H, brs, H-20), 2.52 (1H, brs, 15- OH),2.35(3H,s,H-24),2.08 (3H,s,25-COOCH3 ),1.89(3H,s,H-23),1.82(3H,s,H-18).13C NMR(CDCl3,150Hz)δ:183.1 (C,C-13),170.0(C,25-COOCH3),161.7(C,C-1),152.0(C,C- 10),151.6(C,C-11),150.3(C,C-7), 143.4(C,C-16),141.4(C,C-21),137.7(C,C-6), 134.5(CH,C-3),120.2(CH,C-5),117.7(C,C-4), 116.3(C,C-12),115.0(C,C-8),113.7 (CH2,C-17),112.8(CH2,C-22),110.3(CH,C-2),108.2(C, C-9),79.1(CH,C-15),68.8(CH, C-14),65.5(CH,C-25),63.8(CH2,C-19),42.5(CH,C-20),22.4 (CH3,C-23),21.2(CH3,25- COOCH3 ),18.6(CH3,C-18),17.3(CH3,C-24).HRESIMS m/z 503.1667([M+Na]+,C27H28O8Na； calc.503.1676).
Compound 8Yellow amorphous powder；[α]D 20=-113 (c0.1, CH3OH)；IR (KBr) νmax3431,2972,2352,1733,1637,1471,1249,1054,817cm–1；1H NMR(CDCl3,600Hz)δ: 12.70 (1H, brs, 1-OH), 7.76 (1H, d, J=8.4Hz, H-3), 7.20 (1H, s, H-5), 6.79 (1H, d, J= 8.4Hz, H-2), 5.41 (1H, brs, H-25), 5.28 (1H, brs, H-14), 4.99 (1H, d, J=8.4Hz, 25-OH), 4.83 (1H, s, Ha-22), 4.82 (2H, s, H-17), 4.60 (1H, s, Hb-22), 4.41 (1H, brd, J=10.8Hz, Ha- 19), 4.33 (1H, dd, J=10.8,2.4Hz, Hb-19), 4.26 (1H, d, J=5.4Hz, H-15), 2.94 (1H, brs, 14- ), OH 2.73 (1H, brd, J=2.4Hz, H-20), 2.59 (1H, brs, 15-OH), 2.35 (3H, s, H-24), 1.86 (3H, s, H-23),1.83(3H,s,H-18).13C NMR (CDCl3,150Hz)δ:184.3(C,C-13),161.4(C,C-1),152.1 (C,C-10),151.8(C,C-11),149.8(C, C-7),143.3(C,C-16),142.5(C,C-21),138.7(C,C-6) 135.0(CH,C-3),121.4(C,C-8),118.9(CH, C-5),118.2(C,C-4),116.8(C,C-12),113.7 (CH2,C-17),112.3(C,C-22),110.3(CH,C-2),108.7 (C,C-9),79.1(CH,C-15),68.8(CH,C- 14),64.8(CH2,C-19),63.3(CH,C-25),45.0(CH,C-20), 22.5(CH3,C-23),18.6(CH3,C-18), 17.4(CH3,C-24).HRESIMS m/z 461.1569([M+Na]+, C25H26O7Na；cacl.461.1571).
Embodiment 2
(1) culture of marine fungi ZA-01 strains
Culture medium 10wt% containing glucose, yeast extract 4.0wt%, albumen used in the Spawn incubation of marine fungi ZA-01 Peptone 4.0wt%, agar 6.0wt%, coarse sea salt 10wt%, remaining is water, and test tube slant is made in when use, and fungal bacterial strain is 35 It is cultivated 5 days at DEG C.
(2) fermented and cultured of marine fungi ZA-01
Fermentation medium used in the fermented and cultured of marine fungi ZA-01 is to contain rice in each 1000mL conical flasks 150g、 NaNO30.6g、KH2PO40.2g、MgSO4·7H2O 0.01g、NaCl 0.1g、FeSO40.05g, sucrose 6g, water 150mL, bacterial strain are cultivated 45 days in 35 DEG C of standing for fermentation, obtain fermentate.
(3) the separation analysis of oxa- anthraquinone analog compound
The fermentate obtained by step (2) is taken, is extracted with ethyl acetate 4 times, combined ethyl acetate extract liquor is concentrated under reduced pressure To coarse extract, normal phase silica gel column chromatography separation, stationary phase are first carried out：100~200 mesh silica gel, mobile phase are 25vol% acetic acid second Ester/petroleum ether mixed solution elutes 3 column volumes, normal phase silica gel column chromatography separation is carried out again after eluent concentration, fixed Phase：200~300 mesh silica gel, mobile phase are 75vol% methylene chloride/methanol mixed solvents, elute 3 column volumes.
Reversed-phase silica gel column chromatography separation is carried out after eluent concentration, stationary phase is preferably C18Silica gel, mobile phase are preferably 70vol% methanol/water mixed solutions elute 2 column volumes, Sephadex LH20 gel column chromatographies are carried out after eluent concentration Separation, mobile phase：Dichloromethane elutes 5 column volumes, high performance liquid chromatography separation, stationary phase is carried out after eluent concentration：Half Prepare C18Chromatographic column, XBridge OBD, 5 μm, 10 × 250mm, mobile phase is 80vol% methanol/water mixed solutions, and half system Standby silica gel chromatographic column, ViridisTMSilica 2-Ethylpyridine, 5 μm, 10 × 250mm, mobile phase is the stone of 85vol% Oily ether/alcohol mixed solution, preparative separation obtain compound 1-8, and structural identification data is consistent with embodiment 1.
Other Spawn incubations for not particularly pointed out in Examples 1 and 2, fermentation condition and normal phase silica gel column chromatography separation, Reversed-phase silica gel column chromatography separation, gel column chromatography separation, efficient liquid phase chiral chromatogram separation etc. other experimental operating conditions be The experimental operating conditions of this field routine, those skilled in the art can reasonably be selected according to actual needs.
The antitumor activity of gained oxa- anthraquinone analog compound
(1) antitumor activity is tested
Using MTT methods to human breast cancer cell (MDA-MB-231 and MCF-7), stomach cancer cell (MGC-803), cervical carcinoma The external inhibitory activity of cell (HeLa) and lung epithelial cancer cell (A-549) is tested.
(2) activity test method
By cell growth rate, certain amount is in the cell of exponential phase and is inoculated in 96 with the concentration in 90 holes μ L/ In well culture plate, 10 holes μ L/ of sample to be tested are added in culture afterwards for 24 hours, and to each cell strain, each concentration gradient is done three and put down Row.Cell is in 37 DEG C, 5%CO2Under the conditions of culture 48h after, add MTT (Sigma) liquid 5mg/mL, with physiological saline configure 20 μ L/ Hole；Continue after cultivating 4h, 50 holes μ L/ three liquid (10%SDS-5% isobutanol -0.01mol/L HCl) are added, are placed in CO2Training It supports in case overnight.Then 570 values of OD are surveyed with microplate reader.Adriamycin is as positive control drug.
(3) active testing result
Test result shows that compound on tumor cell prepared by the present invention, which has, inhibits growth, wherein compound The growth of the inhibition lung epithelial cancer cell (A-549) of 1 energy selectivity, 3,6 couples of human breast cancer cell (MDA-MB-231 of compound And MCF-7), stomach cancer cell (MGC-803), cervical cancer cell (HeLa) and lung epithelial cancer cell (A-549) have stronger suppression It makes and uses, inhibit the IC of tumor cell line50Value (μM) is shown in Table 1.
Table 1：
Experiment shows that the oxa- anthraquinone analog compound containing 4 prenylations and 14,15- dihydroxy of the invention has The activity for inhibiting tumour cell, can be made into antitumor drug, be with a wide range of applications.
The antibacterial activity of gained oxa- anthraquinone analog compound
(1) antibacterial activity is tested
Using gradient dilution method to micrococcus lysodeikticus (Micrococcus lysodeikticus), bacillus anthracis (Bacillus anthraci), Salmonella typhi (Salmonella typhi) and clostridium perfringen (Enterobacter Aerogenes active testing) is carried out.
(2) activity test method
In aseptic superclean bench, takes appropriate bacteria culture liquid medium to be added in blank culture solution and is diluted, Dilution is generally 1:1000 or 1:500.Diluted liquid spawn 198 is taken with sterile liquid-transfering gun (pipette tips pass through sterilization treatment) μ L are added on 96 orifice plates, and 2 μ L samples to be tested are added in first hole, and (crude extract or monomeric compound of DMSO configurations are molten Liquid), doubling dilution is taken turns doing to the 8th concentration gradient with liquid-transfering gun, and mixing, 37 DEG C of culture 18h-are shaken after dilution 22h measures absorbance with microplate reader (630nm), obtains the minimal inhibitory concentration (MIC) of sample.The ultimate density of DMSO is kept 1%.Each sample concentration sets three Duplicate Samples, in addition sets blank control, negative control (DMSO) and positive control (ring Third husky star).
(3) active testing result
Test result shows that compound 1-6 is to micrococcus lysodeikticus (Micrococcus lysodeikticus), anthrax bar Bacterium (Bacillus anthraci), Salmonella typhi (Salmonella typhi) and clostridium perfringen (Enterobacter Aerogenes it is 20.0 μ g/mL) to have weak inhibitory activity, MIC value.Compound 7 and 8 pairs of micrococcus lysodeikticus (Micrococcus lysodeikticus), bacillus anthracis (Bacillus anthraci), Salmonella typhi (Salmonella Typhi) and clostridium perfringen (Enterobacter aerogenes) has strong inhibitory activity, and compound 7 is to four pathogen strain bacterium It is respectively 0.78 μ g/mL to inhibit MIC value, and 12.5 μ g/mL, 6.13 μ g/mL and 6.13 μ g/mL, compound 8 is to four pathogen strain bacterium It is respectively 6.13 μ g/mL, 12.5 μ g/mL, 6.13 μ g/mL and 6.13 μ g/mL, positive control Ciprofloxacin pair four to inhibit MIC value It is respectively 0.19 μ g/mL, 1.56 μ g/mL, 3.13 μ g/mL and 1.56 μ g/mL that pathogen strain bacterium, which inhibits MIC value,.

Claims (10)

1. a kind of marine aspergillus, characterized in that the marine aspergillus is aspergillus（Aspergillussp.）ZA-01 bacterial strains, preservation Date is on January 25th, 2018, and deposit number is CGMCC No.15270, and depositary institution is Chinese microorganism strain preservation management Committee's common micro-organisms center, depositary institution address are Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3.
2. a kind of marine aspergillus source oxa- anthraquinone analog compound, characterized in that the structural formula of the compound is
、、、、Or。
3. a kind of preparation method of the marine aspergillus source oxa- anthraquinone analog compound described in claim 2, characterized in that including Following steps：
（1）By aspergillus described in claim 1（Aspergillussp.）ZA-01 inoculations carry out in bacterium culture medium Spawn incubation；
（2）It after the completion of Spawn incubation, is inoculated in fermentation medium and is fermented, obtain fermentate；
（3）Extraction 2-4 times is carried out to fermentate with ethyl acetate, thick leaching is concentrated under reduced pressure to give after combined ethyl acetate extract liquor Cream；
（4）Chromatographic isolation is carried out up to the oxa- anthraquinone analog compound to gained coarse extract, the chromatographic isolation is successively Carry out normal phase silica gel column chromatography separation, reversed-phase silica gel column chromatography separation, gel column chromatography separation and high performance liquid chromatography separation.
4. the preparation method of marine aspergillus source oxa- anthraquinone analog compound according to claim 3, characterized in that step （1）Described in bacterium culture medium be：1.0-10wt% of glucose, 0.1-4.0wt% of yeast extract, 0.2-4.0wt% of peptone, agar 1.0-6.0wt%, 3.0-10wt% of coarse sea salt, remaining is water；Spawn incubation temperature is 15-35 DEG C, and incubation time is 3-10 days.
5. the preparation method of marine aspergillus source oxa- anthraquinone analog compound according to claim 3, characterized in that step （2）The fermentation medium of middle per unit part includes 60-150 g, NaNO of rice3 0.1–0.6 g、KH2PO4 0.05–0.2 g、MgSO4•7H2O 0.02–0.1 g、NaCl 0.02–0.1 g、FeSO4 0.01-0.05 g, 2-6 g of sucrose, water 50-150 mL；Fermentation culture conditions are stationary culture 20-50 days at 15-35 DEG C.
6. the preparation method of marine aspergillus source oxa- anthraquinone analog compound according to claim 3, characterized in that step （4）Described in normal phase silica gel column chromatography be separated into：First use stationary phase for 100 ~ 200 mesh silica gel, mobile phase is 15-25vol% second Acetoacetic ester/petroleum ether mixed solution is eluted, and elution volume is 35 column volumes, is used again after gained eluent is concentrated Stationary phase is 200 ~ 300 mesh silica gel, and mobile phase is that 65-75vol% methylene chloride/methanol mixed solutions are eluted, elution volume For 23 column volumes.
7. the preparation method of marine aspergillus source oxa- anthraquinone analog compound according to claim 3, characterized in that step （4）Described in the stationary phase that uses of reversed-phase silica gel column chromatography separation for C18Silica gel, mobile phase mix for 60-70vol% methanol/waters Solution, elution volume are 23 column volumes.
8. the preparation method of marine aspergillus source oxa- anthraquinone analog compound according to claim 3, characterized in that step （4）Described in gel column chromatography separation stationary phase be sephadex LH-20, mobile phase is dichloromethane, elution volume 3 5 column volumes.
9. the preparation method of marine aspergillus source oxa- anthraquinone analog compound according to claim 3, characterized in that step （4）Described in the chromatographic column that uses in high performance liquid chromatography separation prepare C for half18Chromatographic column, XBridge OBD, 5 μm, 10 × 250 mm, mobile phase are the methanol/water mixed solution of 75-80vol%；Partly prepare silica gel chromatographic column, ViridisTM Silica 2-Ethylpyridine, 5 μm, 10 × 250 mm, mobile phase is 80-85vol% petroleum ethers/alcohol mixed solution.
10. a kind of application of marine aspergillus source oxa- anthraquinone analog compound in preparing antitumor agent, characterized in that described anti- Tumour agent using described in claim 2 compound or its pharmaceutically acceptable salt as active ingredient.
CN201810622689.XA 2018-06-15 2018-06-15 Marine aspergillus derived oxaanthraquinone compound, preparation method thereof and application thereof in preparation of antitumor agent Active CN108753627B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810622689.XA CN108753627B (en) 2018-06-15 2018-06-15 Marine aspergillus derived oxaanthraquinone compound, preparation method thereof and application thereof in preparation of antitumor agent

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810622689.XA CN108753627B (en) 2018-06-15 2018-06-15 Marine aspergillus derived oxaanthraquinone compound, preparation method thereof and application thereof in preparation of antitumor agent

Publications (2)

Publication Number Publication Date
CN108753627A true CN108753627A (en) 2018-11-06
CN108753627B CN108753627B (en) 2022-04-22

Family

ID=63978335

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810622689.XA Active CN108753627B (en) 2018-06-15 2018-06-15 Marine aspergillus derived oxaanthraquinone compound, preparation method thereof and application thereof in preparation of antitumor agent

Country Status (1)

Country Link
CN (1) CN108753627B (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109694827A (en) * 2019-01-18 2019-04-30 河北大学 Marine fungi source azaphilones class compound and preparation method thereof and preparing the application in anti-vibrios drug
CN109706086A (en) * 2019-01-18 2019-05-03 河北大学 A kind of marine fungi source azaphilones class compound and its preparation method and application
CN111321083A (en) * 2020-03-27 2020-06-23 河北大学 Marine fungus-derived azaphilones dimer compound and application thereof in antitumor agent
CN111548954A (en) * 2020-04-23 2020-08-18 安徽农业大学 Four anthraquinone compounds and preparation method and application thereof
CN114149445A (en) * 2021-11-03 2022-03-08 中南民族大学 Preparation method of xanthone compound and application of xanthone compound in resisting drug-resistant bacteria
CN114606134A (en) * 2021-03-10 2022-06-10 宁波大学 Sponge epiphyte and application thereof in preparation of oxaanthraquinone compounds

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105152901A (en) * 2015-09-28 2015-12-16 三峡大学 Preparation method for anthraquinone compound and application of anthraquinone compound as receptor tyrosine kinase inhibitor
CN107473952A (en) * 2017-08-07 2017-12-15 中国农业科学院烟草研究所 Anthraquinone analog compound, preparation method and application
CN107739362A (en) * 2017-11-06 2018-02-27 福建卫生职业技术学院 Come from aspergillus versicolor anthraquinone analog compound and prepare the application of anti-human oesophagus cancer drug
CN107739361A (en) * 2017-11-06 2018-02-27 福建卫生职业技术学院 Come from aspergillus versicolor anthraquinone analog compound and prepare the application of anti-human colon cancer drug

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105152901A (en) * 2015-09-28 2015-12-16 三峡大学 Preparation method for anthraquinone compound and application of anthraquinone compound as receptor tyrosine kinase inhibitor
CN107473952A (en) * 2017-08-07 2017-12-15 中国农业科学院烟草研究所 Anthraquinone analog compound, preparation method and application
CN107739362A (en) * 2017-11-06 2018-02-27 福建卫生职业技术学院 Come from aspergillus versicolor anthraquinone analog compound and prepare the application of anti-human oesophagus cancer drug
CN107739361A (en) * 2017-11-06 2018-02-27 福建卫生职业技术学院 Come from aspergillus versicolor anthraquinone analog compound and prepare the application of anti-human colon cancer drug

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
KULDIP K. CHEXAL: "《The Biosynthesis of Fungal Metabolites, Part III. Structure of Shamixanthone and Tajixanthone, Metabolites of Aspergillus variecolor》", 《JOURNAL OF THE CHEMICAL SOCIETY, PERKIN TRANSACTIONS 1》 *
MANGALADOSS FREDIMOSES: "《New Prenylxanthones from the Deep-Sea Derived Fungus Emericella sp. SCSIO 05240》", 《MARINE DRUGS》 *
PANAWAN MOOSOPHON: "《Prenylxanthones and a Bicyclo[3.3.1]nona-2,6-diene Derivative from the Fungus Emericella rugulosa》", 《J. NAT. PROD》 *
QI WU: "《Varioxiranols A-G and 19-O-Methyl-22-methoxypre-shamixanthone, PKS and Hybrid PKS-Derived Metabolites from a Sponge-Associated Emericella Variecolor Fungus》", 《JOURNAL OF NATURAL PRODUCTS》 *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109694827A (en) * 2019-01-18 2019-04-30 河北大学 Marine fungi source azaphilones class compound and preparation method thereof and preparing the application in anti-vibrios drug
CN109706086A (en) * 2019-01-18 2019-05-03 河北大学 A kind of marine fungi source azaphilones class compound and its preparation method and application
CN109694827B (en) * 2019-01-18 2022-08-12 河北大学 Marine fungus-derived azaphilones compound, preparation method thereof and application thereof in preparation of anti-vibrio drugs
CN109706086B (en) * 2019-01-18 2022-08-12 河北大学 Marine fungus-derived azaphilones compound as well as preparation method and application thereof
CN111321083A (en) * 2020-03-27 2020-06-23 河北大学 Marine fungus-derived azaphilones dimer compound and application thereof in antitumor agent
CN111321083B (en) * 2020-03-27 2023-05-16 河北大学 Ocean fungus source azaphilines dimer compound and application thereof in antitumor agent
CN111548954A (en) * 2020-04-23 2020-08-18 安徽农业大学 Four anthraquinone compounds and preparation method and application thereof
CN111548954B (en) * 2020-04-23 2022-08-19 安徽农业大学 Four anthraquinone compounds and preparation method and application thereof
CN114606134A (en) * 2021-03-10 2022-06-10 宁波大学 Sponge epiphyte and application thereof in preparation of oxaanthraquinone compounds
CN114606134B (en) * 2021-03-10 2023-11-14 宁波大学 Sponge coanda fungus and application thereof in preparation of oxaanthraquinone compounds
CN114149445A (en) * 2021-11-03 2022-03-08 中南民族大学 Preparation method of xanthone compound and application of xanthone compound in resisting drug-resistant bacteria
CN114149445B (en) * 2021-11-03 2023-02-14 中南民族大学 Preparation method of xanthone compound and application of xanthone compound in resisting drug-resistant bacteria

Also Published As

Publication number Publication date
CN108753627B (en) 2022-04-22

Similar Documents

Publication Publication Date Title
CN108753627A (en) A kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and the application in preparing antitumor agent
CN108660082A (en) A kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and the application in preparing antiseptic
CN101974464B (en) Streptomyces and process for preparing antimycin antibiotics by fermentation using same
CN102168044B (en) Streptomyces sp. and process for preparing various antibiotics by using same
CN109694827A (en) Marine fungi source azaphilones class compound and preparation method thereof and preparing the application in anti-vibrios drug
CN109706086A (en) A kind of marine fungi source azaphilones class compound and its preparation method and application
CN103642723B (en) Streptomyces and method for preparing two antibiotics by utilizing same
CN113481106A (en) Deep sea source penicillium mycoides and obtained compound
CN110863021B (en) Preparation method and application of cytochalasin compound
CN102030791A (en) Four tiacumicin compounds as well as preparation methods and applications thereof in preparing antimicrobial agents
CN111411045B (en) Marine fungus-derived azaphilones dimer compound and preparation method thereof
CN112608965B (en) Culture medium for producing bleomycin E by using deep sea streptomycete and preparation method thereof
CN104876945B (en) A kind of alkaloid dimer and preparation method thereof and the application as antivirotic
CN110357788B (en) Polyketone compound and preparation method and application thereof
CN109810919B (en) Ansha all-carbon cyclic polyketone antibiotics and application thereof in preparation of antibacterial drugs or antitumor drugs
CN105441504B (en) A kind of preparation method of CYCLIC DIPEPTIDES compounds
CN103724290A (en) Cyclopeptide compound clavatustide A as well as producing strain, preparation method and application thereof
CN115109023A (en) Macrolide compound FWYZ52-A, and fermentation strain, fermentation method and application thereof
CN109234175A (en) The Fusarium oxysporum DCLZJ-4 bacterial strain and application thereof of one plant of production chonglou saponin
CN109112171A (en) A kind of preparation method of the antibacterial substance based on marine microorganism
CN106047751B (en) Separation method and the application of one plant of quasi- promise Cattell actinomyces and its active metabolite
CN108727169A (en) A kind of preparation method of the biphenyl ether compound in marine fungi source and the application as antiseptic
CN102168020B (en) Marine-source fungus and application thereof
CN108085273A (en) One plant of streptomyces antifungus and its metabolin, metabolin preparation method and application
CN103145740A (en) Sulfoxide alkaloid compound as well as preparation method and application for same

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant