CN106047751B - Separation method and the application of one plant of quasi- promise Cattell actinomyces and its active metabolite - Google Patents
Separation method and the application of one plant of quasi- promise Cattell actinomyces and its active metabolite Download PDFInfo
- Publication number
- CN106047751B CN106047751B CN201610390105.1A CN201610390105A CN106047751B CN 106047751 B CN106047751 B CN 106047751B CN 201610390105 A CN201610390105 A CN 201610390105A CN 106047751 B CN106047751 B CN 106047751B
- Authority
- CN
- China
- Prior art keywords
- quasi
- actinomyces
- promise cattell
- active metabolite
- cattell actinomyces
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
- C07K1/14—Extraction; Separation; Purification
- C07K1/16—Extraction; Separation; Purification by chromatography
- C07K1/20—Partition-, reverse-phase or hydrophobic interaction chromatography
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
- C07K1/14—Extraction; Separation; Purification
- C07K1/34—Extraction; Separation; Purification by filtration, ultrafiltration or reverse osmosis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
- C07K1/14—Extraction; Separation; Purification
- C07K1/36—Extraction; Separation; Purification by a combination of two or more processes of different types
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Water Supply & Treatment (AREA)
- Mycology (AREA)
- General Chemical & Material Sciences (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Veterinary Medicine (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Separation method and the application of one plant of quasi- promise Cattell actinomyces and its active metabolite, the present invention relates to strain be quasi- promise Cattell actinomyces NX032, Nocardiopsissp.NX032, in China typical culture collection center, culture presevation number is CCTCC NO:M 2015361 for the culture presevation.The invention also includes the separation and application of the active metabolite of quasi- promise Cattell actinomyces.The present invention, which intends promise Cattell actinomyces active metabolite, has broad-spectrum anti-tumor activity.
Description
Technical field
The present invention relates to separation method and the applications of one plant of quasi- promise Cattell actinomyces and its active metabolite, especially relate to
And the separation method of one plant of high efficiency anti-tumor wild-type strain (Nocardiopsis sp.NX032) and its active metabolite with
Using.
Background technique
Nocardiopsis (Nocardiopsis) is Actinomycetes Actinomycetal pink mold cyst bacterium suborder nocardia section
Under one category, effectively described by Meyer within 1976, be a kind of G+C rich Gram positive aerobic bacterium.The master of the category bacterial strain
Want feature: Gram-positive, aerobic, medium temperature, chemoorganotrophy type；Substrate mycelium physically well develops, and long, multi-branched can be broken
At bar, sphere.Aerial hyphae develops well, long, medium branch, straight or Z-shaped, the complete rupture rod-shaped spore different at length
Son.Spore surface is smooth, and cell wall contains meso-DAP, and atypism sugar, no mycolic acids, the methylnaphthoquinone of advantage is MK-10
(H2, H4, H6) or MK-9 (H4, H6).Fatty acid 3a type, III type of phosphatide P, (G+C) mol% of DNA are 70%-76%.Pass through
We track discovery, in January, 2014 category effective publication kind oneself reached 53.Nocardia is equal in various environment
It is distributed, the feature of dominant microflora is shown in moderate and hypersaline environment.
At the beginning of penicillin birth to 21 century, the antibiotic that microorganism generates is about 22500 kinds shared, wherein from fungi
About 8600 kinds, account for 38%, from bacterium about 13900 kinds, account for 62%.Unwrapping wire is originated from the antibiotic of bacterial origin
Bacterium is more than 10000 kinds, accounts for 73%, and the reactive compound for originating from other bacteriums is about 3800 kinds, accounts for 27%.So actinomyces
It is all the main source that the mankind have found effective antibiotics all the time.But since recent decades find novel antibacterials from streptomycete
The probability of object is smaller and smaller, finds new antimicrobial agent as the research strategy of bacterium re-scheduling from rare actinomycete and is increasingly becoming research
Emphasis.Rare actinomycete refers to the actinomyces of non-streptomyces in the narrow sense, and when using conventional separation method, they are compared with streptomycete
Plating efficiency is much lower.Some antimicrobial compounds that rare actinomycete generates, oneself is become drug and is clinically widely used, such as
Gentamicin, erythromycin, vancomycin, rifampin etc..
The progress of Pseudomonas secondary metabolite discovery in recent years is rapid, it was found that many new antibiotic.Such as Xiamen University
Shen Yuemao seminar is separated to nocardia Nocardiopsis A00203 (likelihood with DSM44442 is 98%), and
The isolated 3 new disubstituted 2- pyranone of 3,6- (α-pyranone) derivatives, are respectively designated as from its fermentation liquid
Norcardiatones A-C.It is weaker that MTT cytotoxicity assay shows that Norcardiatones A has Hela cell
Cytotoxic activity, Norcardiatones B and C missing cytotoxic activity；Australian Robert J.Capon seminar is big from Australia
It is separated to nocardia Nocardiopsis sp. (CMB-M0232) in the ooze of Leah northeast Queensland state acquisition,
The isolated nocardiopsins A and nocardiopsinsB from the fermentation liquid of the bacterial strain in 2010, the project in 2013
Group is separated to nocardiopsins C and nocardiopsinsD from the metabolite of the bacterial strain.This 4 compounds are poly-
Ketone Macrocyclic lactone compounds.Nocardiopsins A and nocardiopsins B do not have antimycotic, antibacterium and cell toxicant
Activity.They are consistent with the structure-activity relationship of Immunosuppressive drug FK506 and rapamycin.It can be in low molar concentration and immune close
It is combined with plain FKBP12；William Fenical study group is separated to from the saline-alkaline pond on Bahamas island of Latin America the north
Bacterial strain Nocafdiopsis lucentensis (CNR-712), and 5 peptides are separated to from its fermentation liquid:
Lucentamycins A-E, compound L ucentamycins A and Lucentamycins B have Human colon cancer HTC-116
There are apparent cytotoxicity, IC50Value be respectively 0.20 μM and 11 μM, compound L ucentamycins C with
Lucentamycins D is when it is 150 μM that concentration, which reaches, to the colon cancer cell also without apparent cytotoxicity.But these substances
Anti-tumor activity spectrum it is relatively narrow, find that new anti-tumor activity object has great importance in the bacterial strain of screening.
Currently, Nocardiopsis secondary metabolite bioactivity research is concentrated mainly on three aspects: antitumor, anti-
Cancer reactive compound；Anti-inflammatory, anti-infective compounds；Non-cell toxicity, non-bacteriostatic activity compound.Although people are in quasi- promise card
The novel species discovery of Bordetella, secondary metabolite achieve progress in studying, but the compound amounts obtained are not still considerable, together
When the research of noval chemical compound mechanism of action, biosynthesis mechanism is still lacked.
Summary of the invention
The technical problem to be solved by the present invention is to overcoming the deficiencies of the prior art and provide one plant has broad-spectrum anti-tumor living
Property and the preferable quasi- promise Cattell actinomyces of activity and its active metabolite separation method and application.
The technical solution used to solve the technical problems of the present invention is that:
The quasi- promise Cattell actinomyces of the present invention, are quasi- promise Cattell actinomyces NX032 (Nocardiopsis sp.NX032),
The strain is preserved in China typical culture collection center (abbreviation CCTCC, address: Wuhan, China Wuhan on June 8th, 2015
University), culture presevation number is CCTCC NO:M 2015361.
The separation identification of quasi- promise Cattell actinomyces NX032 (the Nocardiopsis sp.NX032) of the present invention: Gao Shi is used
No.1 Screening of Media method is directly isolated to obtain one plant of actinomyces in the soil sample acquired from Hunan rice field, sees through colonial morphology
It examines, Gram's staining, physiological and biochemical property, 16S rRNA Genetic homology of carbapenem-resistant, identifies that the bacterial strain belongs to for Nocardiopsis,
It is named as quasi- promise Cattell actinomyces NX032 (Nocardiopsis sp.NX032).
Anti-tumor biological:
It by quasi- promise Cattell actinomyces NX032 in shaking flask (preferably 300ml shaking flask) after fermented and cultured 10-12 days, is centrifuged, receives
Collect supernatant, carries out cytotoxicity experiment.
Anti-tumor protein isolates and purifies: quasi- promise Cattell actinomyces NX032 is placed in fermentation medium, at 28-30 DEG C,
It is (best with 8000-12000rpm/min centrifugation 15-20min after shaken cultivation 10-12 days under the conditions of 160-170rpm/min
Repeated centrifugation 3 times or more), fermented supernatant fluid is collected, using the ammonium sulfate precipitated protein of various concentration gradient；Then in protein
It is further isolated and purified on purifying instrument, collects biologically active component, obtain active metabolite.
When separation, gel column used is preferably 75 sephadex column of Superdex on protein purification instrument.
Anti-tumor small molecular isolates and purifies: quasi- promise Cattell actinomyces NX032 being placed in fermentation medium, in 28-30
DEG C, under the conditions of 160-170rpm/min, after shaken cultivation 10-12 days, 15-20min is centrifuged with 8000-12000rpm/min,
Collect fermented supernatant fluid；Macroporous absorbent resin DM301 methanol is impregnated into 12h-18h, sterile water is eluted to tasteless, pH value into
Property after, macroporous absorbent resin is mixed with fermented supernatant fluid with 1:2.5-1:3 volume ratio, 4 DEG C of standings place -30h for 24 hours, collect
100% methanol parses solution, and freeze-drying obtains crude extract.
Condition when further being isolated and purified with high performance liquid chromatograph: column model: ZORBAX SB-C189.4 ×
150mm 5um, mobile phase: water, acetonitrile, flow velocity: 1mL/min, applied sample amount: 20 μ L, operation method: 0-10min water: acetonitrile
60%-40%, 10-13min water: acetonitrile 0-100%.
Currently, chromatographic technique has been widely used in the separation and analysis of opsonigenous substance, such as Robert J.Capon
Isolated 1 new 3,6- bis- of liquid chromatogram is utilized Deng from nocardia Nocardiopsis sp. (CMB-M0232) is middle
Substituted a- pyrone compound Nocardiopyrone A, Johannes F.Imhoff seminar is from nocardia
Nocardiopsis strain HB383, and isolated 4 new 2,5- bis- take from the fermentation liquid of bacterial strain using liquid chromatogram
The y- pyranone derivatives in generation: NocapyronesA-D.Although chromatographic technique utilization is very frequent, not due to the strain that is related to
Same different with obtained active material, separation condition is also just different.
It is anti-swollen through LC-MS/MS using the metabolite for intending promise Cattell actinomyces NX032 obtained by the above isolation and purification method
Tumor activity identification, it was demonstrated that: there is preferable anti-tumor activity.
The present invention obtains small molecule with anti-tumor activity and protein on the basis of improvement isolates and purifies, activity
Substance has the anti-tumor activity of wide spectrum, to kinds of tumor cells such as Hep-3B (human liver cancer cell), B16 (murine melanoma
Cell), Hela (human cervical carcinoma cell) have a cytotoxicity, and activity is preferably, while lower to the toxicity of normal cell.And it is right
Its antitumor mechanism has carried out Primary Study, and finds the ATP synthase isolated from quasi- promise Cattell actinomyces
Subunit a has anti-tumor activity.
Research object of the invention is Nocardiopsis actinomyces, it is widely distributed in various environment, especially in
The feature of dominant microflora is shown in degree and height salt environment.Although generating new active secondary metabolites in hypersaline environment
Actinomyces exploration it is less, but oneself is it is found that many new active secondary metabolites, show this in actinomyces with high salt
The actinomyces of ecological environment have very big potentiality in terms of generating new reactive compound.
Nocardia strain activated product because its unique structure and diversification, the preferable secondary metabolite of bioactivity,
The potential object of the following Natural products research can be become.Especially in the acquisition of saline and alkaline and marine environment, isolated quasi- promise card
Salmonella strain, can not only generate noval chemical compound, and quantity is more, be rare microbe-derived natural products exploitation bacterium
Strain.AKTA Purifier10 and high-efficient liquid phase color are passed through to one plant of quasi- promise Cattell actinomyces by soil screening in the present invention
The isolated protein and small molecule compound with broad-spectrum anti-tumor activity of spectral technology simultaneously carries out just its antitumor machanism
Step research.Facilitate the natural products of abundant Nocardiopsis anti-tumor activity, provides reason to explore Antitumor Mechanism
By basis, new material is provided for innovation drug research, provides strain resource to obtain the compound of structure novel.
Detailed description of the invention
Fig. 1 is the morphological feature figure after bacterial strain Nocardiopsis sp.NX032 is isolated and purified on TSB culture medium；
Fig. 2 is Gram's staining morphological feature figure of the bacterial strain Nocardiopsis sp.NX032 after isolating and purifying；
Fig. 3 is scanning electron microscope morphological feature figure of the bacterial strain Nocardiopsis sp.NX032 after isolating and purifying；
Fig. 4 is quasi- promise Cattell actinomyces NX032 strain growth curve graph；
Fig. 5 is influence diagram of the Nocardiopsis sp.NX032 fermented supernatant fluid to different activity of tumor cells；A in figure,
E is Hep-3B (human liver cancer cell), and b, f are B16 (mouse melanin tumor cell), and c, g are Hela (human cervical carcinoma cell), d, h
For HUVEC (Human umbilical vein endothelial cells: normal cell), wherein a, b, c, d are experimental group, and e, f, g, h are control group；
Fig. 6 is that (a-e is hair to influence diagram of the sterile fermented supernatant fluid after treatment of different temperature to B16 cytotoxicity in figure
Ferment supernatant acts on the influence diagram of B16 after 40 DEG C, 60 DEG C, 80 DEG C, 90 DEG C, 100 DEG C of processing respectively；F is not heated place
Reason fermented supernatant fluid acts on the influence diagram of B16)；
Fig. 7 is that (a-f is fermentation to toxic effect figure of different pH treated the sterile fermented supernatant fluid to B16 cell in figure
Supernatant acts on B16 after pH2,4,6,7,10,12 are handled respectively)；
Fig. 8 is toxicity shadow of the precipitating collected after various concentration ammonium sulfate precipitation of sterile fermented supernatant fluid to B16 cell
Ringing figure, (A is control group in figure, and B is 30% ammonium sulfate precipitated protein, and C is 50% ammonium sulfate precipitated protein, and D is 80% ammonium sulfate
Protein precipitation)；
Fig. 9 is that AKTA Purifier10 isolates and purifies figure to ammonium sulfate crude extract；
Figure 10 is antitumor protein components A to B16 cell anti-tumor determination of activity figure；
Figure 11 is purity detecting figure of the AKTA Purifier10 to the SDS-PAGE of ammonium sulfate crude extract A；
Figure 12 is the active component A that isolates and purifies of AKTA Purifier10 to Hep-3B, Hela, B16 and HUVEC cell
Active MTT detect figure；
Figure 13 be fermented supernatant fluid after macroporous absorbent resin DM301 preliminary purification in 1290 Infinity of Agilent
On separation figure；
Figure 14 is isolated each unimodal antitumor cytolytic activity figure；
Figure 15 is that Agilent 1290Infinity isolating active component Peak1 is thin to Hela, B16, Hep-3B and HUVEC
The MTT measurement chart of cytoactive；
Figure 16 is anti-tumor protein substance A Mass Spectrometric Identification result figure；
Figure 17 is anti-tumor small molecular Peak1 Mass Spectrometric Identification result figure；
Microbial preservation situation explanation
Quasi- promise Cattell actinomyces NX032 (Nocardiopsis sp.NX032), the strain were preserved on June 8th, 2015
China typical culture collection center (abbreviation CCTCC, address: Wuhan, China Wuhan University), culture presevation number are CCTCC NO:
M 2015361。
Specific embodiment
Below in conjunction with specific embodiment, invention is further described in detail.
Quasi- promise Cattell actinomyces NX032 (the Nocardiopsis sp.NX032) 1. of the present embodiment, the strain was in 2015
June 8 is in China typical culture collection center (abbreviation CCTCC, address: Wuhan, China Wuhan University) preservation, culture presevation
Number be CCTCC NO:M 2015361.
2. the quasi- promise Cattell actinomyces NX032 strain isolation process of the present embodiment: acquiring soil sample from Hunan rice field, take soil
Earth sample 1g is put into the conical flask equipped with glass marble, and the sterile water of 99ml is added, and vibrates 20min.By treated, soil hangs
Supernatant liquid is serially diluted at 10 times, dilutes 10 respectively3Again, 104Again, 105Times, finally it is made into 10-3、10-4、10-5Dilution suspension.
100 μ L are inhaled respectively on Gause I plate, and coating uniformly, is inverted in 28-30 DEG C of constant incubator and cultivates 6 days, repeatedly pure
Change, finally choose on each plate on the colony inoculation to Gause I inclined-plane of actinomyces, 28-30 DEG C is cultivated 6 days, conventional to apply
Piece, carbolfuchsin dyeing microscopic examination.Actinomyces single bacterium after purification is selected to fall within containing 30mL aseptic seed culture medium (TSB)
In triangular flask, it is placed in 28-30 DEG C of shaking table, 280r/min is cultivated 4 days.50% glycerol mixes, long-term preservation in -80 DEG C of refrigerators.
3. Optical microscope and SEM is observed:
Specific implementation process: the bacterium for taking quasi- promise Cattell actinomyces NX032 (Nocardiopsis sp.NX032) to cultivate 2 days
Supernatant is removed in liquid 1.5mL, 10000rpm/min, 3min, centrifugation, and distilled water cleans twice, and thallus is resuspended with 200 μ L distilled waters, inhales
It takes 10 μ L bacterium solutions drop in glass slide center, quasi- promise Cattell actinomyces NX032 is dyed using Gram's stain, and
The form of 100 times of oily microscopic observation thallus.It is diluted to 10 simultaneously-4Suspension is coated on TSB plate, is observed in TSB plate
Upper colonial morphology.Bacterium solution 1.5mL, 10000rpm/min, 3min are taken, is centrifuged, removes supernatant, PBS buffer solution washs 8-10 times, and penta 2
4 DEG C of aldehyde is fixed overnight, every with the ethyl alcohol of volumetric concentration 30%, 50%, 60%, 70%, 80%, 90%, 95%, 100% respectively
It was cleaned one time every 5 minutes, takes 50 μ L bacterium solutions to be coated on coverslip, observe thalli morphology under a scanning electron microscope.
Fig. 1, Fig. 2 and Fig. 3 are morphological feature figure of the bacterial strain Nocardiopsis sp.NX032 after isolating and purifying.Wherein
Fig. 1 is colonial morphology figure on TSB plate.Fig. 2 is optical microscope, and the bacterial strain is length, medium branch, straight or Z-shaped as the result is shown
Type.Fig. 3 is scanning electron microscope (SEM) photograph.
4. Nocardiopsis sp.NX032 bacterial strain 16S rRNA DNA homolog sequence is analyzed:
Specific implementation process: it from picking single colonie on TSB plate, is transferred to containing in 50mL TSB fluid nutrient medium, 28-
After 30 DEG C, 160rpm/min, shaken cultivation 2 days, using bacterial genomes DNA extraction kit, full base is carried out by operating procedure
Because of a group extraction.Universal primer (Bf-F, AGAGTTTGATCCTGGCTCAG are designed according to bacterial 16 S rRNA gene order；Bf-R,
ACGGCTACCTTGTTACGACTT it) and by raw work (Shanghai) Bioisystech Co., Ltd synthesizes.
16S rRNA gene magnification is carried out by following reaction system and reaction condition:
Reaction system (20 μ L): 12 μ L of aseptic double-distilled water；5XBuffer 4μL；dNTP 1.6μL；Bf-R(10μM)0.6μ
L；Bf-F(10μM)0.6μL；1 μ L of genomic templates；Primer star DNA Polymerase 0.2μL；
Response procedures: 94 DEG C of 4min of initial denaturation are denaturalized 94 DEG C of 30s, and anneal 52 DEG C of 30s, extend 72 DEG C of 90s, 30 circulations,
Extend 72 DEG C of 10min.
PCR product delivers Shanghai English fine horse biology skill through multifunctional dna purification and recovery kits together with appropriate primer
The sequencing of art Co., Ltd.Sequencing result shows that the 16S rRNA gene order of isolated strains Nocardiopsis sp.NX032 is long
Degree is 1524bp.By the 16S rRNA gene order of the Nocardiopsis sp.NX032 measured, and in American National biology skill
Blast is compared in art information centre (NCBI, http://www.ncbi.nlm.nih.gov).The 16S rRNA base of different strain
Because sequence carry out sequence analysis analysis, the bacterial strain belongs to quasi- promise Cattell actinomyces as the result is shown, respectively with
Nocardiopsis sp.AF-333(FJ481931.1)、Nocardiopsis sp.FXJ6.077(GU002080.1)、
Streptomyces sp.Ahbb4KM214828.1、Nocardiopsis dassonvillei subsp.dassonvillei
strain NRRL B-16366(AY999914.2)、Nocardiopsis sp.AM8(AM236241.1)、Nocardiopsis
The similitude highest of sp.An26AM039886.1, Nocardiopsis sp.87H32-3EU196476.1 etc., are 99%.Root
Speculate that the bacterial strain belongs to Nocardiopsis sp. subspecies according to BLAST acquired results, is named as Nocardiopsis.sp NX032
And phylogenetic tree construction (Replications=1000, Bootstrap value take percentage).
5. the growth curve of Nocardiopsis sp.NX032 measures:
TSB culture medium: 5.0g sodium chloride, 17g tryptone, 3g soy peptone, 2.5g dipotassium hydrogen phosphate, 2.5g grape
Sugar adds water to be settled to 1L, pH 7.3；
Specific implementation process: it from picking single colonie on TSB plate, is transferred in 30mL TSB fluid nutrient medium, 28-30
DEG C, 160rpm/min, after shaken cultivation 2 days, by 2% switching in 50mL TSB culture medium, 28-30 DEG C, 160rpm/min, vibration
Culture is swung, every 6h sampling measures OD600Value.
Nocardiopsis sp.NX032 strain growth curve as shown in figure 4, Nocardiopsis sp.NX032 life
About for 24 hours, 30-48h is Exponential growth stage to long lag phase, and it is decline phase after 60h that 48-60h, which is stationary phase,.Growth curve measurement
As a result illustrate the growth cycle and known quasi- promise Cattell actinomyces growth cycle basic one of Nocardiopsis sp.NX032 bacterial strain
It causes, referring concurrently to the bacterial strain known to its growth cycle, in exponential phase, its activity is best, therefore selects to train in this period inoculation fermentation
Support base.
6. the antitumor cytolytic activity of Nocardiopsis sp.NX032 bacterial strain:
Specific implementation process: take 10-12 days fermentation liquids of Nocardiopsis sp.NX032 bacterial strain (10-12 days fermentation liquids
Strain culturing method when acquisition methods are measured with growth curve is consistent) (10000rpm) centrifugation 15mim in refrigerated centrifuge,
0.22 μm of filter membrane is crossed, sterile fermented supernatant fluid is obtained.By B16 mouse melanoma cell line with 104Number (100 μ in a/every hole
L it) is laid in 96 orifice plates respectively, is placed in 37 DEG C, 5%CO2Stationary culture for 24 hours, makes cell adherent growth in cell constant temperature incubator.
It is separately added into the sterile fermented supernatant fluid of 2,5,10,15 μ L, and the nothing after 40 DEG C, 60 DEG C, 80 DEG C, 90 DEG C, 100 DEG C of processing 1h
10 μ L of bacterium fermented supernatant fluid；Sterile fermented supernatant fluid is taken to adjust pH extremely after pH gradient 2,4,6,7,10,12 handles 1h respectively simultaneously
Neutrality, each 10 μ L that are added are used for antitumor test.Separately setting control group, (the i.e. CK of control, adds and does not connect fermentation in Spawn incubation 10-12 days
Supernatant).It is independent and non-interfering two experiments that Temperature Treatment and pH, which handle 10-12 days fermented supernatant fluids, it is therefore an objective to point
Temperature and pH are not probed on the active influence of anti-tumor activity object in 10-12 days fermented supernatant fluids.On control group and sterile fermentation
Clear liquid respectively sets 3 repetitions, continues culture for 24 hours.With inverted microscope observation tumour cell variation.To Hep-3B, (human liver cancer is thin
Born of the same parents), Hela (human cervical carcinoma cell), HUVEC (Human umbilical vein endothelial cells: normal cell) make same experiment.
Fig. 5 be the 5 sterile fermented supernatant fluids of μ L respectively to Hep-3B (human liver cancer cell), B16 (mouse melanin tumor cell),
The toxic effect figure of Hela (human cervical carcinoma cell), HUVEC (Human umbilical vein endothelial cells: normal cell) cell, a, e are in figure
Hep-3B (human liver cancer cell), b, f are B16 (mouse melanin tumor cell), and c, g are Hela (human cervical carcinoma cell), and d, h are
HUVEC (Human umbilical vein endothelial cells: normal cell), wherein a, b, c, d are experimental group, and e, f, g, h are control group.
Fig. 6 is that (a-e is hair to influence diagram of the sterile fermented supernatant fluid after treatment of different temperature to B16 cytotoxicity in figure
Ferment supernatant acts on the influence diagram of B16 after 40 DEG C, 60 DEG C, 80 DEG C, 90 DEG C, 100 DEG C of processing respectively；F is not heated place
Reason fermented supernatant fluid acts on the influence diagram of B16).
Fig. 7 is that (a-f is fermentation to toxic effect figure of different pH treated the sterile fermented supernatant fluid to B16 cell in figure
Supernatant acts on the influence diagram of B16 after pH2,4,6,7,10,12 are handled respectively).
Result of study shows that Nocardiopsis sp.NX032 fermented supernatant fluid can make under the processing of 5 μ L fermented supernatant fluids
Hep-3B (human liver cancer cell), B16 (mouse melanin tumor cell), Hela (human cervical carcinoma cell), HUVEC are (in human umbilical vein
Chrotoplast: normal cell) cell shrinkage is rounded (referring to Fig. 5).Sterile fermented supernatant fluid under treatment of different temperature is thin to tumour
Cellular toxicity does not have notable difference, all has stronger cytotoxicity, B16 cell shrinkage can be made to be rounded so that cracking (referring to figure
6)。
Anti-tumor activity object is active compared with the activity of the anti-tumor activity object under neutrallty condition under strong acid treatment,
Activity is almost lost；Treated that anti-tumor activity object activity is identical as strong acid treatment for highly basic, and activity reduces (referring to Fig. 7)；
Thus it can speculate that anti-tumor activity object in fermented supernatant fluid is high temperature resistant but the not substance of acid and alkali-resistance.
7. the anti-tumor experiment and 3- (4,5- dimethyl -2- thiazole) -2 of AKTA Purifier10 isolating active component A,
5- diphenyl bromination tetrazole thiazolyl blue (MTT) measurement:
The preparation of active component A 1: 12,000rpm collects Nocardiopsis sp.NX032 10-12 days fermentation supernatant
Liquid is added solid ammonium sulfate (be slowly added to, while stirring be added) in 500ml supernatant, until in mixture ammonium sulfate matter
Measuring concentration is 30%, 4 DEG C of standing 4h, and centrifugation 9000-12000rpm collects precipitating.Solid ammonium sulfate is added to mixing in supernatant
The mass concentration of ammonium sulfate is 50% in object, and precipitating is collected by centrifugation.Solid ammonium sulfate is added in supernatant again, until in mixture
The mass concentration of ammonium sulfate is 80%, and precipitating is collected by centrifugation.Be collected into 30%, 50% and 80% ammonium sulfate precipitation is used respectively
Water redissolves, and obtains thick leach protein after removing salt ion with the bag filter that the molecular weight that shuts off is 3.5KD specification.Utilize Superdex
75 sephadex chromatography columns separate thick leach protein on protein purification instrument, (separation condition: mobile phase: water, stream
Speed: 1mL/min, applied sample amount: 1mL, operation method: 100% water, runing time: 30min), collect the active component A of acquisition；And
SDS-PAGE detection is carried out to its purity.
Specific implementation process: by Hep-3B (human liver cancer cell), Hela (human cervical carcinoma cell) and B16 (mouse melanin
Oncocyte) and HUVEC (Human umbilical vein endothelial cells: normal cell) cell respectively with 104The number in a/every hole is inoculated in 96 holes
Plate is placed in 37 DEG C, 5%CO2It is cultivated in cell constant temperature incubator, makes cell adherent growth, culture is for 24 hours；It is separately added into different dense
Room temperature activity component A is spent, continues culture for 24 hours (3 repetitions of every group of setting)；The active component A that control group is not added continues culture for 24 hours；
Supernatant is sucked, the fresh RPMI-1640 culture medium of 90 μ L is added, adds 10 μ L MTT reagents, continues to cultivate 4h；Supernatant is sucked,
110 μ L Formazan lysates are added in every hole, place 10min, interval concussion make crystal sufficiently dissolve (MTT reagent and
The light-exposed easy decomposition of Formazan lysate, above step are protected from light operation), it is placed on enzyme-linked immunosorbent assay instrument and measures at 490nm respectively
The light absorption value in hole, and calculate cell survival rate.
After the sample A freeze concentration being collected into, 12% gum concentration carries out SDS-PAGE detection.It is big to observe protein band
It is small.
Fig. 8 is toxicity shadow of the precipitating collected after various concentration ammonium sulfate precipitation of sterile fermented supernatant fluid to B16 cell
Ringing figure, (A is control group in figure, and the albumen for the ammonium sulfate precipitation that B is 30%, the albumen for the ammonium sulfate precipitation that C is 50%, D is
The albumen of 80% ammonium sulfate precipitation)；
Fig. 9 AKTA Purifier10 isolates and purifies ammonium sulfate crude extract；
Figure 10 is antitumor protein components A to B16 cell anti-tumor determination of activity figure；(A is control CK, that is, activity is not added
Component A processing, the aspect graph of B16 cell after culture for 24 hours；B is the aspect graph of B16 cell after active component A culture for 24 hours is added)
Purity detecting of Figure 11 AKTA Purifier10 to the SDS-PAGE of ammonium sulfate crude extract A.
The active component A that Figure 12 AKTA Purifier10 is isolated and purified is to Hep-3B, Hela, B16 and HUVEC cell
Active MTT detection.MTT is the results show that active component A is to Hela, and B16, Hep-3B and HUVEC cell is all active, and
When concentration reaches 105.584 μ g/mL, the inhibiting rate of three kinds of tumour cells all reaches or approaches 50%, and the suppression of normal cell
Rate processed is lower than 25%, and wherein the active matter is best (referring to Figure 12) to the toxicity of B16 cell.Cell inhibitory rate calculation formula is such as
Under:
Inhibiting rate=[(ODCK-OD zeroing)-(OD sample-OD zeroing)]/(ODCK-OD zeroing)
ODCK: the cell normally cultivated；
OD zeroing: only plus cell is not added in culture medium；
OD sample: the cell normally cultivated adds sample treatment.
8. the chromatographic isolation and active matter MTT of Nocardiopsis sp.NX032 anti-tumor small molecular active matter detect:
Specific implementation process: 12000rpm/min collects Nocardiopsis sp.NX032 10-12 days fermented supernatant fluid,
100% methanol is activated overnight DM301 macroporous absorbent resin, and activated resin is eluted to tasteless, general after pH value to neutrality through sterile water
Macroporous absorbent resin is mixed with fermented supernatant fluid with 1:3 volume ratio, and 4 DEG C stand for 24 hours, is collected 100% methanol and is parsed solution,
12000rpm/min centrifugation, crosses 0.22 μm of filter membrane, further using high performance liquid chromatograph (Agilent 1290Infinity)
Separate anti-tumor activity object (pillar: 5 μm of 9.4 × 150mm of ZORBAX SB-C18, mobile phase: water, acetonitrile, flow velocity: 1mL/
Min, applied sample amount: 20 μ L, operation method: 0-10min water: acetonitrile 60%-40%, 10-12min acetonitrile 100%.
Figure 13 is fermented supernatant fluid after DM301 macroporous absorbent resin, and water intaking is mutually on 1290 Infinity of Agilent
Separation；Figure 14 is the unimodal determination of activity being prepared, Peak1 and Peak2 component is in 1290 Infinity of Agilent
After upper isolated each unimodal freeze-dried concentrating instrument freeze-drying, 20 μ L ddH are taken2O redissolves, 13000rpm centrifugation
After 30min, crosses 0.22 μm of film and obtain sterile each unimodal collection liquid, respectively take 10 μ L to act on B16 cell for 24 hours, observe the shape of cell
State.
Figure 15 is that Agilent 1290Infinity isolating active component Peak1 is thin to Hela, B16, Hep-3B and HUVEC
The MTT of cytoactive is measured.For MTT the results show that active component Peak1 is to Hela, B16, Hep-3B and HUVEC cell has work
Property, and when 72.536 μ L Peak1 is added in 100 μ L cell culture fluids, the inhibiting rate of three kinds of tumour cells is above
50%, and the inhibiting rate of normal cell maintains 25% or so.
9. the LC-MS/MS of Nocardiopsis.sp NX032 anti-tumor activity object is identified:
Specific implementation process: anti-tumor protein film dosim Mass Spectrometric Identification: prepare sterile 1.5mEP pipe, with sharp nothing
Acicula head cuts lower purpose band.280 μ L100mM NH are added4HCO3It decolourizes, is placed at room temperature for glue with 30% acetonitrile of 120 μ L
Block is colorless and transparent, outwells supernatant, freeze-drying；90 μ L100mM NH are added4HCO3, 10 μ L 100mM DTT, 56 DEG C of hatching 30min, also
Crude protein；Supernatant is removed, is sucked after 100 μ L100%ACN, 5min are added；70 μ L100mM NH are added4HCO3,30μL 200mM
IAA, dark place 20min；Supernatant is removed, 100 μ L 100mM NH are added4HCO3, room temperature 15min；Supernatant is removed, 100% acetonitrile 100 is added
It sucks, is lyophilized after μ L, 5min；Add 5 μ L 10ng Trypsin solution after freeze-drying, is placed in 4 DEG C of refrigerator 30-60min, fills blob of viscose
Divide expansion；Add suitable 50mM ammonium bicarbonate buffers (no Trypsin), pH 7.8-8.0.37 DEG C of reactions, 20 hours left sides
It is right；Protein enzymatic hydrolyzate is collected into new centrifuge tube, 100 μ L, 60% acetonitrile/0.1% trifluoroacetic acid is added in former pipe, and it is 3 times ultrasonic,
Each 15min is sucked out solution and is incorporated to previous solution.It is spare that merging freeze-drying is placed on -80 DEG C of refrigerators.The result is shown in Figure 16, through mass spectrum
Identify that the albumen is ATP synthase subunit a.
Anti-tumor small molecular Mass Spectrometric Identification: the anti-tumor small molecular that will be collected from Aglient 1290 carries out cold
Dry concentration is lyophilized, 100 μ L is taken to carry out LC-MS/MS identification.Detection ion source is cation, and mass spectral results show 1 molecule of Peak
Amount is 158.03KDa (see Figure 17).
Claims (6)
1. a kind of quasi- promise Cattell actinomyces, which is characterized in that it is quasi- promise Cattell actinomyces NX032,Nocardiopsis
sp.NX032, in China typical culture collection center, deposit number is CCTCC NO:M 2015361 for the culture presevation.
2. the separation method of the active metabolite of quasi- promise Cattell actinomyces as described in claim 1, which is characterized in that including with
Lower step:
Quasi- promise Cattell actinomyces NX032 is placed in fermentation medium, under the conditions of 28-30 DEG C, 160-170rpm, oscillation training
After supporting 10-12 days, 15-20min is centrifuged with 8000-12000rpm, collects fermented supernatant fluid, 0.22 μm of filter membrane is crossed, obtains sterile
Fermented supernatant fluid；Initial gross separation is carried out on protein purification instrument, collects biologically active component；Utilize high-efficient liquid phase color
Spectrometer further isolates and purifies, and obtains active metabolite.
3. the separation method of quasi- promise Cattell actinomyces active metabolite according to claim 2, which is characterized in that preliminary
When separation, gel column used is 75 sephadex column of Superdex on protein purification instrument.
4. the separation method of quasi- promise Cattell actinomyces active metabolite according to claim 2 or 3, which is characterized in that
When further isolating and purifying, chromatographic column used is C18 reverse-phase chromatographic column in the high performance liquid chromatograph.
5. quasi- application of the promise Cattell actinomyces in terms of preparing anti-tumor drug as described in claim 1.
6. prepared by the quasi- promise Cattell actinomyces active metabolite as separated in any claim in claim 2-4
Application in terms of anti-tumor drug.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610390105.1A CN106047751B (en) | 2016-06-03 | 2016-06-03 | Separation method and the application of one plant of quasi- promise Cattell actinomyces and its active metabolite |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610390105.1A CN106047751B (en) | 2016-06-03 | 2016-06-03 | Separation method and the application of one plant of quasi- promise Cattell actinomyces and its active metabolite |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106047751A CN106047751A (en) | 2016-10-26 |
| CN106047751B true CN106047751B (en) | 2019-11-05 |
Family
ID=57170096
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610390105.1A Active CN106047751B (en) | 2016-06-03 | 2016-06-03 | Separation method and the application of one plant of quasi- promise Cattell actinomyces and its active metabolite |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106047751B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109706083B (en) * | 2018-12-10 | 2023-05-30 | 贵州省中国科学院天然产物化学重点实验室(贵州医科大学天然产物化学重点实验室) | Eucommia ulmoides endophytic fungus with remarkably increased antibacterial activity after metabolic regulation |
| CN114292769B (en) * | 2021-12-01 | 2023-06-16 | 陕西省生物农业研究所 | Saline-alkali tolerant tomato leaf endophyte, fermentation liquor, preparation method and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101074234A (en) * | 2007-03-30 | 2007-11-21 | 云南大学 | Antitumor antibiotics and its production |
| CN101942406A (en) * | 2010-08-12 | 2011-01-12 | 淮海工学院 | Marine nocardiopsissp.HY-G and beta-glucosidase produced by same |
-
2016
- 2016-06-03 CN CN201610390105.1A patent/CN106047751B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101074234A (en) * | 2007-03-30 | 2007-11-21 | 云南大学 | Antitumor antibiotics and its production |
| CN101942406A (en) * | 2010-08-12 | 2011-01-12 | 淮海工学院 | Marine nocardiopsissp.HY-G and beta-glucosidase produced by same |
Non-Patent Citations (4)
| Title |
|---|
| Kroutil W et al..Purification and characterization of a highly selective epoxide hydrolase from Nocardia sp.EH1.《J Biotechnol》.1998,第61卷(第2期),第143-150页. * |
| Purification and characterization of a highly selective epoxide hydrolase from Nocardia sp.EH1;Kroutil W et al.;《J Biotechnol》;19980415;第61卷(第2期);第143-150页 * |
| 拟诺卡菌及其次级代谢产物;高春燕等;《中国抗生素杂志》;20160229;第41卷(第2期);第81-97页 * |
| 高春燕等.拟诺卡菌及其次级代谢产物.《中国抗生素杂志》.2016,第41卷(第2期),第81-97页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106047751A (en) | 2016-10-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Braña et al. | Branimycins B and C, antibiotics produced by the abyssal actinobacterium Pseudonocardia carboxydivorans M-227 | |
| CN108660082A (en) | A kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and the application in preparing antiseptic | |
| CN108753627A (en) | A kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and the application in preparing antitumor agent | |
| CN106434372B (en) | Application of coral-derived fungus aspergillus terreus strain C21-10 | |
| CN109694827A (en) | Marine fungi source azaphilones class compound and preparation method thereof and preparing the application in anti-vibrios drug | |
| CN106367358A (en) | Fungal aspergillus terreus strain C21-10 derived from coral | |
| CN106047751B (en) | Separation method and the application of one plant of quasi- promise Cattell actinomyces and its active metabolite | |
| CN105670968B (en) | A kind of marine natural anticol matter tumor activity substance and preparation and use | |
| CN107868757A (en) | A kind of plant endogenesis epiphyte and its application | |
| CN108794368A (en) | A kind of alkaloid compound and preparation method and application with various bacteriostatic activity | |
| CN111646993B (en) | Marine anti-glioma active substance iso-wall carboline base C, preparation and application thereof | |
| CN104109642B (en) | Serratia marcescens, and screening method and application thereof | |
| JP2005503171A (en) | Cultivation and isolation of microorganisms from the natural environment and drug discovery from them | |
| CN108913606A (en) | A kind of ocean antimicrobial agent active material and preparation and use | |
| CN109234175A (en) | The Fusarium oxysporum DCLZJ-4 bacterial strain and application thereof of one plant of production chonglou saponin | |
| CN109280034A (en) | A kind of Benzoxazepin class compound and the preparation method and application thereof with bacteriostatic activity | |
| CN105112322B (en) | Grey mold quinone A and B and preparation method thereof and medical usage | |
| CN102351859B (en) | Antibiotic Pseudonocardian A and Pseudonocardian B, its preparation method thereof and its application in preparation of antibiotics and antitumor drug | |
| CN109678917A (en) | Amy gram strangles mycin and its preparation method and application | |
| CN107686817A (en) | One plant of fetid marsh fleabane endogenetic fungus CYSK 4 and its Ascomylactam class compounds of production application | |
| CN103820331A (en) | Fujian and Zhejiang phlegmariurus endophytic fungi as well as method and application of Fujian and Zhejiang phlegmariurus endophytic fungi for producing huperzine-A | |
| CN109762046B (en) | Cyclic peptide antibiotics, preparation method thereof and application thereof in preparation of anti-mycobacterium tuberculosis drugs | |
| CN106119157B (en) | A kind of marine streptomyces and its preparing the application in Nosiheptide | |
| CN105886421B (en) | One plant is intended without mycolic acids bacterium and the method for preparing special penta Efrotomycin using the bacterium | |
| CN103820332A (en) | Huperzia serrata endophytic fungi as well as method and application of huperzia serrata endophytic fungi for producing huperzine A |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |