CN106047751A - Nocardiopsis, separation method of active metabolites of Nocardiopsis and application of Nocardiopsis - Google Patents
Nocardiopsis, separation method of active metabolites of Nocardiopsis and application of Nocardiopsis Download PDFInfo
- Publication number
- CN106047751A CN106047751A CN201610390105.1A CN201610390105A CN106047751A CN 106047751 A CN106047751 A CN 106047751A CN 201610390105 A CN201610390105 A CN 201610390105A CN 106047751 A CN106047751 A CN 106047751A
- Authority
- CN
- China
- Prior art keywords
- nocardiopsis
- promise
- actinomycetes
- cell
- shi
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
- C07K1/14—Extraction; Separation; Purification
- C07K1/16—Extraction; Separation; Purification by chromatography
- C07K1/20—Partition-, reverse-phase or hydrophobic interaction chromatography
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
- C07K1/14—Extraction; Separation; Purification
- C07K1/34—Extraction; Separation; Purification by filtration, ultrafiltration or reverse osmosis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
- C07K1/14—Extraction; Separation; Purification
- C07K1/36—Extraction; Separation; Purification by a combination of two or more processes of different types
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Water Supply & Treatment (AREA)
- Mycology (AREA)
- General Chemical & Material Sciences (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Veterinary Medicine (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses Nocardiopsis, a separation method of active metabolites of the Nocardiopsis and an application of the Nocardiopsis. The strain involved in the invention is Nocardiopsis sp. NX 032 and is preserved in the CCTCC (China Center for Type Culture Collection) with the preservation number of CCTCC NO:M2015361. The invention also comprises separation of the active metabolites of the Nocardiopsis and the application of the Nocardiopsis. The active metabolites of the Nocardiopsis have broad-spectrum antitumor activity.
Description
Technical field
The present invention relates to a strain and intend promise Ka Shi actinomycetes and the separation method of active metabolite thereof and application, especially relate to
And one strain high efficiency anti-tumor wild-type strain (Nocardiopsis sp.NX032) and active metabolite thereof separation method with
Application.
Background technology
Nocardiopsis (Nocardiopsis) is Actinomycetes Actinomycetal pink mold cyst bacterium suborder nocardia section
Under a genus, within 1976, effectively described by Meyer, be a class G+C rich Gram positive aerobic bacterium.The master of this genus bacterial strain
Want feature: Gram-positive, aerobic, middle temperature, chemoorganotrophy type；Substrate mycelium physically well develops, long, multi-branched, can rupture
Become bar, spheroid.Aerial hyphae physically well develops, branch long, medium, and straight or Z-shaped, complete rupture becomes the shaft-like spore that length is different
Son.Spore surface is smooth, and cell wall contains meso-DAP, and atypism sugar, without mycolic acids, the methylnaphthoquinone of advantage is MK-10
(H2, H4, H6) or MK-9 (H4, H6).Fatty acid 3a type, phospholipid P III type, (G+C) mol% of DNA is 70%-76%.Pass through
We follow the trail of discovery, and the effective publication kind to this genus of in January, 2014 is own through reaching 53.Nocardia is equal in various environment
There is distribution, moderate and hypersaline environment show the feature of dominant microflora.
Being born at the beginning of 21 century from penicillin, the antibiotic that microorganism produces has about 22500 kinds, wherein comes from fungus
Be about 8600 kinds, account for 38%, come from antibacterial be about 13900 kinds, account for 62%.The antibiotic of bacterial origin originates from unwrapping wire
Bacterium more than 10000 kinds, account for 73%, the reactive compound originating from other antibacterials is about 3800 kinds, accounts for 27%.So, actinomycetes
It is the most all mankind's main sources of finding effective antibiotics.But owing to recent decades finds novel antibacterials from streptomycete
The probability of thing is more and more less, and from rare actinomycete, searching new antimicrobial agent is increasingly becoming research as the research strategy of bacterium re-scheduling
Emphasis.Rare actinomycete refers to the actinomycetes of non-streptomyces in the narrow sense, when using the separation method of routine, they relatively streptomycetes
Plating efficiency is much lower.Some antimicrobial compounds that rare actinomycete produces, oneself is through becoming medicine and being widely used clinically, as
Gentamycin, erythromycin, vancomycin, rifampicin etc..
This Pseudomonas secondary metabolite finds that progress is rapidly in recent years, it was found that many new antibiotic.Such as Xiamen University
Shen Yue hair seminar is separated to nocardia Nocardiopsis A00203 (being 98% with the likelihood of DSM44442), and
Isolated 3 new 3 from its fermentation liquid, 6-dibasic 2-pyranone (α-pyranone) derivant, it is respectively designated as
Norcardiatones A-C.MTT cytotoxicity assay shows, Hela cell is had more weak by Norcardiatones A
Cytotoxic activity, Norcardiatones B and C missing cytotoxic activity；Robert J.Capon seminar of Australia is big from Australia
The sea mud that Queensland state, Leah northeast gathers is separated to nocardia Nocardiopsis sp. (CMB-M0232),
Isolated nocardiopsins A and nocardiopsinsB from the fermentation liquid of this bacterial strain in 2010,2013 years these problems
Group is separated to nocardiopsins C and nocardiopsinsD from the metabolite of this bacterial strain.These 4 compounds are all poly-
Ketone Macrocyclic lactone compounds.Nocardiopsins A and nocardiopsins B does not has antifungal, antibacterium and cell toxicant
Activity.They are consistent with the structure activity relationship of Immunosuppressive drug FK506 and rapamycin.Can be close with immunity when low molar concentration
Combine with element FKBP12；William Fenical seminar saline-alkaline pond from island, Bahamas, the north, Latin America is separated to
Bacterial strain Nocafdiopsis lucentensis (CNR-712), and from its fermentation liquid, it is separated to 5 peptides:
Human colon cancer HTC-116 is had by Lucentamycins A-E, compound L ucentamycins A and Lucentamycins B
There is obvious cytotoxicity, its IC50Value be respectively 0.20 μM and 11 μMs, compound L ucentamycins C with
Lucentamycins D concentration reach be 150 μMs time, to this colon cancer cell also without obvious cytotoxicity.But these materials
Anti-tumor activity spectrum narrower, screening bacterial strain in find that new anti-tumor activity thing has great importance.
At present, Nocardiopsis secondary metabolite bioactivity research is concentrated mainly on three aspects: antitumor, anti-
Cancer reactive compound；Anti-inflammatory, anti-infective compounds；Non-cell toxicity, non-bacteriostatic activity compound.Although people are intending promise card
The novel species of Bordetella finds, secondary metabolite achieves progress in studying, but the compound amounts obtained is the most considerable, with
Time to noval chemical compound mechanism of action, biosynthesis mechanism research still lack.
Summary of the invention
The technical problem to be solved in the present invention is, overcomes the deficiencies in the prior art, it is provided that a strain has broad-spectrum anti-tumor and lives
Property and activity preferably intend promise Ka Shi actinomycetes and the separation method of active metabolite thereof and application.
The present invention solves its technical problem and the technical scheme is that
The plan promise Ka Shi actinomycetes of the present invention, are to intend promise Ka Shi actinomycetes NX032 (Nocardiopsis sp.NX032),
This strain is preserved in China typical culture collection center on June 8th, 2015 and (is called for short CCTCC, address: Wuhan, China Wuhan
University), culture presevation number is CCTCC NO:M 2015361.
The isolation identification of plan promise Ka Shi actinomycetes NX032 (Nocardiopsis sp.NX032) of the present invention: use Gao Shi
A number Screening of Media method, is directly isolated to obtain strain actinomycetes from rice field, Hunan the soil sample that gathers, sees through colonial morphology
Examine, Gram’s staining, physiological and biochemical property, 16S rRNA Genetic homology of carbapenem-resistant, identify this bacterial strain be Nocardiopsis belong to,
Named plan promise Ka Shi actinomycetes NX032 (Nocardiopsis sp.NX032).
Anti-tumor biological:
Promise Ka Shi actinomycetes NX032 will be intended in shaking flask (preferably 300ml shaking flask) after fermentation culture 10-12 days, centrifugal, receive
Collection supernatant, carries out cytotoxicity experiment.
Anti-tumor protein isolated and purified: plan promise Ka Shi actinomycetes NX032 is placed in fermentation medium, at 28-30 DEG C,
Under the conditions of 160-170rpm/min, after shaken cultivation 10-12 days, it is centrifuged 15-20min with 8000-12000rpm/min (best
Repeated centrifugation more than 3 times), collect fermented supernatant fluid, use the ammonium sulfate precipitated protein of variable concentrations gradient；Then at protein
On purification instrument the most isolated and purified, collect there is bioactive component, obtain active metabolite.
During separation, on protein purification instrument, gel column used is preferably Superdex 75 sephadex column.
Anti-tumor small molecular isolated and purified: plan promise Ka Shi actinomycetes NX032 is placed in fermentation medium, at 28-30
DEG C, under the conditions of 160-170rpm/min, after shaken cultivation 10-12 days, it is centrifuged 15-20min with 8000-12000rpm/min,
Collect fermented supernatant fluid；Macroporous adsorbent resin DM301 methanol is soaked 12h-18h, sterilized water be eluted to tasteless, pH value in
After property, being mixed with 1:2.5-1:3 volume ratio with fermented supernatant fluid by macroporous adsorbent resin, 4 DEG C stand placement 24h-30h, collect
100% methanol resolves solution, lyophilization, obtains crude extract.
Condition when using high performance liquid chromatograph isolated and purified further: pillar model: ZORBAX SB-C189.4 ×
150mm 5um, flow phase: water, acetonitrile, flow velocity: 1mL/min, applied sample amount: 20 μ L, operation method: 0-10min water: acetonitrile
60%-40%, 10-13min water: acetonitrile 0-100%.
At present, chromatographic technique has been widely used in separation and the analysis of opsonigenous substance, such as Robert J.Capon
Deng utilizing the 3,6-bis-that liquid chromatograph isolated 1 is new from nocardia Nocardiopsis sp. (CMB-M0232)
Substituted a-pyrone compound Nocardiopyrone A, Johannes F.Imhoff seminar is from nocardia
Nocardiopsis strain HB383, and utilize liquid chromatograph new 2,5-bis-of isolated 4 from the fermentation liquid of bacterial strain to take
The y-pyranone derivatives in generation: NocapyronesA-D.Although chromatographic technique uses very frequent, but due to the strain that relates to not
With different with the active substance obtained, separation condition is also the most different.
Above isolation and purification method gained is utilized to intend the metabolite of promise Ka Shi actinomycetes NX032, anti-swollen through LC-MS/MS
Tumor activity is identified, it was demonstrated that: there is preferable anti-tumor activity.
The present invention obtains little molecule and the protein with anti-tumor activity on the basis of improvement is isolated and purified, its activity
Material has the anti-tumor activity of wide spectrum, to kinds of tumor cells such as Hep-3B (human liver cancer cell), B16 (murine melanoma
Cell), Hela (human cervical carcinoma cell) all have a cytotoxicity, and activity is preferably, simultaneously relatively low to Normocellular toxicity.And it is right
Its antitumor mechanism has carried out preliminary study, and finds from the ATP synthase intending promise Ka Shi actinomycetes isolated
Subunit a has anti-tumor activity.
The object of study of the present invention is Nocardiopsis actinomycetes, and it is widely distributed in various environment, especially in
Degree and height salt environment show the feature of dominant microflora.Although hypersaline environment produces new active secondary metabolites
Actinomycetic exploration less, but in high salt actinomycetes, oneself is it is found that the newest active secondary metabolites, shows this
The actinomycetes of ecological environment have the biggest potentiality in terms of producing new reactive compound.
Nocardia strain activated product is unique with variation, the preferable secondary metabolite of biological activity because of its structure,
The potential object of following Natural products research can be become.Especially at saline and alkaline and marine environment collection, the plan promise card of isolated
Salmonella strain, can not only produce noval chemical compound, and quantity is more, is rare microbe-derived natural product exploitation bacterium
Strain.The present invention intends promise Ka Shi actinomycetes by soil screening to a strain, by AKTA Purifier10 and high-efficient liquid phase color
At the beginning of spectral technology isolated has the protein of broad-spectrum anti-tumor activity and micromolecular compound and carries out its antitumor machanism
Step research.Contribute to the natural product of abundant Nocardiopsis anti-tumor activity, provide reason for exploring Antitumor Mechanism
Opinion basis, provides new material for innovation drug research, provides strain resource for obtaining the compound of novel structure.
Accompanying drawing explanation
Fig. 1 be bacterial strain Nocardiopsis sp.NX032 isolated and purified after morphological characteristic figure in TSB culture medium；
Fig. 2 is the separated Gram’s staining morphological characteristic figure after purification of bacterial strain Nocardiopsis sp.NX032；
Fig. 3 is the separated scanning electron microscope morphological characteristic figure after purification of bacterial strain Nocardiopsis sp.NX032；
Fig. 4 is to intend promise Ka Shi actinomycetes NX032 strain growth curve chart；
What Fig. 5 was Nocardiopsis sp.NX032 fermented supernatant fluid on different activity of tumor cells affects figure；A in figure,
E is Hep-3B (human liver cancer cell), and b, f are B16 (mouse melanin tumor cell), and c, g are Hela (human cervical carcinoma cell), d, h
For HUVEC (Human umbilical vein endothelial cells: normal cell), wherein a, b, c, d are experimental group, and e, f, g, h are matched group；
Fig. 6 is aseptic fermented supernatant fluid after treatment of different temperature to be affected figure to B16 is Cytotoxic (in figure, a-e is for sending out
What ferment supernatant acted on B16 respectively after 40 DEG C, 60 DEG C, 80 DEG C, 90 DEG C, 100 DEG C process affects figure；F is the most heated place
What reason fermented supernatant fluid acted on B16 affects figure)；
Fig. 7 is that to the toxic effect figure of B16 cell, (in figure, a-f is fermentation to the aseptic fermented supernatant fluid after different pH processes
Supernatant acts on B16 respectively after pH2,4,6,7,10,12 process)；
Fig. 8 is the precipitation toxicity shadow to B16 cell that aseptic fermented supernatant fluid is collected after variable concentrations ammonium sulfate precipitation
(in figure, A is matched group, and B is 30% ammonium sulfate precipitated protein, and C is 50% ammonium sulfate precipitated protein, and D is 80% ammonium sulfate to ring figure
Protein precipitation)；
Fig. 9 is the AKTA Purifier10 isolated and purified figure to ammonium sulfate crude extract；
Figure 10 is that antitumor protein components A is to B16 cell anti-tumor determination of activity figure；
Figure 11 is the AKTA Purifier10 purity detecting figure to the SDS-PAGE of ammonium sulfate crude extract A；
Figure 12 is that active component A isolated and purified for AKTA Purifier10 is to Hep-3B, Hela, B16 and HUVEC cell
Activity MTT detection figure；
Figure 13 be fermented supernatant fluid after macroporous adsorbent resin DM301 preliminary purification at Agilent 1290 Infinity
On separation graph；
Figure 14 is each unimodal antitumor cytolytic activity figure of isolated；
Figure 15 is that Agilent 1290Infinity isolating active component Peak1 is thin to Hela, B16, Hep-3B and HUVEC
The MTT of cytoactive measures figure；
Figure 16 is anti-tumor protein substance A Mass Spectrometric Identification result figure；
Figure 17 is anti-tumor small molecular Peak1 Mass Spectrometric Identification result figure；
Microbial preservation situation explanation
Intending promise Ka Shi actinomycetes NX032 (Nocardiopsis sp.NX032), this strain was preserved on June 8th, 2015
China typical culture collection center (is called for short CCTCC, address: Wuhan, China Wuhan University), and culture presevation number is CCTCC NO:
M 2015361。
Detailed description of the invention
Below in conjunction with specific embodiment, the present invention is described in further detail.
1. plan promise Ka Shi actinomycetes NX032 (Nocardiopsis sp.NX032) of the present embodiment, this strain was in 2015
June 8 is in China typical culture collection center (being called for short CCTCC, address: Wuhan, China Wuhan University) preservation, culture presevation
Number it is CCTCC NO:M 2015361.
2. the plan promise Ka Shi actinomycetes NX032 strains separation process of the present embodiment: gather soil sample from rice field, Hunan, fetch earth
Earth sample 1g, puts into equipped with in the conical flask of glass bead, adds the sterilized water of 99ml, and vibrate 20min.Soil after processing hangs
Supernatant liquid becomes 10 times of serial dilutions, dilutes 10 respectively3Again, 104Again, 105Times, finally it is made into 10-3、10-4、10-5Dilution factor suspension.
Inhaling 100 μ L respectively on Gause I flat board, coating uniformly, is inverted in 28-30 DEG C of constant incubator cultivation 6 days, the purest
Change, on each flat board, finally choose actinomycetic colony inoculation to Gause I inclined-plane, cultivate 6 days for 28-30 DEG C, conventional be coated with
Sheet, carbolfuchsin dyeing microscopic examination.Select actinomycetes list bacterium colony after purification in containing 30mL's aseptic seed culture medium (TSB)
In triangular flask, being placed in shaking table 28-30 DEG C, 280r/min cultivates 4 days.50% glycerol mixing ,-80 DEG C of medium-term and long-term preservations of refrigerator.
3. Optical microscope and SEM is observed:
Specific implementation process: take and intend the bacterium that promise Ka Shi actinomycetes NX032 (Nocardiopsis sp.NX032) is cultivated 2 days
Liquid 1.5mL, 10000rpm/min, 3min, centrifugal, remove supernatant, distilled water cleans twice, with the 200 μ resuspended thalline of L distilled water, inhales
Take 10 μ L bacterium solution to drip in microscope slide central authorities, use Gram staining method to dye to intending promise Ka Shi actinomycetes NX032, and
The form of 100 times of oily Microscopic observation thalline.It is diluted to 10 simultaneously-4Suspension, coats on TSB flat board, observes at TSB plate
Upper colonial morphology.Take bacterium solution 1.5mL, 10000rpm/min, 3min, centrifugal, remove supernatant, PBS washs 8-10 time, and penta 2
4 DEG C of aldehyde is overnight fixed, every with the ethanol of volumetric concentration 30%, 50%, 60%, 70%, 80%, 90%, 95%, 100% respectively
Cleaned one time every 5 minutes, take 50 μ L bacterium solution and coat on coverslip, observe thalli morphology under a scanning electron microscope.
Fig. 1, Fig. 2 and Fig. 3 are the separated morphological characteristic figures after purification of bacterial strain Nocardiopsis sp.NX032.Wherein
Fig. 1 is colonial morphology figure on TSB plate.Fig. 2 is optical microscope, and result shows that this bacterial strain is long, medium branch, straight or Z-shaped
Type.Fig. 3 is scanning electron microscope (SEM) photograph.
4. Nocardiopsis sp.NX032 bacterial strain 16S rRNA DNA homolog sequence analysis:
Specific implementation process: picking list bacterium colony from TSB flat board, is transferred to containing in 50mL TSB fluid medium, 28-
30 DEG C, 160rpm/min, shaken cultivation, after 2 days, uses bacterial genomes DNA extraction kit, carries out full base by operating procedure
Because group is extracted.Universal primer (Bf-F, AGAGTTTGATCCTGGCTCAG is designed according to bacterial 16 S rRNA gene order；Bf-R,
ACGGCTACCTTGTTACGACTT) and by raw work (Shanghai) Bioisystech Co., Ltd synthesize.
16S rRNA gene amplification is carried out by following reaction system and reaction condition:
Reaction system (20 μ L): aseptic double-distilled water 12 μ L；5XBuffer 4μL；dNTP 1.6μL；Bf-R(10μM)0.6μ
L；Bf-F(10μM)0.6μL；Genomic templates 1 μ L；Primer star DNA Polymerase 0.2μL；
Response procedures: 94 DEG C of 4min of denaturation, 94 DEG C of 30s of degeneration, anneal 52 DEG C of 30s, extends 72 DEG C of 90s, circulates for 30 times,
Extend 72 DEG C of 10min.
PCR primer reclaims kits through multifunctional dna purification, delivers Shanghai English fine horse biology skill together with appropriate primer
Art company limited checks order.The 16S rRNA gene order of sequencing result display separation bacterial strain Nocardiopsis sp.NX032 is long
Degree is 1524bp.The 16S rRNA gene order of Nocardiopsis sp.NX032 that will record, and in American National biology skill
Blast comparison in art information centre (NCBI, http://www.ncbi.nlm.nih.gov).The 16S rRNA base of different strain
Because sequence carries out sequence analysis analysis, result show this bacterial strain belong to plan promise Ka Shi actinomyces, respectively with
Nocardiopsis sp.AF-333(FJ481931.1)、Nocardiopsis sp.FXJ6.077(GU002080.1)、
Streptomyces sp.Ahbb4KM214828.1、Nocardiopsis dassonvillei subsp.dassonvillei
strain NRRL B-16366(AY999914.2)、Nocardiopsis sp.AM8(AM236241.1)、Nocardiopsis
The similarity of sp.An26AM039886.1, Nocardiopsis sp.87H32-3EU196476.1 etc. is the highest, is 99%.Root
Speculate that this bacterial strain belongs to Nocardiopsis sp. subspecies, named Nocardiopsis.sp NX032 according to BLAST acquired results
And phylogenetic tree construction (Replications=1000, Bootstrap value takes percentage ratio).
5. the growth curve of Nocardiopsis sp.NX032 measures:
TSB culture medium: 5.0g sodium chloride, 17g tryptone, 3g soy peptone, 2.5g dipotassium hydrogen phosphate, 2.5g Fructus Vitis viniferae
Sugar, adds water and is settled to 1L, pH 7.3；
Specific implementation process: picking list bacterium colony from TSB flat board, is transferred in 30mL TSB fluid medium, 28-30
DEG C, 160rpm/min, shaken cultivation, after 2 days, is transferred in 50mL TSB culture medium by 2%, 28-30 DEG C, and 160rpm/min shakes
Swinging cultivation, every 6h samples, and measures OD600Value.
Nocardiopsis sp.NX032 strain growth curve as shown in Figure 4, the life of Nocardiopsis sp.NX032
It is Exponential growth stage that long lag phase is about 24h, 30-48h, and 48-60h is stable phase, is decline phase after 60h.Growth curve measures
The growth cycle of result explanation Nocardiopsis sp.NX032 bacterial strain and known plan promise Ka Shi actinomycetes growth cycle basic
Cause, understand this bacterial strain in its activity of exponential phase preferably referring concurrently to its growth cycle, therefore section inoculation fermentation training between selecting at this moment
Support base.
6. the antitumor cytolytic activity of Nocardiopsis sp.NX032 bacterial strain:
Specific implementation process: take 10-12 days fermentation liquids of Nocardiopsis sp.NX032 bacterial strain (10-12 days fermentation liquids
Strain culturing method when acquisition methods measures with growth curve is consistent) (10000rpm) centrifugal 15mim in refrigerated centrifuger,
Cross 0.22 μm filter membrane, obtain aseptic fermented supernatant fluid.By B16 mouse melanoma cell line with 104Number (100 μ in individual/every hole
L) it is laid on respectively in 96 orifice plates, is placed in 37 DEG C, 5%CO2Quiescent culture 24h in cell constant temperature incubator, makes cell attachment grow.
It is separately added into the aseptic fermented supernatant fluid of 2,5,10,15 μ L, and the nothing after 40 DEG C, 60 DEG C, 80 DEG C, 90 DEG C, 100 DEG C process 1h
Bacterium fermented supernatant fluid 10 μ L；Take aseptic fermented supernatant fluid simultaneously and after pH gradient 2,4,6,7,10,12 processes 1h, adjust pH extremely respectively
Neutrality, each 10 μ L of addition test for antitumor.(comparison i.e. CK adds and does not connects the spawn culture fermentation of 10-12 days separately to set matched group
Supernatant).It is independent and non-interfering two experiments that Temperature Treatment and pH process 10-12 days fermented supernatant fluids, it is therefore an objective to point
Do not probe into temperature and pH to the impact of anti-tumor activity thing activity in 10-12 days fermented supernatant fluids.On matched group and aseptic fermentation
Clear liquid respectively sets 3 repetitions, continues to cultivate 24h.Tumor cell change is observed with inverted microscope.To Hep-3B, (people's hepatocarcinoma is thin
Born of the same parents), Hela (human cervical carcinoma cell), HUVEC (Human umbilical vein endothelial cells: normal cell) make same experiment.
Fig. 5 be the 5 aseptic fermented supernatant fluids of μ L respectively to Hep-3B (human liver cancer cell), B16 (mouse melanin tumor cell),
The toxic effect figure of Hela (human cervical carcinoma cell), HUVEC (Human umbilical vein endothelial cells: normal cell) cell, in figure, a, e are
Hep-3B (human liver cancer cell), b, f are B16 (mouse melanin tumor cell), and c, g are Hela (human cervical carcinoma cell), and d, h are
HUVEC (Human umbilical vein endothelial cells: normal cell), wherein a, b, c, d are experimental group, and e, f, g, h are matched group.
Fig. 6 is aseptic fermented supernatant fluid after treatment of different temperature to be affected figure to B16 is Cytotoxic (in figure, a-e is for sending out
What ferment supernatant acted on B16 respectively after 40 DEG C, 60 DEG C, 80 DEG C, 90 DEG C, 100 DEG C process affects figure；F is the most heated place
What reason fermented supernatant fluid acted on B16 affects figure).
Fig. 7 is that to the toxic effect figure of B16 cell, (in figure, a-f is fermentation to the aseptic fermented supernatant fluid after different pH processes
What supernatant acted on B16 respectively after pH2,4,6,7,10,12 process affects figure).
Result of study shows, Nocardiopsis sp.NX032 fermented supernatant fluid can make under 5 μ L fermented supernatant fluids process
Hep-3B (human liver cancer cell), B16 (mouse melanin tumor cell), Hela (human cervical carcinoma cell), HUVEC are (in human umbilical vein
Chrotoplast: normal cell) cell shrinkage becomes round (seeing Fig. 5).Aseptic fermented supernatant fluid under treatment of different temperature is thin to tumor
Cellular toxicity does not has notable difference, all has stronger cytotoxicity, and B16 cell shrinkage can be made to become round so that cracking and (seeing figure
6)。
Under strong acid treatment, the activity of anti-tumor activity thing is compared with the activity of the anti-tumor activity thing under neutrallty condition, its
Activity is almost lost；Anti-tumor activity thing activity after highly basic processes is identical with strong acid treatment, and its activity reduces (seeing Fig. 7)；
Thus can speculate that the anti-tumor activity thing in fermented supernatant fluid is high temperature resistant but not acid and alkali-resistance material.
7. the anti-tumor experiment of AKTA Purifier10 isolating active component A and 3-(4,5-dimethyl-2-thiazole)-2,
5-diphenyl bromination tetrazole tetrazolium bromide (MTT) measures:
The preparation of active component A 1: 12,000rpm collects 10-12 days fermentation supernatant of Nocardiopsis sp.NX032
Liquid, adds solid ammonium sulfate (being slowly added to, add while stirring), the matter of ammonium sulfate to mixture in 500ml supernatant
Amount concentration is 30%, and 4 DEG C stand 4h, centrifugal 9000-12000rpm and collect precipitation.Supernatant is added solid ammonium sulfate to mixing
In thing, the mass concentration of ammonium sulfate is 50%, centrifugal collecting precipitation.Solid ammonium sulfate is added again, to mixture in supernatant
The mass concentration of ammonium sulfate is 80%, centrifugal collecting precipitation.Respectively 30%, 50% and 80% ammonium sulfate precipitation collected is used
Water redissolves, and the bag filter that molecular weight is 3.5KD specification with damming obtains thick leach protein after removing salt ion.Utilize Superdex
Thick leach protein is separated on protein purification instrument by 75 sephadex chromatography posts, (separation condition: flowing phase: water, stream
Speed: 1mL/min, applied sample amount: 1mL, operation method: 100% water, run time: 30min), collect the active component A obtained；And
Its purity is carried out SDS-PAGE detection.
Specific implementation process: by Hep-3B (human liver cancer cell), Hela (human cervical carcinoma cell) and B16 (mouse melanin
Oncocyte) and HUVEC (Human umbilical vein endothelial cells: normal cell) cell respectively with 104The number in individual/every hole is inoculated in 96 holes
Plate, is placed in 37 DEG C, 5%CO2Cell constant temperature incubator is cultivated, makes cell attachment grow, cultivate 24h；It is separately added into different dense
Degree room temperature activity component A, continues to cultivate 24h (often group arranges 3 repetitions)；The active component A that is not added with matched group continues to cultivate 24h；
Suck supernatant, add 90 μ L fresh RPMI-1640 culture medium, add 10 μ L MTT reagent, continue to cultivate 4h；Suck supernatant,
Every hole adds 110 μ L Formazan lysates, places 10min, interval concussion make crystal fully dissolve (MTT reagent with
Formazan lysate is shown in that light easily decomposes, and above step lucifuge operates), it is placed on enzyme-linked immunosorbent assay instrument at measurement 490nm each
The light absorption value in hole, and calculate cell survival rate.
After the sample A freeze concentration that will collect, 12% gum concentration carries out SDS-PAGE detection.Observation protein band is big
Little.
Fig. 8 is the precipitation toxicity shadow to B16 cell that aseptic fermented supernatant fluid is collected after variable concentrations ammonium sulfate precipitation
(in figure, A is matched group, and B is the albumen of the ammonium sulfate precipitation of 30%, and C is the albumen of the ammonium sulfate precipitation of 50%, and D is to ring figure
The albumen of the ammonium sulfate precipitation of 80%)；
Isolated and purified to ammonium sulfate crude extract of Fig. 9 AKTA Purifier10；
Figure 10 is that antitumor protein components A is to B16 cell anti-tumor determination of activity figure；(A is comparison CK, is i.e. not added with activity
The process of component A, the aspect graph of B16 cell after cultivation 24h；B is to add active component A to cultivate the aspect graph of B16 cell after 24h)
Figure 11 AKTA Purifier10 purity detecting to the SDS-PAGE of ammonium sulfate crude extract A.
Active component A isolated and purified for Figure 12 AKTA Purifier10 is to Hep-3B, Hela, B16 and HUVEC cell
The MTT detection of activity.MTT result shows, active component A is the most active to Hela, B16, Hep-3B and HUVEC cell, and
When concentration reaches 105.584 μ g/mL, the suppression ratio of three kinds of tumor cells all reaches or close to 50%, and Normocellular presses down
Rate processed is less than 25%, and wherein this active matter is best (seeing Figure 12) to the toxicity of B16 cell.Cell inhibitory rate computing formula is such as
Under:
Suppression ratio=[(ODCK-OD zeroing)-(OD sample-OD zeroing)]/(ODCK-OD zeroing)
ODCK: the normal cell cultivated；
OD returns to zero: only adds culture medium and is not added with cell；
OD sample: the normal cell cultivated adds sample treatment.
8. chromatographic isolation and the active matter MTT of Nocardiopsis sp.NX032 anti-tumor small molecular active matter detects:
Specific implementation process: 12000rpm/min collects 10-12 days fermented supernatant fluids of Nocardiopsis sp.NX032,
100% methanol activated overnight DM301 macroporous adsorbent resin, activated resin is eluted to tasteless through sterilized water, will after pH value to neutrality
Macroporous adsorbent resin mixes with 1:3 volume ratio with fermented supernatant fluid, and 4 DEG C stand 24h, collects 100% methanol and resolves solution,
12000rpm/min is centrifuged, and crosses 0.22 μm filter membrane, utilizes high performance liquid chromatograph (Agilent 1290Infinity) further
(pillar: ZORBAX SB-C18 9.4 × 150mm 5 μm, flow phase: water, acetonitrile, flow velocity: 1mL/ to separate anti-tumor activity thing
Min, applied sample amount: 20 μ L, operation method: 0-10min water: acetonitrile 60%-40%, 10-12min acetonitrile 100%.
Figure 13 be fermented supernatant fluid after DM301 macroporous adsorbent resin, water intaking on Agilent 1290 Infinity
Separation；Figure 14 is the unimodal determination of activity prepared, Peak1 and Peak2 component is at Agilent 1290 Infinity
After each unimodal freeze-dried concentrating instrument lyophilization of upper isolated, take 20 μ L ddH2O redissolves, and 13000rpm is centrifuged
After 30min, cross 0.22 μm film and obtain aseptic each unimodal collection liquid, respectively take 10 μ L and act on B16 cell 24h, the shape of observation of cell
State.
Figure 15 is that Agilent 1290Infinity isolating active component Peak1 is thin to Hela, B16, Hep-3B and HUVEC
The MTT of cytoactive measures.MTT result shows, active component Peak1 has work to Hela, B16, Hep-3B and HUVEC cell
Property, and when adding 72.536 μ L Peak1 in 100 μ L cell culture fluids, the suppression ratio of three kinds of tumor cells is above
50%, and Normocellular suppression ratio maintains about 25%.
9. the LC-MS/MS of Nocardiopsis.sp NX032 anti-tumor activity thing identifies:
Specific implementation process: anti-tumor protein film dosim Mass Spectrometric Identification: prepare aseptic 1.5mEP pipe, by sharp nothing
The lower purpose band of acicula head cutting.Add 280 μ L100mM NH4HCO3With the 30% acetonitrile decolouring of 120 μ L, room temperature is placed to glue
Block water white transparency, outwells supernatant, lyophilizing；Add 90 μ L100mM NH4HCO3, 10 μ L 100mM DTT, 56 DEG C of hatching 30min, also
Crude protein；Remove supernatant, add 100 μ L100%ACN, suck after 5min；Add 70 μ L100mM NH4HCO3,30μL 200mM
IAA, dark place 20min；Remove supernatant, add 100 μ L 100mM NH4HCO3, room temperature 15min；Remove supernatant, add 100% acetonitrile 100
μ L, sucks after 5min, lyophilizing；Add 5 μ L 10ng Trypsin solution after lyophilizing, be placed in 4 DEG C of refrigerator 30-60min, make blob of viscose fill
Divide and expand；Add appropriate 50mM ammonium bicarbonate buffers (without Trypsin), pH 7.8-8.0.20 hours left sides of 37 DEG C of reactions
Right；Collecting protein enzymatic hydrolyzate in new centrifuge tube, former pipe adds 100 μ L 60% acetonitrile/0.1% trifluoroacetic acids, ultrasonic 3 times,
15min every time, sucking-off solution is incorporated to previous solution.It is standby that merging lyophilizing is placed on-80 DEG C of refrigerators.Result is shown in Figure 16, through mass spectrum
Identify that this albumen is ATP synthase subunit a.
Anti-tumor small molecular Mass Spectrometric Identification: the anti-tumor small molecular obtained will be collected on Aglient 1290, carry out cold
The dry concentration of lyophilizing, takes 100 μ L and carries out LC-MS/MS qualification.Detection ion source is cation, mass spectral results display Peak 1 molecule
Amount is 158.03KDa (see Figure 17).
Claims (6)
1. intend promise Ka Shi actinomycetes for one kind, it is characterised in that be to intend promise Ka Shi actinomycetes NX032,Nocardiopsissp.
NX032, this culture presevation is in China typical culture collection center, and preserving number is CCTCC NO:M 2015361.
2. intend the separation method of promise Ka Shi actinomycetes active metabolite as claimed in claim 1, it is characterised in that include following
Step:
Plan promise Ka Shi actinomycetes NX032 is placed in fermentation medium, at 28-30 DEG C, under the conditions of 160-170rpm/min, shakes
After swinging cultivation 10-12 days, it is centrifuged 15-20min with 8000-12000rpm/min, collects fermented supernatant fluid, cross 0.22 μm filter membrane,
Obtain aseptic fermented supernatant fluid；Protein purification instrument carries out initial gross separation, collects and there is bioactive component；Utilize height
Effect liquid phase chromatogram instrument is the most isolated and purified, obtains active metabolite.
The separation method of plan promise Ka Shi actinomycetes active metabolite the most according to claim 2, it is characterised in that preliminary
During separation, on protein purification instrument, gel column used is Superdex 75 sephadex column.
4. according to the separation method intending promise Ka Shi actinomycetes active metabolite described in Claims 2 or 3, it is characterised in that
Further isolated and purified time, in described high performance liquid chromatograph, chromatographic column used is C18 reversed phase chromatographic column.
5. intend the application at anti-tumor aspect of the promise Ka Shi actinomycetes as claimed in claim 1.
6. intended the application at anti-tumor aspect of the promise Ka Shi actinomycetes active metabolite such as what one of claim 2-4 separated.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610390105.1A CN106047751B (en) | 2016-06-03 | 2016-06-03 | Separation method and the application of one plant of quasi- promise Cattell actinomyces and its active metabolite |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610390105.1A CN106047751B (en) | 2016-06-03 | 2016-06-03 | Separation method and the application of one plant of quasi- promise Cattell actinomyces and its active metabolite |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106047751A true CN106047751A (en) | 2016-10-26 |
| CN106047751B CN106047751B (en) | 2019-11-05 |
Family
ID=57170096
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610390105.1A Active CN106047751B (en) | 2016-06-03 | 2016-06-03 | Separation method and the application of one plant of quasi- promise Cattell actinomyces and its active metabolite |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106047751B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109706083A (en) * | 2018-12-10 | 2019-05-03 | 贵州省中国科学院天然产物化学重点实验室 | A kind of Eucommia Ulmoieds that the antibacterial activity after metabolic regulation dramatically increases |
| CN114292769A (en) * | 2021-12-01 | 2022-04-08 | 陕西省生物农业研究所 | Saline-alkali-resistant tomato leaf endophyte, fermentation liquor, preparation method and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101074234A (en) * | 2007-03-30 | 2007-11-21 | 云南大学 | Antitumor antibiotics and its production |
| CN101942406A (en) * | 2010-08-12 | 2011-01-12 | 淮海工学院 | Marine nocardiopsissp.HY-G and beta-glucosidase produced by same |
-
2016
- 2016-06-03 CN CN201610390105.1A patent/CN106047751B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101074234A (en) * | 2007-03-30 | 2007-11-21 | 云南大学 | Antitumor antibiotics and its production |
| CN101942406A (en) * | 2010-08-12 | 2011-01-12 | 淮海工学院 | Marine nocardiopsissp.HY-G and beta-glucosidase produced by same |
Non-Patent Citations (2)
| Title |
|---|
| KROUTIL W ET AL.: "Purification and characterization of a highly selective epoxide hydrolase from Nocardia sp.EH1", 《J BIOTECHNOL》 * |
| 高春燕等: "拟诺卡菌及其次级代谢产物", 《中国抗生素杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109706083A (en) * | 2018-12-10 | 2019-05-03 | 贵州省中国科学院天然产物化学重点实验室 | A kind of Eucommia Ulmoieds that the antibacterial activity after metabolic regulation dramatically increases |
| CN109706083B (en) * | 2018-12-10 | 2023-05-30 | 贵州省中国科学院天然产物化学重点实验室(贵州医科大学天然产物化学重点实验室) | Eucommia ulmoides endophytic fungus with remarkably increased antibacterial activity after metabolic regulation |
| CN114292769A (en) * | 2021-12-01 | 2022-04-08 | 陕西省生物农业研究所 | Saline-alkali-resistant tomato leaf endophyte, fermentation liquor, preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106047751B (en) | 2019-11-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| LU501210B1 (en) | Streptomyces antibioticus, preparation of metabolite thereof, and use thereof in antibacterial aspect | |
| CN108660082A (en) | A kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and the application in preparing antiseptic | |
| CN108753627A (en) | A kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and the application in preparing antitumor agent | |
| CN109694827A (en) | Marine fungi source azaphilones class compound and preparation method thereof and preparing the application in anti-vibrios drug | |
| CN106434372B (en) | Application of coral-derived fungus aspergillus terreus strain C21-10 | |
| CN105670968B (en) | A kind of marine natural anticol matter tumor activity substance and preparation and use | |
| CN106047751B (en) | Separation method and the application of one plant of quasi- promise Cattell actinomyces and its active metabolite | |
| CN111646993B (en) | Marine anti-glioma active substance iso-wall carboline base C, preparation and application thereof | |
| CN103173390B (en) | Chromobacterium violaceum strain and application thereof | |
| CN108794368A (en) | A kind of alkaloid compound and preparation method and application with various bacteriostatic activity | |
| CN104109642B (en) | Serratia marcescens, and screening method and application thereof | |
| CN108913606A (en) | A kind of ocean antimicrobial agent active material and preparation and use | |
| CN104962507A (en) | Myxobacteria strain and antitumor activity metabolite thereof | |
| CN109280034A (en) | A kind of Benzoxazepin class compound and the preparation method and application thereof with bacteriostatic activity | |
| CN102965300B (en) | Micromonospora strain, its preparation method and application | |
| CN105112322B (en) | Grey mold quinone A and B and preparation method thereof and medical usage | |
| CN102351859B (en) | Antibiotic Pseudonocardian A and Pseudonocardian B, its preparation method thereof and its application in preparation of antibiotics and antitumor drug | |
| CN107686817A (en) | One plant of fetid marsh fleabane endogenetic fungus CYSK 4 and its Ascomylactam class compounds of production application | |
| CN108085273A (en) | One plant of streptomyces antifungus and its metabolin, metabolin preparation method and application | |
| CN109678917A (en) | Amy gram strangles mycin and its preparation method and application | |
| CN102925372A (en) | Marine fungus rhodotorula minuta and application thereof in preparing anti-tumor medicines | |
| CN102911877A (en) | Marine fungi cladosporium sphaerospermum and application thereof | |
| CN105886421B (en) | One plant is intended without mycolic acids bacterium and the method for preparing special penta Efrotomycin using the bacterium | |
| CN111979137B (en) | Carbon-phosphorus compound derived from marine streptomyces and preparation method and application thereof | |
| CN102604843A (en) | Preparation method of fungus fermentation product and application thereof in prevention and treatment of rice diseases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |