CN109652416B - Characteristic sequence, labeled primer and identification method of apocarya variety Sumner - Google Patents
Characteristic sequence, labeled primer and identification method of apocarya variety Sumner Download PDFInfo
- Publication number
- CN109652416B CN109652416B CN201910148117.7A CN201910148117A CN109652416B CN 109652416 B CN109652416 B CN 109652416B CN 201910148117 A CN201910148117 A CN 201910148117A CN 109652416 B CN109652416 B CN 109652416B
- Authority
- CN
- China
- Prior art keywords
- primer
- variety
- sumner
- carya illinoensis
- molecular
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a plurality of pairs of high-specificity characteristic sequences and molecular specificity marker primers of a Carya illinoensis variety Sumner, and a method capable of quickly and accurately identifying the Carya illinoensis variety Sumner. The sequences of the molecular specific labeled primer group are as follows: 1) an upstream primer: 5'-AAGGGGCTTTGCAGATCCTC-3' downstream primer: 5'-ATCCAAGGCAGCTCTTCCAC-3' 2) upstream primer: 5'-TGGCATGCCCAACTTGATAGT-3' downstream primer: 5'-GCATGACCCTCGTTCGAGAA-3' 3) upstream primer: 5'-AGAGCCGATTCTTCCATGGT-3' downstream primer: 5'-ACCATTTGGATCTTCCCCATCA-3' the molecular specificity marker primer of the invention can rapidly and early identify the variety Sumner of apocarya, the method is simple, rapid and accurate, and is an irreplaceable molecular means for identifying the variety of apocarya by apparent characteristics.
Description
Technical Field
The invention relates to a characteristic sequence of a carya illinoensis variety Sumner, a molecular specific marker primer combination and a method for specifically identifying the carya illinoensis variety Sumner by using the molecular specific marker primer combination.
Background
Carya illinoensis (Carya illino ë nsis (Wangenh.) k. koch) is the most economically valuable tree species in the hickory genus of the jugaceae family; the apocarya is a typical outcrossing plant, and the existing production practice shows that the variety configuration of the apocarya is one of the main factors influencing the yield of the apocarya; the United states is one of the original producing areas of the apocarya and is also a central producing area, and over the years, about 1000 named cultivars have been bred in the United states; the introduction of the apocarya in China has a history of more than 100 years, the varieties which are commonly used in the current production are dozens, and the production practice of years proves that the majority of subtropical regions in China are suitable for the growth of the apocarya;
however, the main problems faced by the current apocarya producing area in China are low and unstable yield, and the reason for the phenomenon has multiple aspects, one of which is that the current introduced variety lacks clear genetic relationship analysis, and some hybrids are confused in name assignment, so that effective parent selection and reasonable configuration are difficult to perform, and variety identification, popularization, communication and new variety cultivation are inconvenient, therefore, developing some stable and specific DNA variety fingerprint markers on the molecular level is a scientific way for realizing accurate and rapid identification of the apocarya variety;
some molecular marking methods for pecan variety identification and genetic relationship analysis have been reported at home and abroad, and the SSR molecular marking methods are better, but the existing detection methods are more complicated and the results are unstable.
Disclosure of Invention
The invention aims to provide a characteristic sequence of a carya illinoensis variety Sumner, a molecular specific marker primer combination and a method for carrying out specific identification on the carya illinoensis variety Sumner by utilizing the molecular specific marker primer combination;
the technical scheme adopted by the invention is as follows:
the characteristic sequence group of the pecan variety Sumner comprises the following sequences:
1) 5′-AATTCTGTACGCAAAGTTGACTTGATCTCCAATGAGGAGGAGTGGTCGATTGTCCAAGGGGCTTTGCAGATCCTCACAGTTGCAGATTGTTTAACAAGCAGGTCTTCTGTCTTTGAGCTTCCTTGAGAGCTACACTTGCTAGGTTGAGCACAAGTTTGTCTCTTTCAGTATTTGGTTCAAGTCTGGACCAAAATCAGTCACATTTTGTCAGTGATCATGGAACTGGGGAGTTGTCTTTGGGTGGAAGAGCTGCCTTGGATGTGGC-3′
2) 5′-AATTCATCAATGCAAATGCTCAGCTTCTCTACAAGCTAACCTCCAATTTTCCTGCATGGCATGCCCAACTTGATAGTCTTGGCATTGGGTATGATCTCCAGGGTTTCATCACTGGTTCCCACCAGTGTCCTATACTCGGAAGTAACCCCATTCCTAATGCCATTGTTGCTCGCAATCGCTGGATTCGCCAAGATAAACTTCTTCTATGGCATTTTTGCTTCAGTTTCTAAAAGCATCTTGCCTTTAATTGCTATCTCAAGCACTTCAAGAGAAGCTTGGCTCAAACTACACAAATTGTTCTCGAACGAGGGTCATGCAA-3′
3) 5′-AATTCATTCCTAATAATCTTCCTAATAGTGTTGTCAAGAGCCGATTCTTCCATGGTTGAGGTAAACACTAACACTCGATATTCCTAGCTGGTGGAGTCTTTGACTATTATCCGACAAGTTCAAAAAGCACAACAGAAGGCTCAAGAGTCCCTGCAACAGGTAGTAGATGGGTTAGCTCAACAATTACAGGTAGTAGCTACTAATATGGAAAATATGATTCGGCAAGTGGGCAAAAAGATGGAGGAAACTCCAGTGAAACTCCAGTTGGCCCTGTTATGCACAGTAGCAACTCCCTTTTTGATGACATAGGTGGCATTCAAACTAAAGTAGTATGTTTGGAGTTTCCTAAATTTGATGGGGAAGATCCAAATGGTTGGCTTTATAAAGCCAACCAATTCTTTAGC-3′
the invention also relates to a molecular specific marker primer group of the pecan variety Sumner, wherein the primer sequence is as follows:
1) an upstream primer: 5'-AAGGGGCTTTGCAGATCCTC-3'
A downstream primer: 5'-ATCCAAGGCAGCTCTTCCAC-3'
2) An upstream primer: 5'-TGGCATGCCCAACTTGATAGT-3'
A downstream primer: 5'-GCATGACCCTCGTTCGAGAA-3'
3) An upstream primer: 5'-AGAGCCGATTCTTCCATGGT-3'
A downstream primer: 5'-ACCATTTGGATCTTCCCCATCA-3'
Sources of the 3 primer combinations: firstly, screening 5 varieties with larger character differences from 24 common varieties to carry out simplified gene sequencing and comparative analysis; then, more than 1000 pairs of primers are designed according to the analysis result, and screening and verification are carried out in 24 samples to obtain a specific DNA fragment of the pecan variety Sumner; then, cloning and sequencing the fragment, and performing repeated screening by more than three times of repeated sampling to finally obtain a molecular specific marker primer combination; carrying out PCR amplification on the apocarya varieties by using the specific primer combination, wherein 3 specific fragments with the sizes of 205bp, 260bp and 327bp can be obtained by only Sumner, and the specific fragments of the selected primer combination cannot be obtained by other apocarya varieties; the molecular specificity marker primer combination is only limited to the identification of the variety of the apocarya, namely, a sample to be detected is only limited to the apocarya;
aiming at the characteristic sequences, 3 pairs of specific primers are designed, and the amplified 3 products are respectively:
1)205bp:5′-AAGGGGCTTTGCAGATCCTCACAGTTGCAGATTGTTTAACAAGCAGGTCTTCTGTCTTTGAGCTTCCTTGAGAGCTACACTTGCTAGGTTGAGCACAAGTTTGTCTCTTTCAGTATTTGGTTCAAGTCTGGACCAAAATCAGTCACATTTTGTCAGTGATCATGGAACTGGGGAGTTGTCTTTGGGTGGAAGAGCTGCCTTGGAT-3′
2)260bp:5′-TGGCATGCCCAACTTGATAGTCTTGGCATTGGGTATGATCTCCAGGGTTTCATCACTGGTTCCCACCAGTGTCCTATACTCGGAAGTAACCCCATTCCTAATGCCATTGTTGCTCGCAATCGCTGGATTCGCCAAGATAAACTTCTTCTTGGCATTTTTGCTTCAGTTTCTAAAAGCATCTTGCCTTTAATTGCTATCTCAAGCACTTCAAGAGAAGCTTGGCTCAAACTACACAAATTGTTCTCGAACGAGGGTCATGC-3′
3)327bp:5′-AGAGCCGATTCTTCCATGGTTGAGGTAAACACTAACACTCGATATTCCTAGCTGGTGGAGTCTTTGACTATTATCCGACAAGTTCAAAAAGCACAACAGAAGGCTCAAGAGTCCCTGCAACAGGTAGTAGATGGGTTAGCTCAACAATTACAGGTAGTAGCTACTAATATGGAAAATATGATTCGGCAAGTGGGCAAAAAGATGGAGGAAACTCCAGTTGGCCCTGTTATGCACAGTAGCAACTCCCTTTTTGATGACATAGGTGGCATTCAAACTAAAGTAGTATGTTTGGAGTTTCCTAAATTTGATGGGGAAGATCCAAATGGT-3′
the variety found in 1932 in Sumner USA from the Taifeng tree in Georgia; the female flowers are ripe firstly, the flowering period is earlier, the male flowers are ripe later than the female flowers, and the middle is later; the fruit is big, oblong, round at the top and bottom, about 9.5g of average single fruit weight, golden yellow in color of the kernel, compact in main groove, obvious secondary grooves on two wings and deep in crack at the base;
the invention also relates to a method for rapidly identifying the pecan variety Sumner by utilizing the molecular specific marker primer combination, which comprises the following steps: extracting genome DNA of leaves of the carya illinoensis variety to be detected as a template, taking the molecular specific marker primer group as an amplification primer, performing PCR amplification, performing electrophoresis detection on an amplification product, and if 3 DNA strips with the sizes of 205bp, 260bp and 327bp respectively appear in an electrophoresis result at the same time, determining that the carya illinoensis variety to be detected is a carya illinoensis variety Sumner, otherwise, determining that the carya illinoensis variety to be detected is not; the sequence of the molecular specific marker primer is as follows:
1) an upstream primer: 5'-AAGGGGCTTTGCAGATCCTC-3'
A downstream primer: 5'-ATCCAAGGCAGCTCTTCCAC-3'
2) An upstream primer: 5'-TGGCATGCCCAACTTGATAGT-3'
A downstream primer: 5'-GCATGACCCTCGTTCGAGAA-3'
3) An upstream primer: 5'-AGAGCCGATTCTTCCATGGT-3'
A downstream primer: 5'-ACCATTTGGATCTTCCCCATCA-3'
The method is characterized in that the selection of an amplification primer combination, the DNA extraction, the determination of a PCR reaction system and reaction conditions, and the electrophoresis detection can be carried out according to the conventional method in the field;
compared with the existing molecular marking method of apocarya varieties, such as SSR and other marking methods, the method of the invention has the following advantages: (1) because the used primers are subjected to sequencing and repeated verification, the reliability is greatly improved; (2) the detection is convenient and visual, the combination of the bands can be directly observed through common electrophoresis to judge, and high-resolution electrophoresis is further used for further analysis or sequencing after the SSR labeling method is applied; (3) the requirement on the sample is low, and DNA samples of tissues such as leaves and the like can meet the requirement of variety identification;
preferably, the PCR amplification system of the present invention comprises:
the final concentration of PCR Buffer is 1
MgCl2 2.5 mmol/L
Taq enzyme 1.0U/reaction
The upstream and downstream primers are 0.2. mu.M each
Template DNA 60 ng/reaction
The balance being ddH2O；
The PCR amplification conditions were as follows: pre-denaturation at 94 ℃ for 300s, denaturation at 95 ℃ for 10s, annealing at 56 ℃ for 50s, extension at 72 ℃ for 40s, circulating for 30 times, and finally filling at 72 ℃ for 300 s; the termination temperature is 4 ℃;
the final concentration of the PCR Buffer is 1 x, which means that the concentration of each component in the PCR Buffer in a reaction system is the same as that of the PCR Buffer 1 x, and the PCR Buffer 10 x with the volume of 1/10 of the reaction system is usually selected; the 10 × PCR Buffer component is: 100 mM Tris-HCl (pH 8.5), 500 mM KCl, 25 mM MgCl2And 1.0% Triton-X-100 in ddH2O；
Specifically, the method comprises the following steps:
(1) adding liquid nitrogen into the leaves of the carya illinoensis to be detected, grinding, and extracting the genomic DNA of the carya illinoensis leaves to be detected by adopting the operation instruction of a bioteke novel rapid plant genomic DNA extraction kit;
(2) performing PCR amplification by taking the genomic DNA extracted in the step (1) as a template and the molecular specific marker primer as an amplification primer:
the composition of each 15. mu.l of PCR reaction was as follows:
2×TsingKE master mix 7.5μl
mu.l of each of 10. mu.M upstream and downstream primers
20 ng/. mu.l template DNA 2. mu.l
dd H2O 4.3μl；
The PCR reaction conditions were as follows:
pre-denaturation at 94 ℃ for 300s, denaturation at 95 ℃ for 10s, annealing at 56 ℃ for 50s, extension at 72 ℃ for 40s, circulating for 30 times, and finally filling at 72 ℃ for 300 s; the termination temperature is 4 ℃;
(3) taking 3 mu l of the amplified product in the step (2), uniformly mixing the amplified product with 1 mu l of 0.25% bromophenol blue buffer solution, spotting the mixture on 1.5% agarose gel, carrying out electrophoresis in 1 XTAE buffer solution at a voltage of 5V/cm, carrying out EB dyeing after the electrophoresis is finished, taking a picture on an automatic gel image analyzer, and if DNA bands with the sizes of 205bp, 260bp and 327bp respectively appear in the electrophoresis result, determining that the variety of the carya illinoensis to be detected is Sumner; otherwise, the result is no.
Drawings
FIG. 1 shows the results of PCR amplification of 24 Carya illinoensis varieties (numbers 1-24 represent Carya illinoensis varieties: 1, Moore, 2, dependeble, 3, Nacono, 4, Jingzhou No. 1, 5, Van Deman, 6, Sturat5, 7, Forkert, 8, Desirable, 9, Davis, 10, Elliott, 11, Caddo, 12, Schley, 13, Choctaw, 14, Shaoxing, 15, Wichita, 16, Sumner, 17, Mahan, 18, Gloria Grande, 19, Peruque, 20, Sioux, 21, Pyzner, 22, Pawnee, 23, Osage, 24, Ocone); m is Takara DL2000 marker; only number 16 is the number of 3 specific DNA bands of 205bp, 260bp and 327bp respectively amplified by Sumner of the carya illinoensis variety; the rest numbers are other apocarya varieties, and no specific DNA band is generated.
Detailed Description
The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:
example 1:
(1) extracting the genomic DNA of the apocarya variety:
taking 0.05 g of young leaves of the apocarya variety to be detected, adding liquid nitrogen to thoroughly grind, extracting genome DNA by adopting an operation instruction of a bioteke novel rapid plant genome DNA extraction kit, and extracting for multiple times to obtain a genome DNA extract of the apocarya variety; the DNA extract was subjected to 1.5% agarose gel electrophoresis to determine integrity, purity and concentration; judging the strip brightness for subsequent PCR amplification; storing the DNA extract in a refrigerator at-20 deg.C;
(2) designing specific PCR amplification primers, wherein the sequences of the primer pairs are as follows:
a, upstream primer: 5'-AAGGGGCTTTGCAGATCCTC-3'
A downstream primer: 5'-ATCCAAGGCAGCTCTTCCAC-3'
B, upstream primer: 5'-TGGCATGCCCAACTTGATAGT-3'
A downstream primer: 5'-GCATGACCCTCGTTCGAGAA-3'
C, upstream primer: 5'-AGAGCCGATTCTTCCATGGT-3'
A downstream primer: 5'-ACCATTTGGATCTTCCCCATCA-3'
Synthesized by Shanghai bioengineering technology, Inc.;
(3) and (3) PCR amplification:
composition of PCR reaction solution (15. mu.l):
2X TsingKE master mix (Otsugaku, Beijing) 7.5. mu.l
Mu.l of each of 10. mu.M upstream and downstream primers
20 ng/. mu.L template DNA 2. mu.l
dd H2O 4.3μl；
The amplification reaction is carried out on a TC-XP type amplification instrument; amplification conditions: pre-denaturation at 94 ℃ for 300s, denaturation at 95 ℃ for 10s, annealing at 56 ℃ for 50s, extension at 72 ℃ for 40s, circulating for 30 times, and finally filling at 72 ℃ for 300 s; the termination temperature is 4 ℃;
(4) and (3) electrophoresis detection: taking 3 mu l of PCR amplification product in the step (3), uniformly mixing with 1 mu l of 0.25% bromophenol blue buffer solution, spotting on 1.5% agarose Gel, carrying out electrophoresis in 1 XTAE buffer solution under the voltage of 5V/cm, after the electrophoresis is finished, staining in aqueous solution containing EB of 0.5 mu g/mL for 30 minutes, and then taking pictures on a Gel Doc of a Bio-rad Gel imaging system;
electrophoresis detection is carried out on PCR amplification maps of 24 carya illinoensis varieties (numbers 1-24 represent carya illinoensis varieties of 1, Moore, 2, dependeble, 3, Nacono, 4, Jingzhou No. 1, 5, Van Deman, 6, Sturat5, 7, Forkert, 8, Desirable, 9, Davis, 10, Elliott, 11, Caddo, 12, Schley, 13, Choctaw, 14, Shaoxing, 15, Wichia, 16, Sumner, 17, Mahan, 18, Gloria Grande, 19, Peruque, 20, Sioux, 21, Pyzner, 22, Pawnee, 23, Osage, 24 and Oconee) respectively according to the method, and the result is shown in figure 1;
three clear, bright and stable specific DNA bands of 205bp, 260bp and 327bp are amplified from the number 16 of the Carya illinoensis variety Sumner, and the rest of the Carya illinoensis varieties do not produce special DNA bands and other non-target bands.
SEQUENCE LISTING
<110> scientific institute of forestry in Zhejiang province
<120> pecan variety Sumner characteristic sequence, labeled primer and identification method
<130>
<160> 12
<170> PatentIn version 3.3
<210> 1
<211> 265
<212> DNA
<213> Carya illinoensis
<220>
<221> unsure
<400> 1
aattctgtac gcaaagttga cttgatctcc aatgaggagg agtggtcgat tgtccaaggg 60
gctttgcaga tcctcacagt tgcagattgt ttaacaagca ggtcttctgt ctttgagctt 120
ccttgagagc tacacttgct aggttgagca caagtttgtc tctttcagta tttggttcaa 180
gtctggacca aaatcagtca cattttgtca gtgatcatgg aactggggag ttgtctttgg 240
gtggaagagc tgccttggat gtggc 265
<210> 2
<211> 205
<212> DNA
<213> unknown
<220>
<221> unsure
<223> Artificial sequence
<400> 2
aaggggcttt gcagatcctc acagttgcag attgtttaac aagcaggtct tctgtctttg 60
agcttccttg agagctacac ttgctaggtt gagcacaagt ttgtctcttt cagtatttgg 120
ttcaagtctg gaccaaaatc agtcacattt tgtcagtgat catggaactg gggagttgtc 180
tttgggtgga agagctgcct tggat 205
<210> 3
<211> 20
<212> DNA
<213> unknown
<220>
<221> unsure
<223> Artificial sequence
<400> 3
aaggggcttt gcagatcctc 20
<210> 4
<211> 20
<212> DNA
<213> unknown
<220>
<221> unsure
<223> Artificial sequence
<400> 4
<210> 5
<211> 319
<212> DNA
<213> Carya illinoensis
<220>
<221> unsure
<400> 5
aattcatcaa tgcaaatgct cagcttctct acaagctaac ctccaatttt cctgcatggc 60
atgcccaact tgatagtctt ggcattgggt atgatctcca gggtttcatc actggttccc 120
accagtgtcc tatactcgga agtaacccca ttcctaatgc cattgttgct cgcaatcgct 180
ggattcgcca agataaactt cttctatggc atttttgctt cagtttctaa aagcatcttg 240
cctttaattg ctatctcaag cacttcaaga gaagcttggc tcaaactaca caaattgttc 300
tcgaacgagg gtcatgcaa 319
<210> 6
<211> 260
<212> DNA
<213> unknown
<220>
<221> unsure
<223> Artificial sequence
<400> 6
tggcatgccc aacttgatag tcttggcatt gggtatgatc tccagggttt catcactggt 60
tcccaccagt gtcctatact cggaagtaac cccattccta atgccattgt tgctcgcaat 120
cgctggattc gccaagataa acttcttctt ggcatttttg cttcagtttc taaaagcatc 180
ttgcctttaa ttgctatctc aagcacttca agagaagctt ggctcaaact acacaaattg 240
ttctcgaacg agggtcatgc 260
<210> 7
<211> 21
<212> DNA
<213> unknown
<220>
<221> unsure
<223> Artificial sequence
<400> 7
<210> 8
<211> 20
<212> DNA
<213> unknown
<220>
<221> unsure
<223> Artificial sequence
<400> 8
<210> 9
<211> 404
<212> DNA
<213> Carya illinoensis
<220>
<221> unsure
<400> 9
aattcattcc taataatctt cctaatagtg ttgtcaagag ccgattcttc catggttgag 60
gtaaacacta acactcgata ttcctagctg gtggagtctt tgactattat ccgacaagtt 120
caaaaagcac aacagaaggc tcaagagtcc ctgcaacagg tagtagatgg gttagctcaa 180
caattacagg tagtagctac taatatggaa aatatgattc ggcaagtggg caaaaagatg 240
gaggaaactc cagtgaaact ccagttggcc ctgttatgca cagtagcaac tccctttttg 300
atgacatagg tggcattcaa actaaagtag tatgtttgga gtttcctaaa tttgatgggg 360
aagatccaaa tggttggctt tataaagcca accaattctt tagc 404
<210> 10
<211> 327
<212> DNA
<213> unknown
<220>
<221> unsure
<223> Artificial sequence
<400> 10
agagccgatt cttccatggt tgaggtaaac actaacactc gatattccta gctggtggag 60
tctttgacta ttatccgaca agttcaaaaa gcacaacaga aggctcaaga gtccctgcaa 120
caggtagtag atgggttagc tcaacaatta caggtagtag ctactaatat ggaaaatatg 180
attcggcaag tgggcaaaaa gatggaggaa actccagttg gccctgttat gcacagtagc 240
aactcccttt ttgatgacat aggtggcatt caaactaaag tagtatgttt ggagtttcct 300
aaatttgatg gggaagatcc aaatggt 327
<210> 11
<211> 20
<212> DNA
<213> unknown
<220>
<221> unsure
<223> Artificial sequence
<400> 11
<210> 12
<211> 22
<212> DNA
<213> unknown
<220>
<221> unsure
<223> Artificial sequence
<400> 12
accatttgga tcttccccat ca 22
Claims (5)
1. The molecular marker set of the pecan variety Sumner consists of 3 coexisting specific DNA fragments, and the base sequences are as follows:
1)5′-AATTCTGTACGCAAAGTTGACTTGATCTCCAATGAGGAGGAGTGGTCGATTGTCCAAGGGGCTTTGCAGATCCTCACAGTTGCAGATTGTTTAACAAGCAGGTCTTCTGTCTTTGAGCTTCCTTGAGAGCTACACTTGCTAGGTTGAGCACAAGTTTGTCTCTTTCAGTATTTGGTTCAAGTCTGGACCAAAATCAGTCACATTTTGTCAGTGATCATGGAACTGGGGAGTTGTCTTTGGGTGGAAGAGCTGCCTTGGATGTGGC-3′
2)5′-AATTCATCAATGCAAATGCTCAGCTTCTCTACAAGCTAACCTCCAATTTTCCTGCATGGCATGCCCAACTTGATAGTCTTGGCATTGGGTATGATCTCCAGGGTTTCATCACTGGTTCCCACCAGTGTCCTATACTCGGAAGTAACCCCATTCCTAATGCCATTGTTGCTCGCAATCGCTGGATTCGCCAAGATAAACTTCTTCTATGGCATTTTTGCTTCAGTTTCTAAAAGCATCTTGCCTTTAATTGCTATCTCAAGCACTTCAAGAGAAGCTTGGCTCAAACTACACAAATTGTTCTCGAACGAGGGTCATGCAA-3′
3)5′-AATTCATTCCTAATAATCTTCCTAATAGTGTTGTCAAGAGCCGATTCTTCCATGGTTGAGGTAAACACTAACACTCGATATTCCTAGCTGGTGGAGTCTTTGACTATTATCCGACAAGTTCAAAAAGCACAACAGAAGGCTCAAGAGTCCCTGCAACAGGTAGTAGATGGGTTAGCTCAACAATTACAGGTAGTAGCTACTAATATGGAAAATATGATTCGGCAAGTGGGCAAAAAGATGGAGGAAACTCCAGTGAAACTCCAGTTGGCCCTGTTATGCACAGTAGCAACTCCCTTTTTGATGACATAGGTGGCATTCAAACTAAAGTAGTATGTTTGGAGTTTCCTAAATTTGATGGGGAAGATCCAAATGGTTGGCTTTATAAAGCCAACCAATTCTTTAGC-3′。
2. 3 coexisting molecular-specific marker primer sets of the pecan variety Sumner, wherein the primer sequences are respectively as follows:
1) an upstream primer: 5'-AAGGGGCTTTGCAGATCCTC-3'
A downstream primer: 5'-ATCCAAGGCAGCTCTTCCAC-3'
2) An upstream primer: 5'-TGGCATGCCCAACTTGATAGT-3'
A downstream primer: 5'-GCATGACCCTCGTTCGAGAA-3'
3) An upstream primer: 5'-AGAGCCGATTCTTCCATGGT-3'
A downstream primer: 5'-ACCATTTGGATCTTCCCCATCA-3' are provided.
3. A method for rapidly identifying a carya illinoensis variety Sumner by using the coexisting 3 molecular specific marker primers of claim 2, the method comprising: extracting genome DNA of leaves of the carya illinoensis variety to be detected as a template, taking the molecular specific marker primer as an amplification primer, performing PCR amplification, performing electrophoresis detection on an amplification product, and if 3 specific DNA strips with the sizes of 205bp, 260bp and 327bp respectively appear in an electrophoresis result at the same time, determining that the carya illinoensis variety to be detected is the carya illinoensis variety Sumner, otherwise, determining that the carya illinoensis variety to be detected is the carya illinoensis variety Sumner; the sequences of the 3 molecular specific marker primer groups are respectively as follows:
1) an upstream primer: 5'-AAGGGGCTTTGCAGATCCTC-3'
A downstream primer: 5'-ATCCAAGGCAGCTCTTCCAC-3'
2) An upstream primer: 5'-TGGCATGCCCAACTTGATAGT-3'
A downstream primer: 5'-GCATGACCCTCGTTCGAGAA-3'
3) An upstream primer: 5'-AGAGCCGATTCTTCCATGGT-3'
A downstream primer: 5'-ACCATTTGGATCTTCCCCATCA-3' are provided.
4. The method of claim 3, wherein the PCR amplification conditions are as follows: pre-denaturation at 94 ℃ for 300s, denaturation at 95 ℃ for 10s, annealing at 56 ℃ for 50s, extension at 72 ℃ for 40s, circulating for 30 times, and finally filling at 72 ℃ for 300 s; the termination temperature was 4 ℃.
5. A method according to claim 3 or 4, characterized in that the method is as follows:
(1) adding liquid nitrogen into the leaves of the carya illinoensis to be detected, grinding, and extracting the genome DNA by adopting the operation instruction of a bioteke novel rapid plant genome DNA extraction kit;
(2) performing PCR amplification by taking the genomic DNA extracted in the step (1) as a template and the molecular specific marker primer as an amplification primer;
the PCR amplification conditions were as follows:
pre-denaturation at 94 ℃ for 300s, denaturation at 95 ℃ for 10s, annealing at 56 ℃ for 50s, extension at 72 ℃ for 40s, circulating for 30 times, and finally filling at 72 ℃ for 300 s; the termination temperature is 4 ℃;
(3) and (3) taking 3 mu l of the amplification product obtained in the step (2), uniformly mixing with 1 mu l of 0.25% bromophenol blue buffer solution, spotting the mixture on 1.5% agarose gel, carrying out electrophoresis in 1 XTAE buffer solution at a voltage of 5V/cm, carrying out EB (electron beam) dyeing after the electrophoresis is finished, taking a picture on an automatic gel imaging system, and if 3 DNA bands with the sizes of 205bp, 260bp and 327bp respectively appear in the electrophoresis result, determining that the variety of the carya illinoensis to be detected is Sumner, otherwise, determining that the variety is not Sumner.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910148117.7A CN109652416B (en) | 2019-02-28 | 2019-02-28 | Characteristic sequence, labeled primer and identification method of apocarya variety Sumner |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910148117.7A CN109652416B (en) | 2019-02-28 | 2019-02-28 | Characteristic sequence, labeled primer and identification method of apocarya variety Sumner |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109652416A CN109652416A (en) | 2019-04-19 |
| CN109652416B true CN109652416B (en) | 2021-12-17 |
Family
ID=66123308
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910148117.7A Active CN109652416B (en) | 2019-02-28 | 2019-02-28 | Characteristic sequence, labeled primer and identification method of apocarya variety Sumner |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109652416B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107557434A (en) * | 2017-09-02 | 2018-01-09 | 浙江省林业科学研究院 | Thin shell mountain pecan Peach cultivars Van Deman characteristic sequence, labeled primer and authentication method |
| CN107557369A (en) * | 2017-09-02 | 2018-01-09 | 浙江省林业科学研究院 | Thin shell mountain pecan Peach cultivars Nacono characteristic sequence, labeled primer and authentication method |
| CN108330163A (en) * | 2017-09-02 | 2018-07-27 | 浙江省林业科学研究院 | Characteristic sequence, primer and the identification method of thin shell mountain pecan Peach cultivars Nacono and Sumner |
-
2019
- 2019-02-28 CN CN201910148117.7A patent/CN109652416B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107557434A (en) * | 2017-09-02 | 2018-01-09 | 浙江省林业科学研究院 | Thin shell mountain pecan Peach cultivars Van Deman characteristic sequence, labeled primer and authentication method |
| CN107557369A (en) * | 2017-09-02 | 2018-01-09 | 浙江省林业科学研究院 | Thin shell mountain pecan Peach cultivars Nacono characteristic sequence, labeled primer and authentication method |
| CN108330163A (en) * | 2017-09-02 | 2018-07-27 | 浙江省林业科学研究院 | Characteristic sequence, primer and the identification method of thin shell mountain pecan Peach cultivars Nacono and Sumner |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109652416A (en) | 2019-04-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108660136B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Davis | |
| CN107557434B (en) | Characteristic sequence, labeled primer and identification method of Carya illinoensis variety Van Deman | |
| CN107586867B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Pawnee | |
| CN107557369B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Nacono | |
| US11926869B2 (en) | Development of simple sequence repeat (SSR) core primer group based on whole genome sequence of pomegranate and application thereof | |
| CN108330163B (en) | Characteristic sequence, primer and identification method of apocarya variety Nacono and Sumner | |
| CN110791586B (en) | SSR (simple sequence repeat) marker primer group for identifying Chinese chestnut varieties and application thereof | |
| CN109652589B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Gloria Grande | |
| CN101654709B (en) | Method for using sts primer to identify ginseng species | |
| CN107586866B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Moore | |
| CN109694923B (en) | Characteristic sequence, marker primer and identification method of apocarya variety Jingzhou No. 1 | |
| CN109652428B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Sioux | |
| CN109652415B (en) | Characteristic sequence, labeled primer and identification method of pecan variety Osage | |
| CN113151567A (en) | SSR molecular marker and method for identifying Lepista sordida N006# strain | |
| CN109694922B (en) | Characteristic sequence, labeled primer and identification method of pecan variety dependendable | |
| CN109652416B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Sumner | |
| CN109706262A (en) | Characteristic sequence, labeled primer and the identification method of thin shell mountain pecan Peach cultivars Davis | |
| CN106676175B (en) | For the Rapid identification oil tea breeding Cen specificity labeled primers pair and authentication method of soft No. 2 | |
| CN108330164B (en) | Characteristic sequence, primer and identification method of apocarya variety Moore | |
| CN109652588B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Elliott | |
| CN109666759B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Wichita | |
| CN109694865B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Desirable | |
| CN111763668B (en) | Sequencing primer group and PCR-based whole genome sequencing method | |
| CN110343778B (en) | Polymorphic marker primer of camellia variety spring Jiang Gongxia and camellia variety identification method | |
| CN108690882B (en) | Molecular specific marker primer and detection method for hibiscus varieties of oxsulan, floru, alden and minuosha |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhu Tangjun Inventor after: Peng Huazheng Inventor after: Jin Qunying Inventor after: Ye Hualin Inventor before: Not publicizing the inventor |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |