CN109652428B - Characteristic sequence, labeled primer and identification method of apocarya variety Sioux - Google Patents
Characteristic sequence, labeled primer and identification method of apocarya variety Sioux Download PDFInfo
- Publication number
- CN109652428B CN109652428B CN201910148116.2A CN201910148116A CN109652428B CN 109652428 B CN109652428 B CN 109652428B CN 201910148116 A CN201910148116 A CN 201910148116A CN 109652428 B CN109652428 B CN 109652428B
- Authority
- CN
- China
- Prior art keywords
- primer
- variety
- sioux
- carya illinoensis
- molecular
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Botany (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Mycology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a plurality of pairs of high-specificity characteristic sequences and molecular specificity marker primers of a carya illinoensis variety Sioux and a method capable of quickly and accurately identifying the carya illinoensis variety Sioux. The sequences of the molecular specific labeled primer group are as follows: 1) an upstream primer: 5'-AGTCAGAGTCGGAGTCGGAT-3' downstream primer: 5'-AGCCTAGCCTTGCAACCTTT-3' 2) upstream primer: 5'-TGGTTCCTGCATAACACTCACA-3' downstream primer: 5'-GGTTCCAGATCACTTCCGCA-3' 3) upstream primer: 5'-AGCGTGCGATTTCCTACGAA-3' downstream primer: 5'-AATTTTACCTGGGGTGGCGT-3' the molecular specificity marker primer can rapidly and early identify the variety Sioux of the carya illinoensis, the method is simple, rapid and accurate, and is an irreplaceable molecular means for identifying the variety of the carya illinoensis by the apparent characteristics.
Description
The invention relates to a characteristic sequence of a carya illinoensis variety Sioux, a molecular specificity labeled primer combination and a method for identifying the specificity of the carya illinoensis variety Sioux by using the molecular specificity labeled primer combination.
Background
Carya illinoensis (Carya illino ë nsis (Wangenh.) k. koch) is the most economically valuable tree species in the hickory genus of the jugaceae family; the apocarya is a typical outcrossing plant, and the existing production practice shows that the variety configuration of the apocarya is one of the main factors influencing the yield of the apocarya; the United states is one of the original producing areas of the apocarya and is also a central producing area, and over the years, about 1000 named cultivars have been bred in the United states; the introduction of apocarya in China has a history of more than 100 years, and the varieties commonly used in the current production have dozens, and the production practice of years proves that the majority of subtropical regions in China are suitable for the growth of apocarya;
however, the main problems faced by the current apocarya producing area in China are low and unstable yield, and the reason for the phenomenon has multiple aspects, one of which is that the current introduced variety lacks clear genetic relationship analysis, and some hybrids are confused in name assignment, so that effective parent selection and reasonable configuration are difficult to perform, and variety identification, popularization, communication and new variety cultivation are inconvenient, therefore, developing some stable and specific DNA variety fingerprint markers on the molecular level is a scientific way for realizing accurate and rapid identification of the apocarya variety;
some molecular marking methods for pecan variety identification and genetic relationship analysis have been reported at home and abroad, and SSR molecular marking methods are better, but the existing detection methods are more complicated and the results are unstable.
Disclosure of Invention
The invention aims to provide a characteristic sequence of a carya illinoensis variety Sioux, a molecular specificity marker primer combination and a method for identifying the specificity of the carya illinoensis variety Sioux by using the molecular specificity marker primer combination;
the technical scheme adopted by the invention is as follows:
the characteristic sequence group of apocarya variety Sioux comprises the following sequence groups:
1)5′-AATTCAGTCAGAGTCGGAGTCGGATTTCATATTTAAACTTTGACAAAATCTGAGTCAAAATCAGATTTAGGGGATATCGACTCTGACTCTATCAGTGCTCAACCCTATGGTGAAACGTCACTTCCCCCTTGCTTGTGTCCGTCAATACATGTCCATGAACATATCATCAAATATTCTTAAGTCGAAACTGATGAAACATAAAGGTTGCAAGGCTAGGCTCTAAATGAGAGTCTTGCTTGACTCATACTTTGCTCAATCATACGCATGCTCTCAAT-3′
2)5′-AATTCAATGGTTCCTGCATAACACTCACATAGTGTTTCCTCCCAATCCTTTATAATGCTTAATAATTTCTCCAAGTTTGTTTTGGCTCGTTTCATGAAATCCATGAGATATCTCACTTTATACTTTTCCATGGTTTGCAATTTTTCACTCCCATGGTGGAAAGGCCCCATGGAAATAACTGCGCAGTAGGTCAGCTCCCATGGTGGAAAGGCCCCATGGAAATAACCCGAGGAGTGTAAGCTTCTTCATTCATTTTGCGGAAGTGATCTGGAACCTTGTAGATACAACATCCAGGTGATAGTAGAGGCCTCGAACTTTCTATCATTTCCTTGATTTCAATTAC-3′
3)5′-AATTCGAACAACCTCTTTCTACCCTATAATATTACACTATATAAAGCCCATGAAAGCGTGCGATTTCCTACGAAATTTACAAAGCATCTCTCCTCCGTCAAAACCATTAGACTGTTTCTCGGCCGACTTAGAGGTGGTTTTCCTGTGACATGGACTCGCACTTTCTGACCCTTCAAACTGGTTCGTGGACCAACGAGAAGCACTTGCTGTTCTTAAACACCATGGAGGCCTCCTTTGTGCGTGCAATGTTTGAGAGCAACGGTCGGATTGCTCTCCGCCTGGACCGTGACTTGCCGGACAGCTCGGAGTCGACATTAGATTCGAAGACGCATAGAAGAGAAAAACACGCCACCCCAGGTAAAATTAATATCAA-3′
the invention also relates to a molecular specificity marker primer group of the apocarya variety Sioux, and the primer sequence is as follows:
1) an upstream primer: 5'-AGTCAGAGTCGGAGTCGGAT-3'
A downstream primer: 5'-AGCCTAGCCTTGCAACCTTT-3'
2) An upstream primer: 5'-TGGTTCCTGCATAACACTCACA-3'
A downstream primer: 5'-GGTTCCAGATCACTTCCGCA-3'
3) An upstream primer: 5'-AGCGTGCGATTTCCTACGAA-3'
A downstream primer: 5'-AATTTTACCTGGGGTGGCGT-3'
Sources of the 3 primer combinations: firstly, screening 5 varieties with larger character differences from 24 common varieties to carry out simplified gene sequencing and comparative analysis; then, more than 1000 pairs of primers are designed according to the analysis result, and screening and verification are carried out on 24 samples to obtain specific DNA fragments of the apocarya variety Sioux; then, cloning and sequencing the fragment, and performing repeated screening by more than three times of repeated sampling to finally obtain a molecular specific marker primer combination; carrying out PCR amplification on the apocarya variety by using the specific primer combination, wherein only Sioux can obtain 3 specific fragments with the sizes of 214bp, 268bp and 311bp respectively, and other apocarya varieties cannot obtain the specific fragments of the selected primer combination; the molecular specificity marker primer combination is only limited to the identification of the variety of the apocarya, namely, a sample to be detected is only limited to the apocarya;
aiming at the characteristic sequences, 3 pairs of specific primers are designed, and the amplified 3 products are respectively:
1)214bp:5’-AGTCAGAGTCGGAGTCGGATTTCATATTTAAACTTTGACAAAATCTGAGTCAAAATCAGATTTAGGGGATATCGACTCTGACTCTATCAGTGCTCAACCCTATGGTGAAACGTCACTTCCCCCTTGCTTGTGTCCGTCAATACATGTCCATGAACATATCATCAAATATTCTTAAGTCGAAACTGATGAAACATAAAGGTTGCAAGGCTAGGCT-3′
2)268bp:5’-TGGTTCCTGCATAACACTCACATAGTGTTTCCTCCCAATCCTTTATAATGCTTAATAATTTCTCCAAGTTTGTTTTGGCTCGTTTCATGAAATCCATGAGATATCTCACTTTATACTTTTCCATGGTTTGCAATTTTTCACTCCCATGGTGGAAAGGCCCCATGGAAATAACTGCGCAGTAGGTCAGCTCCCATGGTGGAAAGGCCCCATGGAAATAACCCGAGGAGTGTAAGCTTCTTCATTCATTTTGCGGAAGTGATCTGGAACC-3′
3)311bp:5’-AGCGTGCGATTTCCTACGAAATTTACAAAGCATCTCTCCTCCGTCAAAACCATTAGACTGTTTCTCGGCCGACTTAGAGGTGGTTTTCCTGTGACATGGACTCGCACTTTCTGACCCTTCAAACTGGTTCGTGGACCAACGAGAAGCACTTGCTGTTCTTAAACACCATGGAGGCCTCCTTTGTGCGTGCAATGTTTGAGAGCAACGGTCGGATTGCTCTCCGCCTGGACCGTGACTTGCCGGACAGCTCGGAGTCGACATTAGATTCGAAGACGCATAGAAGAGAAAAACACGCCACCCCAGGTAAAATT-3′
sioux is a variety introduced by the United states department of agriculture and research (USDA-ARS) through crossbreeding, and was selected by the filial generation of 'Schley' x 'Carmichael' in 1943 in Texas and released in 1962; the tree body is moderate in growth vigor, female flowers are ripe first, and the flowering phase is early; the male flower has a moderate flowering period; the fruit belongs to a Chinese fruit type, the average single fruit weight is about 6.4g, the nuts are long and oval, the top ends are sharp and the bottoms are round, the heads are wide and the tails are contracted; the nutlet is golden yellow, the back ridge is slightly thin and tapered, the main groove is narrow and deep, the base part has no crack, the texture is fine and smooth, and the oil content is high;
the invention also relates to a method for rapidly identifying the apocarya variety Sioux by utilizing the molecular specificity labeled primer combination, which comprises the following steps: extracting genome DNA of leaves of the carya illinoensis varieties to be detected as templates, taking the molecular specific marker primer group as an amplification primer, carrying out PCR amplification, carrying out electrophoresis detection on amplification products, and if 3 DNA strips with the sizes of 214bp, 268bp and 311bp respectively appear in the electrophoresis results at the same time, determining that the carya illinoensis varieties to be detected are the carya illinoensis varieties Sioux, otherwise, determining that the carya illinoensis varieties are not the same; the sequence of the molecular specific marker primer is as follows:
1) an upstream primer: 5'-AGTCAGAGTCGGAGTCGGAT-3'
A downstream primer: 5'-AGCCTAGCCTTGCAACCTTT-3'
2) An upstream primer: 5'-TGGTTCCTGCATAACACTCACA-3'
A downstream primer: 5'-GGTTCCAGATCACTTCCGCA-3'
3) An upstream primer: 5'-AGCGTGCGATTTCCTACGAA-3'
A downstream primer: 5'-AATTTTACCTGGGGTGGCGT-3'
The method is characterized in that the selection of an amplification primer combination, the DNA extraction, the determination of a PCR reaction system and reaction conditions, and the electrophoresis detection can be carried out according to the conventional method in the field;
compared with the existing molecular marking method of apocarya varieties, such as SSR and other marking methods, the method of the invention has the following advantages: (1) because the used primers are subjected to sequencing and repeated verification, the reliability is greatly improved; (2) the detection is convenient and visual, the combination of the bands can be directly observed through common electrophoresis to judge, and high-resolution electrophoresis is further used for further analysis or sequencing after the SSR labeling method is applied; (3) the requirement on the sample is low, and DNA samples of tissues such as leaves and the like can meet the requirement of variety identification;
preferably, the PCR amplification system of the present invention comprises:
the final concentration of PCR Buffer is 1
MgCl 2 2.5 mmol/L
Taq enzyme 1.0U/reaction
The upstream and downstream primers are 0.2. mu.M each
Template DNA 60 ng/reaction
The balance being ddH 2 O；
The PCR amplification conditions were as follows: pre-denaturing at 94 ℃ for 300s, denaturing at 95 ℃ for 10s, annealing at 56 ℃ for 50s, extending at 72 ℃ for 40s, circulating for 30 times, and finally filling at 72 ℃ for 300 s; the termination temperature is 4 ℃;
the final concentration of the PCR Buffer is 1 x, which means that the concentration of each component in the PCR Buffer in a reaction system is the same as that of the PCR Buffer 1 x, and the PCR Buffer 10 x with the volume of 1/10 of the reaction system is usually selected; the 10 × PCR Buffer component is: 100 mM Tris-HCl (pH 8.5), 500 mM KCl, 25 mM MgCl 2 And 1.0% Triton-X-100 in ddH 2 O；
Specifically, the method comprises the following steps:
(1) adding liquid nitrogen into the leaves of the carya illinoensis to be detected, grinding, and extracting the genomic DNA of the carya illinoensis leaves to be detected by adopting the operation instruction of a bioteke novel rapid plant genomic DNA extraction kit;
(2) performing PCR amplification by taking the genomic DNA extracted in the step (1) as a template and the molecular specific marker primer as an amplification primer:
the composition of each 15. mu.l of PCR reaction was as follows:
2×TsingKE master mix 7.5μl
mu.l of each of 10. mu.M upstream and downstream primers
20 ng/. mu.l template DNA 2. mu.l
dd H 2 O 4.3μl；
The PCR reaction conditions were as follows:
pre-denaturation at 94 ℃ for 300s, denaturation at 95 ℃ for 10s, annealing at 56 ℃ for 50s, extension at 72 ℃ for 40s, circulating for 30 times, and finally filling at 72 ℃ for 300 s; the termination temperature is 4 ℃;
(3) taking 3 mu l of the amplified product in the step (2), uniformly mixing the amplified product with 1 mu l of 0.25% bromophenol blue buffer solution, spotting the mixed solution on 1.5% agarose gel, carrying out electrophoresis in 1 XTAE buffer solution at a voltage of 5V/cm, carrying out EB dyeing after the electrophoresis is finished, taking a picture on an automatic gel image analyzer, and if DNA bands with the sizes of 214bp, 268bp and 311bp respectively appear in the electrophoresis result, determining that the variety of the carya illinoensis to be detected is Sioux; otherwise, the result is no.
Drawings
FIG. 1 shows the results of PCR amplification of 24 Carya illinoensis varieties (numbers 1-24 represent Carya illinoensis varieties: 1, Moore, 2, dependeble, 3, Nacono, 4, Jingzhou No. 1, 5, Van Deman, 6, Sturat5, 7, Forkert, 8, Desirable, 9, Davis, 10, Elliott, 11, Caddo, 12, Schley, 13, Choctaw, 14, Shaoxing, 15, Wichita, 16, Sumner, 17, Mahan, 18, Gloria Grande, 19, Peruque, 20, Sioux, 21, Pyzner, 22, Pawnee, 23, Osage, 24, Ocone); m is Takara DL2000 marker; only 20 serial numbers of 3 specific DNA bands with the molecular weights of 214bp, 268bp and 311bp are amplified for the carya illinoensis variety Sioux; the rest numbers are other apocarya varieties, and no specific DNA band is generated.
Detailed Description
The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:
example 1:
(1) extracting the genomic DNA of the apocarya variety:
taking 0.05 g of young leaves of the variety of the carya illinoensis to be detected, adding liquid nitrogen for thoroughly grinding, extracting genome DNA by adopting an operation instruction of a bioteke novel rapid plant genome DNA extraction kit, and extracting for multiple times to obtain a genome DNA extract of the variety of the carya illinoensis; the DNA extract was subjected to 1.5% agarose gel electrophoresis to determine integrity, purity and concentration; judging the strip brightness for subsequent PCR amplification; storing the DNA extract in a refrigerator at-20 deg.C;
(2) designing specific PCR amplification primers, wherein the sequences of the primer pairs are as follows:
a, upstream primer: 5'-AGTCAGAGTCGGAGTCGGAT-3'
A downstream primer: 5'-AGCCTAGCCTTGCAACCTTT-3'
B, upstream primer: 5'-TGGTTCCTGCATAACACTCACA-3'
A downstream primer: 5'-GGTTCCAGATCACTTCCGCA-3'
C, upstream primer: 5'-AGCGTGCGATTTCCTACGAA-3'
A downstream primer: 5'-AATTTTACCTGGGGTGGCGT-3'
Synthesized by Shanghai bioengineering technology, Inc.;
(3) and (3) PCR amplification:
composition of PCR reaction solution (15. mu.l):
2X TsingKE master mix (Otsugaku, Beijing) 7.5. mu.l
Mu.l of each of 10. mu.M upstream and downstream primers
20 ng/. mu.l template DNA 2. mu.l
dd H 2 O 4.3μl；
The amplification reaction is carried out on a TC-XP type amplification instrument; amplification conditions: pre-denaturation at 94 ℃ for 300s, denaturation at 95 ℃ for 10s, annealing at 56 ℃ for 50s, extension at 72 ℃ for 40s, circulating for 30 times, and finally filling at 72 ℃ for 300 s; the termination temperature is 4 ℃;
(4) and (3) electrophoresis detection: taking 3 mu l of PCR amplification product in the step (3), uniformly mixing with 1 mu l of 0.25% bromophenol blue buffer solution, spotting on 1.5% agarose Gel, carrying out electrophoresis in 1 XTAE buffer solution under the voltage of 5V/cm, after the electrophoresis is finished, staining in aqueous solution containing EB of 0.5 mu g/ml for 30 minutes, and then taking pictures on a Gel Doc of a Bio-rad Gel imaging system;
electrophoresis detection is carried out on PCR amplification maps of 24 carya illinoensis varieties (numbers 1-24 represent carya illinoensis varieties of 1, Moore, 2, dependeble, 3, Nacono, 4, Jingzhou No. 1, 5, Van Deman, 6, Sturat5, 7, Forkert, 8, Desirable, 9, Davis, 10, Elliott, 11, Caddo, 12, Schley, 13, Choctaw, 14, Shaoxing, 15, Wichia, 16, Sumner, 17, Mahan, 18, Gloria Grande, 19, Peruque, 20, Sioux, 21, Pyzner, 22, Pawnee, 23, Osage, 24 and Oconee) respectively according to the method, and the result is shown in figure 1;
three clear, bright and stable 3 specific DNA bands with the sizes of 214bp, 268bp and 311bp are amplified from the carya illinoensis variety Sinoux with the number of 20, while the other carya illinoensis varieties have no special DNA band and no other non-target bands, so that the molecular specific marker primer pair developed by the invention is used for early identification of the carya illinoensis variety Sinoux, and has very high stability and specificity.
SEQUENCE LISTING
<110> scientific institute of forestry in Zhejiang province
<120> pecan variety Sioux characteristic sequence, labeled primer and identification method
<130>
<160> 12
<170> PatentIn version 3.3
<210> 1
<211> 275
<212> DNA
<213> Carya illinoensis
<220>
<221> unsure
<400> 1
aattcagtca gagtcggagt cggatttcat atttaaactt tgacaaaatc tgagtcaaaa 60
tcagatttag gggatatcga ctctgactct atcagtgctc aaccctatgg tgaaacgtca 120
cttccccctt gcttgtgtcc gtcaatacat gtccatgaac atatcatcaa atattcttaa 180
gtcgaaactg atgaaacata aaggttgcaa ggctaggctc taaatgagag tcttgcttga 240
ctcatacttt gctcaatcat acgcatgctc tcaat 275
<210> 2
<211> 214
<212> DNA
<213> unknown
<220>
<221> unsure
<223> Artificial sequence
<400> 2
agtcagagtc ggagtcggat ttcatattta aactttgaca aaatctgagt caaaatcaga 60
tttaggggat atcgactctg actctatcag tgctcaaccc tatggtgaaa cgtcacttcc 120
cccttgcttg tgtccgtcaa tacatgtcca tgaacatatc atcaaatatt cttaagtcga 180
aactgatgaa acataaaggt tgcaaggcta ggct 214
<210> 3
<211> 20
<212> DNA
<213> unknown
<220>
<221> unsure
<223> Artificial sequence
<400> 3
agtcagagtc ggagtcggat 20
<210> 4
<211> 20
<212> DNA
<213> unknown
<220>
<221> unsure
<223> Artificial sequence
<400> 4
<210> 5
<211> 343
<212> DNA
<213> Carya illinoensis
<220>
<221> unsure
<400> 5
aattcaatgg ttcctgcata acactcacat agtgtttcct cccaatcctt tataatgctt 60
aataatttct ccaagtttgt tttggctcgt ttcatgaaat ccatgagata tctcacttta 120
tacttttcca tggtttgcaa tttttcactc ccatggtgga aaggccccat ggaaataact 180
gcgcagtagg tcagctccca tggtggaaag gccccatgga aataacccga ggagtgtaag 240
cttcttcatt cattttgcgg aagtgatctg gaaccttgta gatacaacat ccaggtgata 300
gtagaggcct cgaactttct atcatttcct tgatttcaat tac 343
<210> 6
<211> 268
<212> DNA
<213> unknown
<220>
<221> unsure
<223> Artificial sequence
<400> 6
tggttcctgc ataacactca catagtgttt cctcccaatc ctttataatg cttaataatt 60
tctccaagtt tgttttggct cgtttcatga aatccatgag atatctcact ttatactttt 120
ccatggtttg caatttttca ctcccatggt ggaaaggccc catggaaata actgcgcagt 180
aggtcagctc ccatggtgga aaggccccat ggaaataacc cgaggagtgt aagcttcttc 240
attcattttg cggaagtgat ctggaacc 268
<210> 7
<211> 22
<212> DNA
<213> unknown
<220>
<221> unsure
<223> Artificial sequence
<400> 7
tggttcctgc ataacactca ca 22
<210> 8
<211> 20
<212> DNA
<213> unknown
<220>
<221> unsure
<223> Artificial sequence
<400> 8
<210> 9
<211> 373
<212> DNA
<213> Carya illinoensis
<220>
<221> unsure
<400> 9
aattcgaaca acctctttct accctataat attacactat ataaagccca tgaaagcgtg 60
cgatttccta cgaaatttac aaagcatctc tcctccgtca aaaccattag actgtttctc 120
ggccgactta gaggtggttt tcctgtgaca tggactcgca ctttctgacc cttcaaactg 180
gttcgtggac caacgagaag cacttgctgt tcttaaacac catggaggcc tcctttgtgc 240
gtgcaatgtt tgagagcaac ggtcggattg ctctccgcct ggaccgtgac ttgccggaca 300
gctcggagtc gacattagat tcgaagacgc atagaagaga aaaacacgcc accccaggta 360
aaattaatat caa 373
<210> 10
<211> 311
<212> DNA
<213> unknown
<220>
<221> unsure
<223> Artificial sequence
<400> 10
agcgtgcgat ttcctacgaa atttacaaag catctctcct ccgtcaaaac cattagactg 60
tttctcggcc gacttagagg tggttttcct gtgacatgga ctcgcacttt ctgacccttc 120
aaactggttc gtggaccaac gagaagcact tgctgttctt aaacaccatg gaggcctcct 180
ttgtgcgtgc aatgtttgag agcaacggtc ggattgctct ccgcctggac cgtgacttgc 240
cggacagctc ggagtcgaca ttagattcga agacgcatag aagagaaaaa cacgccaccc 300
caggtaaaat t 311
<210> 11
<211> 20
<212> DNA
<213> unknown
<220>
<221> unsure
<223> Artificial sequence
<400> 11
<210> 12
<211> 20
<212> DNA
<213> unknown
<220>
<221> unsure
<223> Artificial sequence
<400> 12
Claims (5)
1. The molecular marker group of the apocarya variety Sioux consists of 3 coexisting specific DNA fragments, and the base sequences are as follows:
1)5′-AATTCAGTCAGAGTCGGAGTCGGATTTCATATTTAAACTTTGACAAAATCTGAGTCAAAATCAGATTTAGGGGATATCGACTCTGACTCTATCAGTGCTCAACCCTATGGTGAAACGTCACTTCCCCCTTGCTTGTGTCCGTCAATACATGTCCATGAACATATCATCAAATATTCTTAAGTCGAAACTGATGAAACATAAAGGTTGCAAGGCTAGGCTCTAAATGAGAGTCTTGCTTGACTCATACTTTGCTCAATCATACGCATGCTCTCAAT-3′
2)5′-AATTCAATGGTTCCTGCATAACACTCACATAGTGTTTCCTCCCAATCCTTTATAATGCTTAATAATTTCTCCAAGTTTGTTTTGGCTCGTTTCATGAAATCCATGAGATATCTCACTTTATACTTTTCCATGGTTTGCAATTTTTCACTCCCATGGTGGAAAGGCCCCATGGAAATAACTGCGCAGTAGGTCAGCTCCCATGGTGGAAAGGCCCCATGGAAATAACCCGAGGAGTGTAAGCTTCTTCATTCATTTTGCGGAAGTGATCTGGAACCTTGTAGATACAACATCCAGGTGATAGTAGAGGCCTCGAACTTTCTATCATTTCCTTGATTTCAATTAC-3′
3)5′-AATTCGAACAACCTCTTTCTACCCTATAATATTACACTATATAAAGCCCATGAAAGCGTGCGATTTCCTACGAAATTTACAAAGCATCTCTCCTCCGTCAAAACCATTAGACTGTTTCTCGGCCGACTTAGAGGTGGTTTTCCTGTGACATGGACTCGCACTTTCTGACCCTTCAAACTGGTTCGTGGACCAACGAGAAGCACTTGCTGTTCTTAAACACCATGGAGGCCTCCTTTGTGCGTGCAATGTTTGAGAGCAACGGTCGGATTGCTCTCCGCCTGGACCGTGACTTGCCGGACAGCTCGGAGTCGACATTAGATTCGAAGACGCATAGAAGAGAAAAACACGCCACCCCAGGTAAAATTAATATCAA-3′。
2. the coexisting 3 pairs of molecular specificity labeling primers of the apocarya variety Sioux, the primer sequences are respectively as follows:
1) an upstream primer: 5'-AGTCAGAGTCGGAGTCGGAT-3'
A downstream primer: 5'-AGCCTAGCCTTGCAACCTTT-3'
2) An upstream primer: 5'-TGGTTCCTGCATAACACTCACA-3'
A downstream primer: 5'-GGTTCCAGATCACTTCCGCA-3'
3) An upstream primer: 5'-AGCGTGCGATTTCCTACGAA-3'
A downstream primer: 5'-AATTTTACCTGGGGTGGCGT-3' are provided.
3. A method for rapidly identifying apocarya variety Sioux by using the coexisting 3 pairs of molecular-specific labeled primers as claimed in claim 2, the method comprising: extracting genome DNA of leaves of the carya illinoensis variety to be detected as a template, taking the molecular specificity marker primer as an amplification primer, carrying out PCR amplification, carrying out electrophoresis detection on an amplification product, if 3 specific DNA bands with the sizes of 214bp, 268bp and 311bp respectively appear in an electrophoresis result at the same time, determining that the carya illinoensis variety to be detected is the carya illinoensis variety Sioux, otherwise, determining that the carya illinoensis variety to be detected is not the carya illinoensis variety Sioux; the sequences of the 3 pairs of molecular specific labeling primer groups are respectively as follows:
1) an upstream primer: 5'-AGTCAGAGTCGGAGTCGGAT-3'
A downstream primer: 5'-AGCCTAGCCTTGCAACCTTT-3'
2) An upstream primer: 5'-TGGTTCCTGCATAACACTCACA-3'
A downstream primer: 5'-GGTTCCAGATCACTTCCGCA-3'
3) An upstream primer: 5'-AGCGTGCGATTTCCTACGAA-3'
A downstream primer: 5'-AATTTTACCTGGGGTGGCGT-3' are provided.
4. The method of claim 3, wherein the PCR amplification conditions are as follows: pre-denaturation at 94 ℃ for 300s, denaturation at 95 ℃ for 10s, annealing at 56 ℃ for 50s, extension at 72 ℃ for 40s, circulating for 30 times, and finally filling at 72 ℃ for 300 s; the termination temperature was 4 ℃.
5. A method according to any of claims 3 or 4, characterized in that the method is as follows:
(1) taking a carya illinoensis leaf to be detected, adding liquid nitrogen for grinding, and extracting genome DNA by adopting an operation instruction of a bioteke novel rapid plant genome DNA extraction kit;
(2) performing PCR amplification by taking the genomic DNA extracted in the step (1) as a template and the molecular specific marker primer as an amplification primer;
the PCR amplification conditions were as follows:
pre-denaturation at 94 ℃ for 300s, denaturation at 95 ℃ for 10s, annealing at 56 ℃ for 50s, extension at 72 ℃ for 40s, circulating for 30 times, and finally filling at 72 ℃ for 300 s; the termination temperature is 4 ℃;
(3) and (3) taking 3 mu l of the amplification product obtained in the step (2), uniformly mixing with 1 mu l of 0.25% bromophenol blue buffer solution, spotting the mixture on 1.5% agarose gel, carrying out electrophoresis in 1 XTAE buffer solution at a voltage of 5V/cm, carrying out EB (electron beam) dyeing after the electrophoresis is finished, taking a picture on an automatic gel imaging system, and if 3 DNA bands with the sizes of 214bp, 268bp and 311bp respectively appear in the electrophoresis result, determining that the variety of the carya illinoensis to be detected is Sioux, otherwise, determining that the variety is not.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910148116.2A CN109652428B (en) | 2019-02-28 | 2019-02-28 | Characteristic sequence, labeled primer and identification method of apocarya variety Sioux |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910148116.2A CN109652428B (en) | 2019-02-28 | 2019-02-28 | Characteristic sequence, labeled primer and identification method of apocarya variety Sioux |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109652428A CN109652428A (en) | 2019-04-19 |
| CN109652428B true CN109652428B (en) | 2022-09-20 |
Family
ID=66123103
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910148116.2A Active CN109652428B (en) | 2019-02-28 | 2019-02-28 | Characteristic sequence, labeled primer and identification method of apocarya variety Sioux |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109652428B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113981125B (en) * | 2021-11-04 | 2023-07-11 | 中国林业科学研究院亚热带林业研究所 | Molecular marker of apocarya variety Creek and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107557369A (en) * | 2017-09-02 | 2018-01-09 | 浙江省林业科学研究院 | Thin shell mountain pecan Peach cultivars Nacono characteristic sequence, labeled primer and authentication method |
| CN107586867A (en) * | 2017-09-02 | 2018-01-16 | 浙江省林业科学研究院 | Thin shell mountain pecan Peach cultivars Pawnee characteristic sequence, labeled primer and authentication method |
| CN108660136A (en) * | 2018-06-26 | 2018-10-16 | 浙江省林业科学研究院 | Characteristic sequence, labeled primer and the identification method of thin shell mountain pecan Peach cultivars Davis |
-
2019
- 2019-02-28 CN CN201910148116.2A patent/CN109652428B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107557369A (en) * | 2017-09-02 | 2018-01-09 | 浙江省林业科学研究院 | Thin shell mountain pecan Peach cultivars Nacono characteristic sequence, labeled primer and authentication method |
| CN107586867A (en) * | 2017-09-02 | 2018-01-16 | 浙江省林业科学研究院 | Thin shell mountain pecan Peach cultivars Pawnee characteristic sequence, labeled primer and authentication method |
| CN108660136A (en) * | 2018-06-26 | 2018-10-16 | 浙江省林业科学研究院 | Characteristic sequence, labeled primer and the identification method of thin shell mountain pecan Peach cultivars Davis |
Non-Patent Citations (1)
| Title |
|---|
| 薄壳山核桃品种果质性状变异及选择改良研究;李永荣等;《江苏林业科技》;20110615(第03期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109652428A (en) | 2019-04-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108660136B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Davis | |
| CN107557434B (en) | Characteristic sequence, labeled primer and identification method of Carya illinoensis variety Van Deman | |
| CN107557369B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Nacono | |
| CN107586867B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Pawnee | |
| CN108330163B (en) | Characteristic sequence, primer and identification method of apocarya variety Nacono and Sumner | |
| US11926869B2 (en) | Development of simple sequence repeat (SSR) core primer group based on whole genome sequence of pomegranate and application thereof | |
| CN110791586A (en) | SSR (simple sequence repeat) marker primer group for identifying Chinese chestnut varieties and application thereof | |
| CN109652589B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Gloria Grande | |
| CN107586866B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Moore | |
| CN109694923B (en) | Characteristic sequence, marker primer and identification method of apocarya variety Jingzhou No. 1 | |
| CN109652428B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Sioux | |
| CN109652415B (en) | Characteristic sequence, labeled primer and identification method of pecan variety Osage | |
| CN109694922B (en) | Characteristic sequence, labeled primer and identification method of pecan variety dependendable | |
| CN109706262A (en) | Characteristic sequence, labeled primer and the identification method of thin shell mountain pecan Peach cultivars Davis | |
| CN106676175B (en) | For the Rapid identification oil tea breeding Cen specificity labeled primers pair and authentication method of soft No. 2 | |
| CN110804675A (en) | Microsatellite DNA marker fingerprint spectrum of non-heading Chinese cabbage and application thereof | |
| CN109652416B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Sumner | |
| CN114182042B (en) | SNP (Single nucleotide polymorphism) marker related to brown skin/green skin of Chinese pear and application thereof | |
| CN109666759B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Wichita | |
| CN109652588B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Elliott | |
| CN108330164B (en) | Characteristic sequence, primer and identification method of apocarya variety Moore | |
| CN109694865B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Desirable | |
| CN106834529A (en) | A kind of molecular labeling for indicating and identifying muskmelon orange flesh proterties and its primer and application | |
| CN110343778B (en) | Polymorphic marker primer of camellia variety spring Jiang Gongxia and camellia variety identification method | |
| CN110129469B (en) | Characteristic nucleotide sequence, specific primer and identification method of improved camellia oleifera variety GanYong 5 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Peng Huazheng Inventor after: Jin Qunying Inventor after: Zhu Tangjun Inventor after: Ye Hualin Inventor before: Do not announce the inventor |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |