CN109652416A

CN109652416A - Characteristic sequence, labeled primer and the identification method of thin shell mountain pecan Peach cultivars Sumner

Info

Publication number: CN109652416A
Application number: CN201910148117.7A
Authority: CN
Inventors: 不公告发明人
Original assignee: Zhejiang Academy of Forestry
Current assignee: Zhejiang Academy of Forestry
Priority date: 2019-02-28
Filing date: 2019-02-28
Publication date: 2019-04-19
Anticipated expiration: 2039-02-28
Also published as: CN109652416B

Abstract

The present invention relates to the characteristic sequence of the multipair high specific of thin shell mountain pecan Peach cultivars Sumner, molecular specificity labeled primers and it is a kind of can be to the method that thin shell mountain pecan Peach cultivars Sumner is quickly and accurately identified.The molecular specificity labeled primers group sequence is as follows: 1) upstream primer: 5 '-AAGGGGCTTTGCAGATCCTC-3 ' downstream primer: 5 '-ATCCAAGGCAGCTCTTCCAC-3 ' 2) upstream primer: 5 '-TGGCATGCCCAACTTGATAGT-3 ' downstream primer: 5 '-GCATGACCCTCGTTCGAGAA-3 ' 3) upstream primer: 5 '-AGAGCCGATTCTTCCATGGT-3 ' downstream primer: 5 '-ACCATTTGGATCTTCCCCATCA-3 ' molecular specificity labeled primers of the present invention can carry out quick Early Identification to thin shell mountain pecan Peach cultivars Sumner, method is simple, fast , it is accurate, be that appearance features distinguish the irreplaceable Molecular tools of thin shell mountain pecan Peach cultivars.

Description

Characteristic sequence, labeled primer and the identification method of thin shell mountain pecan Peach cultivars Sumner

Technical field

The present invention relates to the characteristic sequence of thin shell mountain pecan Peach cultivars Sumner, molecular specificity labeled primers combination and benefits The method that specificity identification is carried out to thin shell mountain pecan Peach cultivars Sumner is combined with the molecular specificity labeled primers.

Background technique

Apocarya (Carya illino nsis (Wangenh.) K.Koch) is that most have in Juglandaceae hickory The tree species of economic value；Apocarya is typical outcrossing plant, and existing production practices discovery, the kind of apocarya is matched Setting is one of the principal element for influencing its yield；The U.S. is one of source area of apocarya and center producing region, many years Come, cultivar about 1000 of U.S.'s breeding name；China introduces a fine variety apocarya and has more than 100 years history, raw at present Common kind has tens in production, and the production practices of many years prove that the vast subtropical zone in China is the adaptability of apocarya Area；

But the main problem that faces of the existing apocarya producing region in China be it is under low output and unstable, cause this phenomenon The reason of have many aspects, one of them is exactly that the kind of existing introduction still lacks specific Genetic relationship, adds one The confusion that a little filial generations are named, causes to be difficult to carry out effective Juvenile stage and reasonable disposition, is not easy to cultivar identification, pushes away Extensively, exchange and the cultivation of new varieties, therefore put forth effort to develop some stabilizations, special DNA varieties systematics mark from molecular level Note is to realize the Scientific Approaches of the accurate Rapid identification of thin shell mountain pecan Peach cultivars；

Some molecule labelling methods for apocarya cultivar identification and Genetic relationship have been reported both at home and abroad, it is relatively good Have SSR molecular marker method, but these old detection methods are relatively complicated, and unstable result.

Summary of the invention

It is an object of the present invention to provide the characteristic sequence of thin shell mountain pecan Peach cultivars Sumner, molecular specificity labeled primers to combine And using molecular specificity labeled primers combination to the method for thin shell mountain pecan Peach cultivars Sumner progress specificity identification；

The technical solution adopted by the present invention is that:

The characteristic sequence group of thin shell mountain pecan Peach cultivars Sumner, sequence group are as follows:

1)5′-AATTCTGTACGCAAAGTTGACTTGATCTCCAATGAGGAGGAGTGGTCGATTGTCCAAGGGGCTTTGC AGATCCTCACAGTTGCAGATTGTTTAACAAGCAGGTCTTCTGTCTTTGAGCTTCCTTGAGAGCTACACTTGCTAGG TTGAGCACAAGTTTGTCTCTTTCAGTATTTGGTTCAAGTCTGGACCAAAATCAGTCACATTTTGTCAGTGATCATG GAACTGGGGAGTTGTCTTTGGGTGGAAGAGCTGCCTTGGATGTGGC-3′

2)5′-AATTCATCAATGCAAATGCTCAGCTTCTCTACAAGCTAACCTCCAATTTTCCTGCATGGCATGCCCA ACTTGATAGTCTTGGCATTGGGTATGATCTCCAGGGTTTCATCACTGGTTCCCACCAGTGTCCTATACTCGGAAGT AACCCCATTCCTAATGCCATTGTTGCTCGCAATCGCTGGATTCGCCAAGATAAACTTCTTCTATGGCATTTTTGCT TCAGTTTCTAAAAGCATCTTGCCTTTAATTGCTATCTCAAGCACTTCAAGAGAAGCTTGGCTCAAACTACACAAAT TGTTCTCGAACGAGGGTCATGCAA-3′

3)5′-AATTCATTCCTAATAATCTTCCTAATAGTGTTGTCAAGAGCCGATTCTTCCATGGTTGAGGTAAACA CTAACACTCGATATTCCTAGCTGGTGGAGTCTTTGACTATTATCCGACAAGTTCAAAAAGCACAACAGAAGGCTCA AGAGTCCCTGCAACAGGTAGTAGATGGGTTAGCTCAACAATTACAGGTAGTAGCTACTAATATGGAAAATATGATT CGGCAAGTGGGCAAAAAGATGGAGGAAACTCCAGTGAAACTCCAGTTGGCCCTGTTATGCACAGTAGCAACTCCCT TTTTGATGACATAGGTGGCATTCAAACTAAAGTAGTATGTTTGGAGTTTCCTAAATTTGATGGGGAAGATCCAAAT GGTTGGCTTTATAAAGCCAACCAATTCTTTAGC-3′

The invention further relates to the molecular specificity labeled primers group of thin shell mountain pecan Peach cultivars Sumner, the primer sequences are as follows:

1) upstream primer: 5 '-AAGGGGCTTTGCAGATCCTC-3 '

Downstream primer: 5 '-ATCCAAGGCAGCTCTTCCAC-3 '

2) upstream primer: 5 '-TGGCATGCCCAACTTGATAGT-3 '

Downstream primer: 5 '-GCATGACCCTCGTTCGAGAA-3 '

3) upstream primer: 5 '-AGAGCCGATTCTTCCATGGT-3 '

Downstream primer: 5 '-ACCATTTGGATCTTCCCCATCA-3 '

The source of above-mentioned 3 pairs of primers combination: firstly, filtering out biggish 5 kinds of Traits change from 24 common kinds Simplify the sequencing and comparative analysis of gene；Then, based on the analysis results design 1000 multipair primers, in 24 samples into Row screening and verifying, obtain the DNA fragment specific of thin shell mountain pecan Peach cultivars Sumner；Then, by the segment cloning and sequencing, then By the secondary screening of repeatability sampling more than three times, the molecular specificity labeled primers finally obtained are combined；Drawn with above-mentioned specificity Object combination carries out PCR amplification to thin shell mountain pecan Peach cultivars, and it is respectively 205bp, 260bp, 327bp size that only Sumner, which can get, 3 specific fragments, other thin shell mountain pecan Peach cultivars cannot obtain the specific fragment for selecting primer combination；It needs to illustrate It is that molecular specificity labeled primers combination of the invention is only limitted to the identification of thin shell mountain pecan Peach cultivars, i.e. sample to be tested is only limitted to Apocarya；

For features described above sequence, 3 pairs of specific primers of design, 3 products expanded are respectively as follows:

1)205bp:5′-AAGGGGCTTTGCAGATCCTCACAGTTGCAGATTGTTTAACAAGCAGGTCTTCTGTCTTTGA GCTTCCTTGAGAGCTACACTTGCTAGGTTGAGCACAAGTTTGTCTCTTTCAGTATTTGGTTCAAGTCTGGACCAAA ATCAGTCACATTTTGTCAGTGATCATGGAACTGGGGAGTTGTCTTTGGGTGGAAGAGCTGCCTTGGAT-3′

2)260bp:5′-TGGCATGCCCAACTTGATAGTCTTGGCATTGGGTATGATCTCCAGGGTTTCATCACTGGTT CCCACCAGTGTCCTATACTCGGAAGTAACCCCATTCCTAATGCCATTGTTGCTCGCAATCGCTGGATTCGCCAAGA TAAACTTCTTCTTGGCATTTTTGCTTCAGTTTCTAAAAGCATCTTGCCTTTAATTGCTATCTCAAGCACTTCAAGA GAAGCTTGGCTCAAACTACACAAATTGTTCTCGAACGAGGGTCATGC-3′

3)327bp:5′-AGAGCCGATTCTTCCATGGTTGAGGTAAACACTAACACTCGATATTCCTAGCTGGTGGAGT CTTTGACTATTATCCGACAAGTTCAAAAAGCACAACAGAAGGCTCAAGAGTCCCTGCAACAGGTAGTAGATGGGTT AGCTCAACAATTACAGGTAGTAGCTACTAATATGGAAAATATGATTCGGCAAGTGGGCAAAAAGATGGAGGAAACT CCAGTTGGCCCTGTTATGCACAGTAGCAACTCCCTTTTTGATGACATAGGTGGCATTCAAACTAAAGTAGTATGTT TGGAGTTTCCTAAATTTGATGGGGAAGATCCAAATGGT-3′

The kind that U.S. Sumner 1932 is found from the rich seedling tree of Thailand of the Georgia State；Female flower is first ripe, partially early in the florescence, male Flower maturity is slower than female flower, in it is to the rear；Belonging to large fruit, oblong, top and bottom are all relatively round, mean fruit weight 9.5g or so, Kernel coloured gold is yellow, and main groove is close, and both wings have apparent groove, and base portion crack is deep；

The invention further relates to a kind of using the described molecular specificity labeled primers combination, to thin shell mountain pecan Peach cultivars Sumner into The method of row Rapid identification, the method are as follows: extract the genomic DNA of thin shell mountain pecan Peach cultivars blade to be measured as template, with The molecular specificity labeled primers group carries out PCR amplification as amplimer, electrophoresis detection is carried out to amplified production, if electric There are 3 DNA bands of respectively 205bp, 260bp, 327bp size simultaneously in result of swimming, then thin shell mountain pecan Peach cultivars to be measured are Thin shell mountain pecan Peach cultivars Sumner, it is on the contrary then no；The molecular specificity labeled primers sequence are as follows:

1) upstream primer: 5 '-AAGGGGCTTTGCAGATCCTC-3 '

Downstream primer: 5 '-ATCCAAGGCAGCTCTTCCAC-3 '

2) upstream primer: 5 '-TGGCATGCCCAACTTGATAGT-3 '

Downstream primer: 5 '-GCATGACCCTCGTTCGAGAA-3 '

3) upstream primer: 5 '-AGAGCCGATTCTTCCATGGT-3 '

Downstream primer: 5 '-ACCATTTGGATCTTCCCCATCA-3 '

The method of the present invention key is the selection of amplimer combination, and DNA is extracted, and PCR reaction system and reaction condition determine, with And electrophoresis detection, it can be carried out according to conventional method in that art；

The method of the present invention is compared with the molecule labelling method of existing thin shell mountain pecan Peach cultivars, such as SSR labeling method, has following excellent Point: (1) because the primer is verified through sequencing and repeatedly, therefore reliability improves very much；(2) easy to detect, intuitive, it is directly logical Crossing the combination of the presence or absence of general electrophoresis observation band can determine whether, and also need to utilize high score after expanding if applying SSR marker method Resolution electrophoresis is further analyzed or is sequenced；(3) lower to the requirement of sample, the DNA sample of the tissues such as blade can satisfy The needs of cultivar identification；

Preferably, PCR amplification system composition of the present invention is as follows:

PCR Buffer final concentration of 1 ×

dNTPs 1 mmol/L

MgCl₂ 2.5 mmol/L

1.0 U/ of Taq enzyme reaction

Each 0.2 μM of upstream and downstream primer

60 ng/ of template DNA reaction

Surplus is ddH₂O；

The PCR amplification condition is as follows: after 94 DEG C of initial denaturation 300s, 95 DEG C of denaturation 10s, 56 DEG C of annealing time 50s, 72 DEG C extend 40s is recycled 30 times, altogether finally in 72 DEG C of filling-in 300s；Final temperature is 4 DEG C；

PCR Buffer final concentration of 1 ×, refer to the concentration of each component in the reaction system and 1 × PCR in PCR Buffer Buffer is identical, and usually selecting volume is 10 × PCR Buffer of reaction system volume 1/10；10 × PCR Buffer ingredient Are as follows: 100 mM Tris-HCl(pH 8.5), 500 mM KCl, 25 mM MgCl₂With 1.0% Triton-X-100, solvent is ddH₂O；

Specifically, the method is as follows:

(1) apocarya blade to be measured is taken, liquid feeding nitrogen is ground, using the novel quick-speed plant extracting genome DNA of bioteke The operating instruction of kit extracts the genomic DNA of apocarya blade to be measured；

(2) genomic DNA extracted using step (1) is template, using the molecular specificity labeled primers as amplimer, Carry out PCR amplification:

The every 15 μ l composition of PCR reaction system is as follows:

2×TsingKE master mix 7.5μl

Each 0.2 μ l of 10 μM of upstream and downstream primers

20 ng/ μ l template DNA, 2 μ l

dd H₂O 4.3μl；

PCR reaction condition is as follows:

After 94 DEG C of initial denaturation 300s, 95 DEG C of denaturation 10s, 56 DEG C of annealing times 50s, 72 DEG C of extension 40s, circulation 30 times altogether, finally In 72 DEG C of filling-in 300s；Final temperature is 4 DEG C；

(3) 3 μ l of step (2) amplified production is taken, is mixed with 1 μ l, 0.25% bromjophenol blue buffer, point sample is solidifying in 1.5% agarose On glue, in 1 × TAE buffer, electrophoresis under 5V/cm voltage, EB is dyed after electrophoresis, on Yu Zidong gel image analysis instrument Photograph, if the DNA band of respectively 205bp, 260bp, 327bp size, thin shell mountain pecan Peach cultivars to be measured occurs in electrophoresis result For Sumner；It is on the contrary then no.

Detailed description of the invention

Fig. 1 is that (number 1-24 represents thin shell mountain pecan Peach cultivars by the result of 24 kinds of thin shell mountain pecan Peach cultivars progress PCR amplifications Successively are as follows: 1, Moore, 2, Dependable, 3, Nacono, 4, quiet state 1,5, Van Deman, 6, Sturat5,7, Forkert, 8, Desirable, 9, Davis, 10, Elliott, 11, Caddo, 12, Schley, 13, Choctaw, 14, Shaoxing, 15, Wichita, 16, Sumner, 17, Mahan, 18, Gloria Grande, 19, Peruque, 20, Sioux, 21, Pyzner, 22, Pawnee, 23, Osage, 24, Oconee)；M is Takara DL2000 marker；Only number 16 is apocarya product Kind Sumner has amplified 3 specific DNA bands of respectively 205bp, 260bp, 327bp size；Remaining number is other Thin shell mountain pecan Peach cultivars there are no the generation of specific DNA band.

Specific embodiment

The present invention is described further combined with specific embodiments below, but protection scope of the present invention is not limited in This:

Embodiment 1:

(1) extraction of apocarya variety genome DNA:

0.05 g of thin shell mountain pecan Peach cultivars young leaflet tablet to be measured is taken, liquid feeding nitrogen is thoroughly ground, and the extraction of genomic DNA uses The operating instruction of the novel quick-speed plant genome DNA extracting reagent kit of bioteke, is repeatedly extracted, to obtain apocarya The extracting genome DNA object of kind；DNA extract detected using 1.5% agarose gel electrophoresis integrality, purity and Concentration；Judge band brightness for subsequent PCR amplification；DNA extract is spare in -20 DEG C of refrigerator storages；

(2) specific PCR amplification primer, the sequence of primer pair are designed are as follows:

A: upstream primer: 5 '-AAGGGGCTTTGCAGATCCTC-3 '

Downstream primer: 5 '-ATCCAAGGCAGCTCTTCCAC-3 '

B: upstream primer: 5 '-TGGCATGCCCAACTTGATAGT-3 '

Downstream primer: 5 '-GCATGACCCTCGTTCGAGAA-3 '

C: upstream primer: 5 '-AGAGCCGATTCTTCCATGGT-3 '

Downstream primer: 5 '-ACCATTTGGATCTTCCCCATCA-3 '

By Shanghai, biotechnology Co., Ltd is synthesized；

(3) PCR amplification:

PCR reaction solution forms (15 μ l):

2 × TsingKE master mix master mix(holds up section's biology, Beijing) 7.5 μ l

Each 0.2 μ l of 10 μM of upstream and downstream primers

20 ng/ μ L template DNA, 2 μ l

dd H₂O 4.3μl；

Amplified reaction carries out on TC-XP type amplification instrument；Amplification condition: after 94 DEG C of initial denaturation 300s, 95 DEG C of denaturation 10s, 56 DEG C Annealing time 50s, 72 DEG C of extension 40s are recycled 30 times, altogether finally in 72 DEG C of filling-in 300s；Final temperature is 4 DEG C；

(4) electrophoresis detection: taking 3 μ l of step (3) pcr amplification product, with 1 μ l, 0.25% bromjophenol blue buffer mix, point sample in On 1.5% Ago-Gel, in 1 × TAE buffer, electrophoresis under 5V/cm voltage after electrophoresis, is containing 0.5 μ g/mL It dyes in the aqueous solution of EB 30 minutes, then takes a picture on Bio-rad gel imaging system Gel Doc；

To 24 thin shell mountain pecan Peach cultivars, (number 1-24 represents thin shell mountain pecan Peach cultivars and is followed successively by: 1, respectively according to the method described above Moore, 2, Dependable, 3, Nacono, 4, quiet state 1,5, Van Deman, 6, Sturat5,7, Forkert, 8, Desirable, 9, Davis, 10, Elliott, 11, Caddo, 12, Schley, 13, Choctaw, 14, Shaoxing, 15, Wichita, 16, Sumner, 17, Mahan, 18, Gloria Grande, 19, Peruque, 20, Sioux, 21, Pyzner, 22, Pawnee, 23, Osage, 24, Oconee) PCR amplification map carry out electrophoresis detection, the result is shown in Figure 1；

Three have wherein only been amplified from the thin shell mountain pecan Peach cultivars Sumner that number is 16 clear bright, stable is respectively The specific DNA band of 205bp, 260bp, 327bp, and the thin shell mountain pecan Peach cultivars of remaining number, there are no special DNA band and produce It is raw, there are not other non-purpose bands to generate, it is seen that the molecular specificity labeled primers that the present invention develops are to for shell mountain yet The early stage of Walnut Cultivars Sumner identifies that stability, specificity are very high.

SEQUENCE LISTING

<110>Zhejiang Prov. Forest Science Inst

<120>characteristic sequence of thin shell mountain pecan Peach cultivars Sumner, labeled primer and identification method

<130>

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 265

<212> DNA

<213> Carya illinoensis

<220>

<221> unsure

<400> 1

aattctgtac gcaaagttga cttgatctcc aatgaggagg agtggtcgat tgtccaaggg 60

gctttgcaga tcctcacagt tgcagattgt ttaacaagca ggtcttctgt ctttgagctt 120

ccttgagagc tacacttgct aggttgagca caagtttgtc tctttcagta tttggttcaa 180

gtctggacca aaatcagtca cattttgtca gtgatcatgg aactggggag ttgtctttgg 240

gtggaagagc tgccttggat gtggc 265

<210> 2

<211> 205

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 2

aaggggcttt gcagatcctc acagttgcag attgtttaac aagcaggtct tctgtctttg 60

agcttccttg agagctacac ttgctaggtt gagcacaagt ttgtctcttt cagtatttgg 120

ttcaagtctg gaccaaaatc agtcacattt tgtcagtgat catggaactg gggagttgtc 180

tttgggtgga agagctgcct tggat 205

<210> 3

<211> 20

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 3

aaggggcttt gcagatcctc 20

<210> 4

<211> 20

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 4

atccaaggca gctcttccac 20

<210> 5

<211> 319

<212> DNA

<213> Carya illinoensis

<220>

<221> unsure

<400> 5

aattcatcaa tgcaaatgct cagcttctct acaagctaac ctccaatttt cctgcatggc 60

atgcccaact tgatagtctt ggcattgggt atgatctcca gggtttcatc actggttccc 120

accagtgtcc tatactcgga agtaacccca ttcctaatgc cattgttgct cgcaatcgct 180

ggattcgcca agataaactt cttctatggc atttttgctt cagtttctaa aagcatcttg 240

cctttaattg ctatctcaag cacttcaaga gaagcttggc tcaaactaca caaattgttc 300

tcgaacgagg gtcatgcaa 319

<210> 6

<211> 260

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 6

tggcatgccc aacttgatag tcttggcatt gggtatgatc tccagggttt catcactggt 60

tcccaccagt gtcctatact cggaagtaac cccattccta atgccattgt tgctcgcaat 120

cgctggattc gccaagataa acttcttctt ggcatttttg cttcagtttc taaaagcatc 180

ttgcctttaa ttgctatctc aagcacttca agagaagctt ggctcaaact acacaaattg 240

ttctcgaacg agggtcatgc 260

<210> 7

<211> 21

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 7

tggcatgccc aacttgatag t 21

<210> 8

<211> 20

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 8

gcatgaccct cgttcgagaa 20

<210> 9

<211> 404

<212> DNA

<213> Carya illinoensis

<220>

<221> unsure

<400> 9

aattcattcc taataatctt cctaatagtg ttgtcaagag ccgattcttc catggttgag 60

gtaaacacta acactcgata ttcctagctg gtggagtctt tgactattat ccgacaagtt 120

caaaaagcac aacagaaggc tcaagagtcc ctgcaacagg tagtagatgg gttagctcaa 180

caattacagg tagtagctac taatatggaa aatatgattc ggcaagtggg caaaaagatg 240

gaggaaactc cagtgaaact ccagttggcc ctgttatgca cagtagcaac tccctttttg 300

atgacatagg tggcattcaa actaaagtag tatgtttgga gtttcctaaa tttgatgggg 360

aagatccaaa tggttggctt tataaagcca accaattctt tagc 404

<210> 10

<211> 327

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 10

agagccgatt cttccatggt tgaggtaaac actaacactc gatattccta gctggtggag 60

tctttgacta ttatccgaca agttcaaaaa gcacaacaga aggctcaaga gtccctgcaa 120

caggtagtag atgggttagc tcaacaatta caggtagtag ctactaatat ggaaaatatg 180

attcggcaag tgggcaaaaa gatggaggaa actccagttg gccctgttat gcacagtagc 240

aactcccttt ttgatgacat aggtggcatt caaactaaag tagtatgttt ggagtttcct 300

aaatttgatg gggaagatcc aaatggt 327

<210> 11

<211> 20

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 11

agagccgatt cttccatggt 20

<210> 12

<211> 22

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 12

accatttgga tcttccccat ca 22

Claims

1. the characteristic sequence group of thin shell mountain pecan Peach cultivars Sumner, sequence group are as follows:

5′-AATTCTGTACGCAAAGTTGACTTGATCTCCAATGAGGAGGAGTGGTCGATTGTCCAAGGGGCTTTGCAG ATCCTCACAGTTGCAGATTGTTTAACAAGCAGGTCTTCTGTCTTTGAGCTTCCTTGAGAGCTACACTTGCTAGGTT GAGCACAAGTTTGTCTCTTTCAGTATTTGGTTCAAGTCTGGACCAAAATCAGTCACATTTTGTCAGTGATCATGGA ACTGGGGAGTTGTCTTTGGGTGGAAGAGCTGCCTTGGATGTGGC-3′

5′-AATTCATCAATGCAAATGCTCAGCTTCTCTACAAGCTAACCTCCAATTTTCCTGCATGGCATGCCCAAC TTGATAGTCTTGGCATTGGGTATGATCTCCAGGGTTTCATCACTGGTTCCCACCAGTGTCCTATACTCGGAAGTAA CCCCATTCCTAATGCCATTGTTGCTCGCAATCGCTGGATTCGCCAAGATAAACTTCTTCTATGGCATTTTTGCTTC AGTTTCTAAAAGCATCTTGCCTTTAATTGCTATCTCAAGCACTTCAAGAGAAGCTTGGCTCAAACTACACAAATTG TTCTCGAACGAGGGTCATGCAA-3′

5′-AATTCATTCCTAATAATCTTCCTAATAGTGTTGTCAAGAGCCGATTCTTCCATGGTTGAGGTAAACACT AACACTCGATATTCCTAGCTGGTGGAGTCTTTGACTATTATCCGACAAGTTCAAAAAGCACAACAGAAGGCTCAAG AGTCCCTGCAACAGGTAGTAGATGGGTTAGCTCAACAATTACAGGTAGTAGCTACTAATATGGAAAATATGATTCG GCAAGTGGGCAAAAAGATGGAGGAAACTCCAGTGAAACTCCAGTTGGCCCTGTTATGCACAGTAGCAACTCCCTTT TTGATGACATAGGTGGCATTCAAACTAAAGTAGTATGTTTGGAGTTTCCTAAATTTGATGGGGAAGATCCAAATGG TTGGCTTTATAAAGCCAACCAATTCTTTAGC-3′。

2. the molecular specificity labeled primers group of thin shell mountain pecan Peach cultivars Sumner, the primer sequence are as follows:

1) upstream primer: 5 '-AAGGGGCTTTGCAGATCCTC-3 '

Downstream primer: 5 '-ATCCAAGGCAGCTCTTCCAC-3 '

2) upstream primer: 5 '-TGGCATGCCCAACTTGATAGT-3 '

Downstream primer: 5 '-GCATGACCCTCGTTCGAGAA-3 '

3) upstream primer: 5 '-AGAGCCGATTCTTCCATGGT-3 '

Downstream primer: 5 '-ACCATTTGGATCTTCCCCATCA-3 '.

3. a kind of carry out quickly thin shell mountain pecan Peach cultivars Sumner using molecular specificity labeled primers as claimed in claim 2 The method of identification, the method are as follows: extract the genomic DNA of thin shell mountain pecan Peach cultivars blade to be measured as template, with described point Sub- specificity labeled primers carry out PCR amplification as amplimer, electrophoresis detection are carried out to amplified production, if electrophoresis result is same When occur be respectively 205bp, 260bp, 3 specific DNA bands of 327bp size, then thin shell mountain pecan Peach cultivars to be measured be shell Hickory nut kind is Sumner, on the contrary then no；The molecular specificity labeled primers group sequence are as follows:

1) upstream primer: 5 '-AAGGGGCTTTGCAGATCCTC-3 '

Downstream primer: 5 '-ATCCAAGGCAGCTCTTCCAC-3 '

2) upstream primer: 5 '-TGGCATGCCCAACTTGATAGT-3 '

Downstream primer: 5 '-GCATGACCCTCGTTCGAGAA-3 '

3) upstream primer: 5 '-AGAGCCGATTCTTCCATGGT-3 '

Downstream primer: 5 '-ACCATTTGGATCTTCCCCATCA-3 '.

4. method as claimed in claim 3, it is characterised in that the PCR amplification condition is as follows: after 94 DEG C of initial denaturation 300s, 95 DEG C denaturation 10s, 56 DEG C of annealing times 50s, 72 DEG C of extensions 40s, altogether circulation 30 times, finally in 72 DEG C of filling-in 300s；Final temperature It is 4 DEG C.

5. the method as described in claim 3,4, it is characterised in that the method is as follows:

(1) apocarya blade to be measured is taken, liquid feeding nitrogen is ground, and the extraction of genomic DNA uses the novel quick-speed plant of bioteke The operating instruction of genome DNA extracting reagent kit；

(2) genomic DNA extracted using step (1) is template, using the molecular specificity labeled primers as amplimer, into Row PCR amplification:

The every 15 μ l composition of PCR reaction system is as follows:

2×TsingKE master mix 7.5μl

Each 0.2 μ l of 10 μM of upstream and downstream primers

20 ng/ μ l template DNA, 2 μ l

dd H2O 4.3μl；

PCR amplification condition is as follows:

(3) 3 μ l of step (2) amplified production is taken, is mixed with 1 μ l, 0.25% bromjophenol blue buffer, point sample is solidifying in 1.5% agarose On glue, in 1 × TAE buffer, electrophoresis under 5V/cm voltage, EB is dyed after electrophoresis, and Yu Zidong gel imaging system can photograph well Phase, if 3 DNA bands of respectively 205bp, 260bp, 327bp size, apocarya to be measured occurs simultaneously in electrophoresis result Kind is Sumner, on the contrary then no.