CN109652588A

CN109652588A - Characteristic sequence, labeled primer and the identification method of thin shell mountain pecan Peach cultivars Elliott

Info

Publication number: CN109652588A
Application number: CN201910148146.3A
Authority: CN
Inventors: 不公告发明人
Original assignee: Zhejiang Academy of Forestry
Current assignee: Zhejiang Academy of Forestry
Priority date: 2019-02-28
Filing date: 2019-02-28
Publication date: 2019-04-19
Anticipated expiration: 2039-02-28
Also published as: CN109652588B

Abstract

The present invention relates to the high specific characteristic sequence of multipair thin shell mountain pecan Peach cultivars Elliott, molecular specificity labeled primers and it is a kind of can be to the method that thin shell mountain pecan Peach cultivars Elliott is quickly and accurately identified.The molecular specificity labeled primers group sequence is as follows: 1) upstream primer: 5 '-TCATGAGACCCACCTTGCAC-3 ' downstream primer: 5 '-GGAATGTTGACCAAGCGAGC-3 ' 2) upstream primer: 5 '-TGAGACTCTGTTTCGTACTTTCGA-3 ' downstream primer: 5 '-ACAGGAAGAGTGTGCAGCAA-3 ' 3) upstream primer: 5 '-TCTCCATGAGCAACAGCAGT-3 ' downstream primer: 5 '-GCGTCTTCGTAAGCTCACCA-3 ' molecular specificity labeled primers of the present invention can carry out quick Early Identification to thin shell mountain pecan Peach cultivars Elliott, method is simple, It fast, is accurately, that appearance features distinguish the irreplaceable Molecular tools of thin shell mountain pecan Peach cultivars.

Description

Characteristic sequence, labeled primer and the identification method of thin shell mountain pecan Peach cultivars Elliott

Technical field

The present invention relates to the characteristic sequence of thin shell mountain pecan Peach cultivars Elliott, molecular specificity labeled primers combination and The method that specificity identification is carried out to thin shell mountain pecan Peach cultivars Elliott using molecular specificity labeled primers combination.

Background technique

Apocarya (Carya illino nsis (Wangenh.) K.Koch) is that most have in Juglandaceae hickory The tree species of economic value.Apocarya is typical outcrossing plant, and existing production practices discovery, the kind of apocarya is matched Setting is one of the principal element for influencing its yield；The U.S. is one of source area of apocarya and center producing region, many years Come, cultivar about 1000 of U.S.'s breeding name；China introduces a fine variety apocarya and has more than 100 years history, raw at present Common kind has tens in production, and the production practices of many years prove that the vast subtropical zone in China is the adaptability of apocarya Area；

But the main problem that faces of the existing apocarya producing region in China is under low output, is unstable, causes this phenomenon Reason has many aspects, one of them is exactly that the existing kind introduced still lacks specific Genetic relationship, along with The confusion that filial generation is named causes to be difficult to carry out effective Juvenile stage and reasonable disposition, be not easy to cultivar identification, popularization, Exchange and the cultivation of new varieties, thus put forth effort to develop some stabilizations from molecular level, special DNA varieties systematics label is Realize the Scientific Approaches of the accurate Rapid identification of thin shell mountain pecan Peach cultivars；

Some molecule labelling methods for apocarya cultivar identification and Genetic relationship have been reported both at home and abroad, it is relatively good Have SSR molecular marker method, but these old detection methods are relatively complicated, and unstable result.

Summary of the invention

The object of the present invention is to provide the characteristic sequences of thin shell mountain pecan Peach cultivars Elliott, molecular specificity labeled primers Combination and the side for carrying out specificity identification to thin shell mountain pecan Peach cultivars Elliott using molecular specificity labeled primers combination Method；

The technical solution adopted by the present invention is that:

The characteristic sequence group of thin shell mountain pecan Peach cultivars Elliott, sequence group are as follows:

1)5′-AATTCTTGCGTTCATTTCTTTACATTCTAGAGTAATTGTTGATCGGGTTATTAGGTGTTCCTTGACA CCATCACCATCAAACCACCAAATCTATCCAGATCTATAGTGAGACCAAATCTATCCAGATCTATAGTGAGAGCCAC CCAGACCACCCAAATCTGTCATGAGACCCACCTTGCACGGAGGAAATTTCTTAACCACTGTAAGCTATGAGCTGGT TTGACAACCTACATTGTTCTTCAAATCTAAGCCGCTTCATTGCCGGCCTTCTCGTCTTCATTCTCTATCATTCATT CCAATTCATTTCCAATTTCTTGATTTCTACACACCCTTCAAATAAATCCTTATAATCGCTCGCTTGGTCAACATTC CTAGCAAATTTAGATTCCAATTTCTCT-3′

2)5′-AATTCCTATATTTGAGACTCTGTTTCGTACTTTCGAATCTTCACAACATTATCATTAATGTCATATA TTGCTAGTATCAGAATATGGGTTGCTCTAGGAAATATTGCATCCAAAACATAATCTTATTAGAAATTAGATAACAG AATAAACTTCCACACTGAATTGCTTGCAGGATCATTTGAAGTTATGTTTATATATGCTATTGGATACGAACTCAAT ATTCTGAATTTTGATAATATCGTTTTGGAAACAGCTTTTGTTTTGCTGCACACTCTTCCTGTTCTGTACGAGAAGT ATGAGGACAAGGTTGATCCATTTGCAGAGAAGGCGATGA-3′

3)5′-AATTCGATGCCACTTGTTGCAAACTTCATAATGTTCTCCATGAGCAACAGCAGTTGTATTCAAATGA GGCTGTTCTCTATATTTGTGTCTGAGCATTCTGTATTTAGTTTTTTTTATTTTTCTCCCTTCCATATACAAGTGCT TAGAAGTTGTTATCATCTCTTTTGGAATAGTTTCAAATTATGTATATAATGGGTTATTAATAGTTGTACTTATAAA AAAAAGTCTTTATTAATAGTTGTAATTTTTTACTTTGACTCTCTGTTATATGTGTACCTTCATTATAAGTGCTCTT GTTTTAGTGATCCAAGGAGCTAGGTGATAACTGTGATATTTGAGAGAAGTGACCAAGTAAAGCGGTGTACGTTAAT TGAAAATTTTGAGTCAAAACATGGTGAGCTTACGAAGACGCAAG-3′

The invention further relates to the molecular specificity labeled primers group of thin shell mountain pecan Peach cultivars Elliott, the primer sequences are as follows:

1) upstream primer: 5 '-TCATGAGACCCACCTTGCAC-3 '

Downstream primer: 5 '-GGAATGTTGACCAAGCGAGC-3 '

2) upstream primer: 5 '-TGAGACTCTGTTTCGTACTTTCGA-3 '

Downstream primer: 5 '-ACAGGAAGAGTGTGCAGCAA-3 '

3) upstream primer: 5 '-TCTCCATGAGCAACAGCAGT-3 '

Downstream primer: 5 '-GCGTCTTCGTAAGCTCACCA-3 '

The source of above-mentioned 3 pairs of primers combination: firstly, filtering out biggish 5 kinds of Traits change from 24 common kinds It carries out simplifying gene order-checking and comparative analysis；Then, based on the analysis results design 1000 multipair primers, in 24 samples into Row screening and verifying, obtain the DNA fragment specific of thin shell mountain pecan Peach cultivars Elliott；Then, by the segment cloning and sequencing, Using the secondary screening of repeatability sampling more than three times, the molecular specificity labeled primers finally obtained are combined；With above-mentioned specificity Primer combination carries out PCR amplification to thin shell mountain pecan Peach cultivars, and it is respectively 211bp, 269bp, 378bp that only Elliott, which can get 3, One specific fragment of size, other thin shell mountain pecan Peach cultivars cannot obtain the specific fragment for selecting primer combination；It needs It is noted that molecular specificity labeled primers combination of the invention is only limitted to the identification of thin shell mountain pecan Peach cultivars, i.e., to test sample Product are only limitted to apocarya；

For features described above sequence, 3 pairs of specific primers of design, 3 products expanded are respectively as follows:

1)211bp:5′-TCATGAGACCCACCTTGCACGGAGGAAATTTCTTAACCACTGTAAGCTATGAGCTGGTTTG ACAACCTACATTGTTCTTCAAATCTAAGCCGCTTCATTGCCGGCCTTCTCGTCTTCATTCTCTATCATTCATTCCA ATTCATTTCCAATTTCTTGATTTCTACACACCCTTCAAATAAATCCTTATAATCGCTCGCTTGGTCAACATTCC-3′

2)269bp:5′-AATTCCTATATTTGAGACTCTGTTTCGTACTTTCGAATCTTCACAACATTATCATTAATGT CATATATTGCTAGTATCAGAATATGGGTTGCTCTAGGAAATATTGCATCCAAAACATAATCTTATTAGAAATTAGA TAACAGAATAAACTTCCACACTGAATTGCTTGCAGGATCATTTGAAGTTATGTTTATATATGCTATTGGATACGAA CTCAATATTCTGAATTTTGATAATATCGTTTTGGAAACAGCTTTTGTTTTGCTAAT-3′

3)378bp:5′-TCTCCATGAGCAACAGCAGTTGTATTCAAATGAGGCTGTTCTCTATATTTGTGTCTGAGCA TTCTGTATTTAGTTTTTTTTATTTTTCTCCCTTCCATATACAAGTGCTTAGAAGTTGTTATCATCTCTTTTGGAAT AGTTTCAAATTATGTATATAATGGGTTATTAATAGTTGTACTTATAAAAAAAAGTCTTTATTAATAGTTGTAATTT TTTACTTTGACTCTCTGTTATATGTGTACCTTCATTATAAGTGCTCTTGTTTTAGTGATCCAAGGAGCTAGGTGAT AACTGTGATATTTGAGAGAAGTGACCAAGTAAAGCGGTGTACGTTAATTGAAAATTTTGAGTCAAAACATGGTGAG CTTACGAAGACGC-3′

Elliott was the kind that H. Elliot was brought out in the seedling tree of Florida State in 1912, in 1919 It promotes；Tree management is good, and growth potential is prosperous, sprouts morning, vulnerable to cold spell in spring freeze injury.Female flower is first, and the florescence is early, in the male flower florescence；Nut ovum Circle, middle small fruit type, top is sharp and bottom is relatively round, and nut shell color is shallow, mean fruit weight 5.7g or so；Kernel is golden yellow, Quality is high, can fresh eating, back main groove is wide, and base portion crack is deep；

The invention further relates to a kind of using the molecular specificity labeled primers combination, to thin shell mountain pecan Peach cultivars Elliott The method for carrying out Rapid identification；The method are as follows: extract the genomic DNA of the blade of thin shell mountain pecan Peach cultivars to be measured as mould Plate carries out PCR amplification using the molecular specificity labeled primers group as amplimer, carries out electrophoresis detection to amplified production, If there are 3 DNA bands of respectively 211bp, 269bp, 378bp size, apocarya product to be measured simultaneously in electrophoresis result Kind is thin shell mountain pecan Peach cultivars Elliott, on the contrary then no；The molecular specificity labeled primers sequence are as follows:

1) upstream primer: 5 '-TCATGAGACCCACCTTGCAC-3 '

Downstream primer: 5 '-GGAATGTTGACCAAGCGAGC-3 '

2) upstream primer: 5 '-TGAGACTCTGTTTCGTACTTTCGA-3 '

Downstream primer: 5 '-ACAGGAAGAGTGTGCAGCAA-3 '

3) upstream primer: 5 '-TCTCCATGAGCAACAGCAGT-3 '

Downstream primer: 5 '-GCGTCTTCGTAAGCTCACCA-3 '

The method of the present invention key is the selection of amplimer combination, and DNA is extracted, and PCR reaction system and reaction condition determine, with And electrophoresis detection, it can be carried out according to conventional method in that art；

The method of the present invention is compared with the molecule labelling method of existing thin shell mountain pecan Peach cultivars, such as SSR labeling method, has following excellent Point: (1) because the primer is verified through sequencing and repeatedly, therefore reliability improves very much；(2) easy to detect, intuitive, it is directly logical Crossing the combination of the presence or absence of general electrophoresis observation band can determine whether, and also need to utilize high score after expanding if applying SSR marker method Resolution electrophoresis is further analyzed or is sequenced；(3) lower to the requirement of sample, the DNA sample of the tissues such as blade can satisfy The needs of cultivar identification；

The currently preferred PCR amplification system composition is as follows:

PCR Buffer final concentration of 1 ×

dNTPs 1 mmol/L

MgCl₂ 2.5 mmol/L

1.0 U/ of Taq enzyme reaction

Each 0.2 μM of upstream and downstream primer

60 ng/ of template DNA reaction

Surplus is ddH₂O；

The PCR amplification condition is as follows: after 94 DEG C of initial denaturation 300s, 95 DEG C of denaturation 10s, 56 DEG C of annealing time 50s, 72 DEG C extend 40s is recycled 30 times, altogether finally in 72 DEG C of filling-in 300s；Final temperature is 4 DEG C；

PCR Buffer final concentration of 1 ×, refer to the concentration of each component in the reaction system and 1 × PCR in PCR Buffer Buffer is identical, and usually selecting volume is 10 × PCR Buffer of reaction system volume 1/10；10 × PCR Buffer ingredient Are as follows: 100 mM Tris-HCl(pH 8.5), 500 mM KCl, 25 mM MgCl₂With 1.0% Triton-X-100, solvent is ddH₂O；

Specifically, the method is as follows:

(1) apocarya blade to be measured is taken, liquid feeding nitrogen is ground, and is tried using the novel quick-speed plant extracting genome DNA of bioteke The operating instruction of agent box extracts the genomic DNA of apocarya blade to be measured；

(2) genomic DNA extracted using step (1) is template, using the molecular specificity labeled primers as amplimer, into Row PCR amplification:

The every 15 μ L composition of PCR reaction system is as follows:

2×TsingKE master mix 7.5μl

Each 0.2 μ l of 10 μM of upstream and downstream primers

20 ng/ μ l template DNA, 2 μ l

dd H₂O 4.3μl；

PCR reaction condition is as follows:

After 94 DEG C of initial denaturation 300s, 95 DEG C of denaturation 10s, 56 DEG C of annealing times 50s, 72 DEG C of extension 40s, circulation 30 times altogether, finally In 72 DEG C of filling-in 300s；Final temperature is 4 DEG C；

(3) 3 μ l of step (2) amplified production is taken, is mixed with 1 μ l, 0.25% bromjophenol blue buffer, point sample is solidifying in 1.5% agarose On glue, in 1 × TAE buffer, electrophoresis under 5V/cm voltage, EB is dyed after electrophoresis, on Yu Zidong gel image analysis instrument Photograph, if electrophoresis result appearance 3 is respectively a DNA band of 211bp, 269bp, 378bp, apocarya product to be measured Kind is Elliott；It is on the contrary then no.

Detailed description of the invention

Fig. 1 is that (number 1-24 represents thin shell mountain pecan Peach cultivars by the result of 24 kinds of thin shell mountain pecan Peach cultivars progress PCR amplifications Successively are as follows: 1, Moore, 2, Dependable, 3, Nacono, 4, quiet state 1,5, Van Deman, 6, Sturat5,7, Forkert, 8, Desirable, 9, Davis, 10, Elliott, 11, Caddo, 12, Schley, 13, Choctaw, 14, Shaoxing, 15, Wichita, 16, Sumner, 17, Mahan, 18, Gloria Grande, 19, Peruque, 20, Sioux, 21, Pyzner, 22, Pawnee, 23, Osage, 24, Oconee)；M is Takara DL2000 marker；Only number 10 is apocarya product Kind Elliott has amplified 3 specific DNA bands of respectively 211bp, 269bp, 378bp size；Remaining number is other Thin shell mountain pecan Peach cultivars there are no the generation of specific DNA band.

Specific embodiment

The present invention is described further combined with specific embodiments below, but protection scope of the present invention is not limited in This:

Embodiment 1:

(1) extraction of apocarya variety genome DNA:

0.05 g of thin shell mountain pecan Peach cultivars young leaflet tablet to be measured is taken, liquid feeding nitrogen is thoroughly ground, and the extraction of genomic DNA uses The operating instruction of the novel quick-speed plant genome DNA extracting reagent kit of bioteke, is repeatedly extracted, to obtain apocarya The extracting genome DNA object of kind.DNA extract detected using 1.5% agarose gel electrophoresis integrality, purity and Concentration；Judge band brightness for subsequent PCR amplification；DNA extract is spare in -20 DEG C of refrigerator storages；

(2) specific PCR amplification primer, the sequence of primer pair are designed are as follows:

A: upstream primer: 5 '-TCATGAGACCCACCTTGCAC-3 '

Downstream primer: 5 '-GGAATGTTGACCAAGCGAGC-3 '

B: upstream primer: 5 '-TGAGACTCTGTTTCGTACTTTCGA-3 '

Downstream primer: 5 '-ACAGGAAGAGTGTGCAGCAA-3 '

C: upstream primer: 5 '-TCTCCATGAGCAACAGCAGT-3 '

Downstream primer: 5 '-GCGTCTTCGTAAGCTCACCA-3 '

By Shanghai, biotechnology Co., Ltd is synthesized；

(3) PCR amplification:

PCR reaction solution forms (15 μ l):

2 × TsingKE master mix master mix(holds up section's biology, Beijing) 7.5 μ l

Each 0.2 μ l of 10 μM of upstream and downstream primers

20 ng/ μ l template DNA, 2 μ l

dd H₂O 4.3μl；

Amplified reaction carries out on TC-XP type amplification instrument.Amplification condition: after 94 DEG C of initial denaturation 300s, 95 DEG C of denaturation 10s, 56 DEG C Annealing time 50s, 72 DEG C of extension 40s are recycled 30 times, altogether finally in 72 DEG C of filling-in 300s；Final temperature is 4 DEG C；

(4) electrophoresis detection: taking 3 μ l of step (3) pcr amplification product, with 1 μ l, 0.25% bromjophenol blue buffer mix, point sample in On 1.5% Ago-Gel, in 1 × TAE buffer, electrophoresis under 5V/cm voltage after electrophoresis, is containing 0.5 μ g/ml It dyes in the aqueous solution of EB 30 minutes, then takes a picture on Bio-rad gel imaging system Gel Doc；

To 24 thin shell mountain pecan Peach cultivars, (number 1-24 represents thin shell mountain pecan Peach cultivars and is followed successively by: 1, respectively according to the method described above Moore, 2, Dependable, 3, Nacono, 4, quiet state 1,5, Van Deman, 6, Sturat5,7, Forkert, 8, Desirable, 9, Davis, 10, Elliott, 11, Caddo, 12, Schley, 13, Choctaw, 14, Shaoxing, 15, Wichita, 16, Sumner, 17, Mahan, 18, Gloria Grande, 19, Peruque, 20, Sioux, 21, Pyzner, 22, Pawnee, 23, Osage, 24, Oconee) PCR amplification map carry out electrophoresis detection, the result is shown in Figure 1；

Three clear bright, stable difference have wherein only been amplified from the thin shell mountain pecan Peach cultivars Elliott that number is 10 For the specific DNA band of 211bp, 269bp, 378bp, and the thin shell mountain pecan Peach cultivars of remaining number, it there are no special DNA band It generates, does not also there are other non-purpose bands to generate, it is seen that the molecular specificity labeled primers that the present invention develops are to for shell The early stage of hickory nut kind Elliott identifies that stability, specificity are very high.

SEQUENCE LISTING

<110>Zhejiang Prov. Forest Science Inst

<120>characteristic sequence of thin shell mountain pecan Peach cultivars Elliott, labeled primer and identification method

<130>

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 398

<212> DNA

<213> Carya illinoensis

<220>

<221> unsure

<400> 1

aattcttgcg ttcatttctt tacattctag agtaattgtt gatcgggtta ttaggtgttc 60

cttgacacca tcaccatcaa accaccaaat ctatccagat ctatagtgag accaaatcta 120

tccagatcta tagtgagagc cacccagacc acccaaatct gtcatgagac ccaccttgca 180

cggaggaaat ttcttaacca ctgtaagcta tgagctggtt tgacaaccta cattgttctt 240

caaatctaag ccgcttcatt gccggccttc tcgtcttcat tctctatcat tcattccaat 300

tcatttccaa tttcttgatt tctacacacc cttcaaataa atccttataa tcgctcgctt 360

ggtcaacatt cctagcaaat ttagattcca atttctct 398

<210> 2

<211> 211

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 2

tcatgagacc caccttgcac ggaggaaatt tcttaaccac tgtaagctat gagctggttt 60

gacaacctac attgttcttc aaatctaagc cgcttcattg ccggccttct cgtcttcatt 120

ctctatcatt cattccaatt catttccaat ttcttgattt ctacacaccc ttcaaataaa 180

tccttataat cgctcgcttg gtcaacattc c 211

<210> 3

<211> 20

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 3

tcatgagacc caccttgcac 20

<210> 4

<211> 20

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 4

ggaatgttga ccaagcgagc 20

<210> 5

<211> 334

<212> DNA

<213> Carya illinoensis

<220>

<221> unsure

<400> 5

aattcctata tttgagactc tgtttcgtac tttcgaatct tcacaacatt atcattaatg 60

tcatatattg ctagtatcag aatatgggtt gctctaggaa atattgcatc caaaacataa 120

tcttattaga aattagataa cagaataaac ttccacactg aattgcttgc aggatcattt 180

gaagttatgt ttatatatgc tattggatac gaactcaata ttctgaattt tgataatatc 240

gttttggaaa cagcttttgt tttgctgcac actcttcctg ttctgtacga gaagtatgag 300

gacaaggttg atccatttgc agagaaggcg atga 334

<210> 6

<211> 269

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 6

aattcctata tttgagactc tgtttcgtac tttcgaatct tcacaacatt atcattaatg 60

tcatatattg ctagtatcag aatatgggtt gctctaggaa atattgcatc caaaacataa 120

tcttattaga aattagataa cagaataaac ttccacactg aattgcttgc aggatcattt 180

gaagttatgt ttatatatgc tattggatac gaactcaata ttctgaattt tgataatatc 240

gttttggaaa cagcttttgt tttgctaat 269

<210> 7

<211> 24

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 7

tgagactctg tttcgtactt tcga 24

<210> 8

<211> 20

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 8

acaggaagag tgtgcagcaa 20

<210> 9

<211> 415

<212> DNA

<213> Carya illinoensis

<220>

<221> unsure

<400> 9

aattcgatgc cacttgttgc aaacttcata atgttctcca tgagcaacag cagttgtatt 60

caaatgaggc tgttctctat atttgtgtct gagcattctg tatttagttt tttttatttt 120

tctcccttcc atatacaagt gcttagaagt tgttatcatc tcttttggaa tagtttcaaa 180

ttatgtatat aatgggttat taatagttgt acttataaaa aaaagtcttt attaatagtt 240

gtaatttttt actttgactc tctgttatat gtgtaccttc attataagtg ctcttgtttt 300

agtgatccaa ggagctaggt gataactgtg atatttgaga gaagtgacca agtaaagcgg 360

tgtacgttaa ttgaaaattt tgagtcaaaa catggtgagc ttacgaagac gcaag 415

<210> 10

<211> 378

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 10

tctccatgag caacagcagt tgtattcaaa tgaggctgtt ctctatattt gtgtctgagc 60

attctgtatt tagttttttt tatttttctc ccttccatat acaagtgctt agaagttgtt 120

atcatctctt ttggaatagt ttcaaattat gtatataatg ggttattaat agttgtactt 180

ataaaaaaaa gtctttatta atagttgtaa ttttttactt tgactctctg ttatatgtgt 240

accttcatta taagtgctct tgttttagtg atccaaggag ctaggtgata actgtgatat 300

ttgagagaag tgaccaagta aagcggtgta cgttaattga aaattttgag tcaaaacatg 360

gtgagcttac gaagacgc 378

<210> 11

<211> 20

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 11

tctccatgag caacagcagt 20

<210> 12

<211> 20

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 12

gcgtcttcgt aagctcacca 20

Claims

1. the characteristic sequence group of thin shell mountain pecan Peach cultivars Elliott, sequence group are as follows:

3)5′-AATTCGATGCCACTTGTTGCAAACTTCATAATGTTCTCCATGAGCAACAGCAGTTGTATTCAAATGA GGCTGTTCTCTATATTTGTGTCTGAGCATTCTGTATTTAGTTTTTTTTATTTTTCTCCCTTCCATATACAAGTGCT TAGAAGTTGTTATCATCTCTTTTGGAATAGTTTCAAATTATGTATATAATGGGTTATTAATAGTTGTACTTATAAA AAAAAGTCTTTATTAATAGTTGTAATTTTTTACTTTGACTCTCTGTTATATGTGTACCTTCATTATAAGTGCTCTT GTTTTAGTGATCCAAGGAGCTAGGTGATAACTGTGATATTTGAGAGAAGTGACCAAGTAAAGCGGTGTACGTTAAT TGAAAATTTTGAGTCAAAACATGGTGAGCTTACGAAGACGCAAG-3′。

2. the molecular specificity labeled primers group of thin shell mountain pecan Peach cultivars Elliott, the primer sequence are as follows:

1) upstream primer: 5 '-TCATGAGACCCACCTTGCAC-3 '

Downstream primer: 5 '-GGAATGTTGACCAAGCGAGC-3 '

2) upstream primer: 5 '-TGAGACTCTGTTTCGTACTTTCGA-3 '

Downstream primer: 5 '-ACAGGAAGAGTGTGCAGCAA-3 '

3) upstream primer: 5 '-TCTCCATGAGCAACAGCAGT-3 '

Downstream primer: 5 '-GCGTCTTCGTAAGCTCACCA-3 '.

3. a kind of carry out fastly thin shell mountain pecan Peach cultivars Elliott using molecular specificity labeled primers as claimed in claim 2 The method of speed identification, the method are as follows: extract the genomic DNA of thin shell mountain pecan Peach cultivars blade to be measured as template, with described Molecular specificity labeled primers carry out PCR amplification as amplimer, electrophoresis detection are carried out to amplified production, if electrophoresis result Occur 3 specific DNA bands of respectively 211bp, 269bp, 378bp size simultaneously, then thin shell mountain pecan Peach cultivars to be measured are thin Shell hickory nut kind Elliott, it is on the contrary then no；The molecular specificity labeled primers group sequence are as follows:

1) upstream primer: 5 '-TCATGAGACCCACCTTGCAC-3 '

Downstream primer: 5 '-GGAATGTTGACCAAGCGAGC-3 '

2) upstream primer: 5 '-TGAGACTCTGTTTCGTACTTTCGA-3 '

Downstream primer: 5 '-ACAGGAAGAGTGTGCAGCAA-3 '

3) upstream primer: 5 '-TCTCCATGAGCAACAGCAGT-3 '

Downstream primer: 5 '-GCGTCTTCGTAAGCTCACCA-3 '.

4. method as claimed in claim 3, it is characterised in that the PCR amplification condition is as follows: after 94 DEG C of initial denaturation 300s, 95 DEG C denaturation 10s, 56 DEG C of annealing times 50s, 72 DEG C of extensions 40s, altogether circulation 30 times, finally in 72 DEG C of filling-in 300s；Final temperature It is 4 DEG C.

5. the method as described in claim 3,4, it is characterised in that the method is as follows:

Apocarya blade to be measured is taken, liquid feeding nitrogen is ground, and the extraction of genomic DNA uses the novel quick-speed plant base of bioteke Because of the operating instruction of group DNA extraction kit；

The genomic DNA extracted using step (1) is template, using the molecular specificity labeled primers as amplimer, carries out PCR amplification:

The every 15 μ l composition of PCR reaction system is as follows:

2×TsingKE master mix 7.5μl

Each 0.2 μ l of 10 μM of upstream and downstream primers

20 ng/ μ l template DNA, 2 μ l

dd H2O 4.3μl；

PCR amplification condition is as follows:

3 μ l of step (2) amplified production is taken, is mixed with 1 μ l, 0.25% bromjophenol blue buffer, point sample is in 1.5% Ago-Gel On, in 1 × TAE buffer, electrophoresis under 5V/cm voltage, EB is dyed after electrophoresis, and Yu Zidong gel imaging system can photograph well Phase, if 3 DNA bands of respectively 211bp, 269bp, 378bp size, apocarya to be measured occurs simultaneously in electrophoresis result Kind is Elliott, on the contrary then no.