CN109652589A

CN109652589A - Characteristic sequence, labeled primer and the identification method of thin shell mountain pecan Peach cultivars Gloria Grande

Info

Publication number: CN109652589A
Application number: CN201910148147.8A
Authority: CN
Inventors: 不公告发明人
Original assignee: Zhejiang Academy of Forestry
Current assignee: Zhejiang Academy of Forestry
Priority date: 2019-02-28
Filing date: 2019-02-28
Publication date: 2019-04-19
Anticipated expiration: 2039-02-28
Also published as: CN109652589B

Abstract

The present invention relates to the multipair high specific characteristic sequence of thin shell mountain pecan Peach cultivars Gloria Grande, molecular specificity labeled primers and it is a kind of can be to the method that thin shell mountain pecan Peach cultivars Gloria Grande is quickly and accurately identified.The molecular specificity labeled primers group sequence is as follows: 1) upstream primer: 5 '-AGTCAGAGTCGGAGTCGGAT-3 ' downstream primer: 5 '-AGCCTAGCCTTGCAACCTTT-3 ' 2) upstream primer: 5 '-AGATGCGAGCCAAAGTCCAA-3 ' downstream primer: 5 '-TGGTGTGTTTGTGTGTGGTTG-3 ' 3) upstream primer: 5 '-TCATGGGCGTAAAGGACAGT-3 ' downstream primer: 5 '-GTGAACACAAATGCAGAGCTGT-3 ' molecular specificity labeled primers of the present invention can carry out quick Early Identification to thin shell mountain pecan Peach cultivars Gloria Grande Method is simple, quick, accurate, is that appearance features distinguish the irreplaceable Molecular tools of thin shell mountain pecan Peach cultivars.

Description

Characteristic sequence, labeled primer and the identification of thin shell mountain pecan Peach cultivars Gloria Grande Method

Technical field

The present invention relates to the characteristic sequences of thin shell mountain pecan Peach cultivars Gloria Grande, molecular specificity labeled primers group It closes and specificity identification is carried out to thin shell mountain pecan Peach cultivars Gloria Grande using molecular specificity labeled primers combination Method.

Background technique

Apocarya (Carya illino nsis (Wangenh.) K.Koch) is that most have in Juglandaceae hickory The tree species of economic value；Apocarya is typical outcrossing plant, and existing production practices discovery, the kind of apocarya is matched Setting is one of the principal element for influencing its yield；The U.S. is one of source area of apocarya and center producing region, many years Come, cultivar about 1000 of U.S.'s breeding name；China introduces a fine variety apocarya and has more than 100 years history, raw at present Common kind has tens in production, and the production practices of many years prove that the vast subtropical zone in China is the adaptability of apocarya Area；

But the main problem that the existing apocarya producing region in China faces is under low output and unstable；Cause this phenomenon The reason of have many aspects, one of them is exactly that the kind of existing introduction still lacks specific Genetic relationship, adds one The confusion that a little filial generations are named, causes to be difficult to carry out effective Juvenile stage and reasonable disposition, is not easy to cultivar identification, pushes away Extensively, the cultivation of exchange and new varieties, thus put forth effort to develop some stable varieties from molecular level, special DNA kind refers to Line label is the Scientific Approaches for realizing the accurate Rapid identification of thin shell mountain pecan Peach cultivars；

Some molecule labelling methods for apocarya cultivar identification and Genetic relationship have been reported both at home and abroad, it is relatively good Have SSR molecular marker method, but these old detection methods are relatively complicated, and unstable result.

Summary of the invention

It is an object of the present invention to provide characteristic sequence, the molecular specificity markers of thin shell mountain pecan Peach cultivars Gloria Grande Primer is combined and is carried out using molecular specificity labeled primers combination to thin shell mountain pecan Peach cultivars Gloria Grande special Property identification method；

The technical solution adopted by the present invention is that:

The characteristic sequence group of thin shell mountain pecan Peach cultivars Gloria Grande, sequence group are as follows:

1) 5′-AATTCAGTCAGAGTCGGAGTCGGATTTCATATTTAAACTTTGACAAAATCTGAGTCAAAATCAGAT TTAGGGGATATCGACTCTGACTCTATCAGTGCTCAACCCTATGGTGAAACGTCACTTCCCCCTTGCTTGTGTCCGT CAATACATGTCCATGAACATATCATCAAATATTCTTAAGTCGAAACTGATGAAACATAAAGGTTGCAAGGCTAGGC TCTAAATGAGAGTCTTGCTTGACTCATACTTTGCTCAATCATACGCATGCTCTCAAT-3′

2) 5′-AATTCAATTGGTCACTTTTATCTGTTCAATTATCATTTTCCTTTATATATATCTTAAATTGTATAT GATTCATAGTAGATGCGAGCCAAAGTCCAAACTCATAATAAAACAGAAGGAAGTACTTCCTTTTATAATACACAAC AAATATAAATTATCGTACAAGCTGTGGCCATGAGAATGACCTTATTAATTGGGGGATAATATTACACACAATTAAT TAACACAGCATAGCCATTGGCCTTATTGTTGATGATACAATTAGCAGCTTCTATGGTTACTGCATATAATTGTAAC AGAACATCGGTATATCTGATACCAATATTGGCCTTAATATTGATAATACAACCACACACAAACACACCAA-3′

3) 5′-AATTCATGGGCGTAAAGGACAGTTTGTGTTCAATCTCATCAACAGTTTTGATATCCGGAACCAGAA AATGCATCACAATTTACAAGCCTACTTTTTCCCTCATCTCTGTCATCTTGTTTAGATTACTTTTTCATTTCAGATG TACAATTTTTTGGTTGGTGTTTCAAACATACGAGACATTCATAAGATAAAGAATATGCATTTTACACTGACACAAA TCAACTATAACAAGAACAAAGCTAAACCCCTTGCATTCTCAATTCTTGTTCTTTCCACCTTTTAGGTGTGCTCCGT TCTTACGGTTCTAGGCGGTTTTGCAAGCCTGGAAATACACCAATCTTTTTCTACTAGTCATTGTGTATATACAGAA GCAGCAAGGAAATATTCTCTCTCATATTTAACTGATCTAGTCTCATAAGACAAGACAGCTCTGCATTTGTGTTCAC TGAGAACTTGGATGTGTATTGAAAACTTACATTTTCG-3′

The invention further relates to the molecular specificity labeled primers group of thin shell mountain pecan Peach cultivars Gloria Grande, the primer sequence It is classified as:

1) upstream primer: 5 '-AGTCAGAGTCGGAGTCGGAT-3 '

Downstream primer: 5 '-AGCCTAGCCTTGCAACCTTT-3 '

2) upstream primer: 5 '-AGATGCGAGCCAAAGTCCAA-3 '

Downstream primer: 5 '-TGGTGTGTTTGTGTGTGGTTG-3 '

3) upstream primer: 5 '-TCATGGGCGTAAAGGACAGT-3 '

Downstream primer: 5 '-GTGAACACAAATGCAGAGCTGT-3 '

The source of above-mentioned 3 pairs of primers combination: firstly, filtering out biggish 5 kinds of Traits change from 24 common kinds Simplify the sequencing and comparative analysis of gene；Then, based on the analysis results design 1000 multipair primers, in 24 samples into Row screening and verifying, obtain the DNA fragment specific of thin shell mountain pecan Peach cultivars Gloria Grande；Then, which is cloned Sequencing, using the secondary screening of repeatability sampling more than three times, the molecular specificity labeled primers finally obtained are combined；With above-mentioned spy Specific primer combination to thin shell mountain pecan Peach cultivars carry out PCR amplification, only Gloria Grande can get be respectively 214bp, 3 specific fragments of 286bp, 443bp size, other thin shell mountain pecan Peach cultivars, which cannot obtain, selects the special of primer combination Property segment；It should be noted that molecular specificity labeled primers combination of the invention is only limitted to the identification of thin shell mountain pecan Peach cultivars, I.e. sample to be tested is only limitted to apocarya；

For features described above sequence, 3 pairs of specific primers of design, 3 products expanded are respectively as follows:

1)214bp:5′-AGTCAGAGTCGGAGTCGGATTTCATATTTAAACTTTGACAAAATCTGAGTCAAAATCAGAT TTAGGGGATATCGACTCTGACTCTATCAGTGCTCAACCCTATGGTGAAACGTCACTTCCCCCTTGCTTGTGTCCGT CAATACATGTCCATGAACATATCATCAAATATTCTTAAGTCGAAACTGATGAAACATAAAGGTTGCAAGGCTAGG CT-3′

2)286bp:5′-AGATGCGAGCCAAAGTCCAAACTCATAATAAAACAGAAGGAAGTACTTCCTTTTATAATAC ACAACAAATATAAATTATCGTACAAGCTGTGGCCATGAGAATGACCTTATTAATTGGGGGATAATATTACACACAA TAATTAACACAGCATAGCCATTGGCCTTATTGTTGATGATACAATTAGCAGCTTCTATGGTTACTGCATATAATTG TAACAGAACATCGGTATATCTGATACCAATATTGGCCTTAATATTGATAATACAACCACACACAAACACACCA-3′

3)443bp:5′-TCATGGGCGTAAAGGACAGTTTGTGTTCAATCTCATCAACAGTTTTGATATCCGGAACCAG AAAATGCATCACAATTTACAAGCCTACTTTTTCCCTCATCTCTGTCATCTTGTTTAGATTACTTTTTCATTTCAGA TGTACAATTTTTTGGTTGGTGTTTCAAACATACGAGACATTCATAAGATAAAGAATATGCATTTTACACTGACACA AATCAACTATAACAAGAACAAAGCTAAACCCCTTGCATTCTCAATTCTTGTTCTTTCCACCTTTTAGGTGTGCTCC GTTCTTACGGTTCTAGGCGGTTTTGCAAGCCTGGAAATACACCAATCTTTTTCTACTAGTCATTGTGTATATACAG AAGCAGCAAGGAAATATTCTCTCTCATATTTAACTGATCTAGTCTCATAAGACAAGACAGCTCTGCATTTGTGTTC AC-3′

Gloria Grande is the kind found from the seedling tree of the South Carolina U.S.'s nineteen twenty；Female flower is first ripe, the florescence In it is partially early, male flower maturation is slower than female flower, in it is to the rear；Fruit type in category, ellipse, top and bottom are all relatively round, it is upper wider without Symmetrically, nut shell is thicker, smooth, there is blackstreak, mean fruit weight 7.5g or so, and kernel color is deeper, and main groove is wide, base portion Crack is deep；

The invention further relates to a kind of using the molecular specificity labeled primers combination, to thin shell mountain pecan Peach cultivars Gloria The method that Grande carries out Rapid identification, the method are as follows: extract the genomic DNA conduct of thin shell mountain pecan Peach cultivars blade to be measured Template carries out PCR amplification using the molecular specificity labeled primers group as amplimer, carries out electrophoresis inspection to amplified production It surveys, if 3 DNA bands of respectively 214bp, 286bp, 443bp size, apocarya to be measured occurs simultaneously in electrophoresis result Kind is thin shell mountain pecan Peach cultivars Gloria Grande, on the contrary then no；The molecular specificity labeled primers sequence are as follows:

1) upstream primer: 5 '-AGTCAGAGTCGGAGTCGGAT-3 '

Downstream primer: 5 '-AGCCTAGCCTTGCAACCTTT-3 '

2) upstream primer: 5 '-AGATGCGAGCCAAAGTCCAA-3 '

Downstream primer: 5 '-TGGTGTGTTTGTGTGTGGTTG-3 '

3) upstream primer: 5 '-TCATGGGCGTAAAGGACAGT-3 '

Downstream primer: 5 '-GTGAACACAAATGCAGAGCTGT-3 '

The method of the present invention key is the selection of amplimer combination, and DNA is extracted, and PCR reaction system and reaction condition determine, with And electrophoresis detection, it can be carried out according to conventional method in that art；

The method of the present invention is compared with the molecule labelling method of existing thin shell mountain pecan Peach cultivars, such as SSR labeling method, has following excellent Point: (1) because the primer is verified through sequencing and repeatedly, therefore reliability improves very much；(2) easy to detect, intuitive, it is directly logical Crossing the combination of the presence or absence of general electrophoresis observation band can determine whether, and also need to utilize high score after expanding if applying SSR marker method Resolution electrophoresis is further analyzed or is sequenced；(3) lower to the requirement of sample, the DNA sample of the tissues such as blade can satisfy The needs of cultivar identification；

Preferably, PCR amplification system composition of the present invention is as follows:

PCR Buffer final concentration of 1 ×

dNTPs 1 mmol/L

MgCl₂ 2.5 mmol/L

1.0 U/ of Taq enzyme reaction

Each 0.2 μM of upstream and downstream primer

60 ng/ of template DNA reaction

Surplus is ddH₂O；

The PCR amplification condition is as follows: after 94 DEG C of initial denaturation 300s, 95 DEG C of denaturation 10s, 56 DEG C of annealing time 50s, 72 DEG C extend 40s is recycled 30 times, altogether finally in 72 DEG C of filling-in 300s；Final temperature is 4 DEG C；

PCR Buffer final concentration of 1 ×, refer to the concentration of each component in the reaction system and 1 × PCR in PCR Buffer Buffer is identical, and usually selecting volume is 10 × PCR Buffer of reaction system volume 1/10；10 × PCR Buffer ingredient Are as follows: 100 mM Tris-HCl(pH 8.5), 500 mM KCl, 25 mM MgCl₂With 1.0% Triton-X-100, solvent is ddH₂O；

Specifically, the method is as follows:

(1) apocarya blade to be measured is taken, liquid feeding nitrogen is ground, using the novel quick-speed plant extracting genome DNA of bioteke The operating instruction of kit extracts the genomic DNA of apocarya blade to be measured；

(2) genomic DNA extracted using step (1) is template, using the molecular specificity labeled primers as amplimer, Carry out PCR amplification:

The every 15 μ l composition of PCR reaction system is as follows:

2×TsingKE master mix 7.5μl

Each 0.2 μ l of 10 μM of upstream and downstream primers

20 ng/ μ l template DNA, 2 μ l

dd H₂O 4.3μl；

PCR reaction condition is as follows:

After 94 DEG C of initial denaturation 300s, 95 DEG C of denaturation 10s, 56 DEG C of annealing times 50s, 72 DEG C of extension 40s, circulation 30 times altogether, finally In 72 DEG C of filling-in 300s；Final temperature is 4 DEG C；

3 μ l of step (2) amplified production is taken, is mixed with 1 μ l, 0.25% bromjophenol blue buffer, point sample is in 1.5% Ago-Gel On, in 1 × TAE buffer, electrophoresis under 5V/cm voltage, EB is dyed after electrophoresis, and Yu Zidong gel image analysis instrument can photograph well Phase, if the DNA band of respectively 214bp, 286bp, 443bp size occurs in electrophoresis result, thin shell mountain pecan Peach cultivars to be measured are Gloria Grande；It is on the contrary then no.

Detailed description of the invention

Fig. 1 is that (number 1-24 represents thin shell mountain pecan Peach cultivars by the result of 24 kinds of thin shell mountain pecan Peach cultivars progress PCR amplifications Successively are as follows: 1, Moore, 2, Dependable, 3, Nacono, 4, quiet state 1,5, Van Deman, 6, Sturat5,7, Forkert, 8, Desirable, 9, Davis, 10, Elliott, 11, Caddo, 12, Schley, 13, Choctaw, 14, Shaoxing, 15, Wichita, 16, Sumner, 17, Mahan, 18, Gloria Grande, 19, Peruque, 20, Sioux, 21, Pyzner, 22, Pawnee, 23, Osage, 24, Oconee)；M is Takara DL2000 marker；Only number 18 is apocarya product Kind Gloria Grande has amplified 3 specific DNA bands of respectively 214bp, 286bp, 443bp size；Remaining number is Other thin shell mountain pecan Peach cultivars there are no the generation of specific DNA band.

Specific embodiment

The present invention is described further combined with specific embodiments below, but protection scope of the present invention is not limited in This:

Embodiment 1:

(1) extraction of apocarya variety genome DNA:

0.05 g of thin shell mountain pecan Peach cultivars young leaflet tablet to be measured is taken, liquid feeding nitrogen is thoroughly ground, and the extraction of genomic DNA uses The operating instruction of the novel quick-speed plant genome DNA extracting reagent kit of bioteke, is repeatedly extracted, to obtain apocarya The extracting genome DNA object of kind；DNA extract detected using 1.5% agarose gel electrophoresis integrality, purity and Concentration；Judge band brightness for subsequent PCR amplification；DNA extract is spare in -20 DEG C of refrigerator storages；

(2) specific PCR amplification primer, the sequence of primer pair are designed are as follows:

A: upstream primer: 5 '-AGTCAGAGTCGGAGTCGGAT-3 '

Downstream primer: 5 '-AGCCTAGCCTTGCAACCTTT-3 '

B: upstream primer: 5 '-AGATGCGAGCCAAAGTCCAA-3 '

Downstream primer: 5 '-TGGTGTGTTTGTGTGTGGTTG-3 '

C: upstream primer: 5 '-TCATGGGCGTAAAGGACAGT-3 '

Downstream primer: 5 '-GTGAACACAAATGCAGAGCTGT-3 '

By Shanghai, biotechnology Co., Ltd is synthesized；

(3) PCR amplification:

PCR reaction solution forms (15 μ l):

2 × TsingKE master mix master mix(holds up section's biology, Beijing) 7.5 μ l

Each 0.2 μ l of 10 μM of upstream and downstream primers

20 ng/ μ l template DNA, 2 μ l

dd H₂O 4.3μl；

Amplified reaction carries out on TC-XP type amplification instrument；Amplification condition: after 94 DEG C of initial denaturation 300s, 95 DEG C of denaturation 10s, 56 DEG C Annealing time 50s, 72 DEG C of extension 40s are recycled 30 times, altogether finally in 72 DEG C of filling-in 300s；Final temperature is 4 DEG C；

(4) electrophoresis detection: taking 3 μ l of step (3) pcr amplification product, with 1 μ l, 0.25% bromjophenol blue buffer mix, point sample in On 1.5% Ago-Gel, in 1 × TAE buffer, electrophoresis under 5V/cm voltage after electrophoresis, is containing 0.5 μ g/ml It dyes in the aqueous solution of EB 30 minutes, then takes a picture on Bio-rad gel imaging system Gel Doc；

According to the method described above respectively to 24 thin shell mountain pecan Peach cultivars (number 1-24 represent thin shell mountain pecan Peach cultivars be followed successively by 1, Moore, 2, Dependable, 3, Nacono, 4, quiet state 1,5, Van Deman, 6, Sturat5,7, Forkert, 8, Desirable, 9, Davis, 10, Elliott, 11, Caddo, 12, Schley, 13, Choctaw, 14, Shaoxing, 15, Wichita, 16, Sumner, 17, Mahan, 18, Gloria Grande, 19, Peruque, 20, Sioux, 21, Pyzner, 22, Pawnee, 23, Osage, 24, Oconee) PCR amplification map carry out electrophoresis detection, the result is shown in Figure 1；

Three have wherein only been amplified from the thin shell mountain pecan Peach cultivars Gloria Grande that number is 18 clearly to become clear, stablize Be respectively 214bp, 286bp, 443bp size specific DNA band；And the thin shell mountain pecan Peach cultivars of remaining number, it there are no Special DNA band generates, and does not also have other non-purpose bands to generate, it is seen that the molecular specificity labeled primers that the present invention develops To the early stage identification for thin shell mountain pecan Peach cultivars Gloria Grande, stability, specificity are very high.

SEQUENCE LISTING

<110>Zhejiang Prov. Forest Science Inst

<120>characteristic sequence, labeled primer and the identification method of thin shell mountain pecan Peach cultivars Gloria Grande

<130>

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 275

<212> DNA

<213> Carya illinoensis

<220>

<221> unsure

<400> 1

aattcagtca gagtcggagt cggatttcat atttaaactt tgacaaaatc tgagtcaaaa 60

tcagatttag gggatatcga ctctgactct atcagtgctc aaccctatgg tgaaacgtca 120

cttccccctt gcttgtgtcc gtcaatacat gtccatgaac atatcatcaa atattcttaa 180

gtcgaaactg atgaaacata aaggttgcaa ggctaggctc taaatgagag tcttgcttga 240

ctcatacttt gctcaatcat acgcatgctc tcaat 275

<210> 2

<211> 214

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 2

agtcagagtc ggagtcggat ttcatattta aactttgaca aaatctgagt caaaatcaga 60

tttaggggat atcgactctg actctatcag tgctcaaccc tatggtgaaa cgtcacttcc 120

cccttgcttg tgtccgtcaa tacatgtcca tgaacatatc atcaaatatt cttaagtcga 180

aactgatgaa acataaaggt tgcaaggcta ggct 214

<210> 3

<211> 20

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 3

agtcagagtc ggagtcggat 20

<210> 4

<211> 20

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 4

agcctagcct tgcaaccttt 20

<210> 5

<211> 364

<212> DNA

<213> Carya illinoensis

<220>

<221> unsure

<400> 5

aattcaattg gtcactttta tctgttcaat tatcattttc ctttatatat atcttaaatt 60

gtatatgatt catagtagat gcgagccaaa gtccaaactc ataataaaac agaaggaagt 120

acttcctttt ataatacaca acaaatataa attatcgtac aagctgtggc catgagaatg 180

accttattaa ttgggggata atattacaca caattaatta acacagcata gccattggcc 240

ttattgttga tgatacaatt agcagcttct atggttactg catataattg taacagaaca 300

tcggtatatc tgataccaat attggcctta atattgataa tacaaccaca cacaaacaca 360

ccaa 364

<210> 6

<211> 286

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 6

agatgcgagc caaagtccaa actcataata aaacagaagg aagtacttcc ttttataata 60

cacaacaaat ataaattatc gtacaagctg tggccatgag aatgacctta ttaattgggg 120

gataatatta cacacaataa ttaacacagc atagccattg gccttattgt tgatgataca 180

attagcagct tctatggtta ctgcatataa ttgtaacaga acatcggtat atctgatacc 240

aatattggcc ttaatattga taatacaacc acacacaaac acacca 286

<210> 7

<211> 20

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 7

agatgcgagc caaagtccaa 20

<210> 8

<211> 21

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 8

tggtgtgttt gtgtgtggtt g 21

<210> 9

<211> 483

<212> DNA

<213> Gloria Grande

<220>

<221> unsure

<400> 9

aattcatggg cgtaaaggac agtttgtgtt caatctcatc aacagttttg atatccggaa 60

ccagaaaatg catcacaatt tacaagccta ctttttccct catctctgtc atcttgttta 120

gattactttt tcatttcaga tgtacaattt tttggttggt gtttcaaaca tacgagacat 180

tcataagata aagaatatgc attttacact gacacaaatc aactataaca agaacaaagc 240

taaacccctt gcattctcaa ttcttgttct ttccaccttt taggtgtgct ccgttcttac 300

ggttctaggc ggttttgcaa gcctggaaat acaccaatct ttttctacta gtcattgtgt 360

atatacagaa gcagcaagga aatattctct ctcatattta actgatctag tctcataaga 420

caagacagct ctgcatttgt gttcactgag aacttggatg tgtattgaaa acttacattt 480

tcg 483

<210> 10

<211> 443

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 10

tcatgggcgt aaaggacagt ttgtgttcaa tctcatcaac agttttgata tccggaacca 60

gaaaatgcat cacaatttac aagcctactt tttccctcat ctctgtcatc ttgtttagat 120

tactttttca tttcagatgt acaatttttt ggttggtgtt tcaaacatac gagacattca 180

taagataaag aatatgcatt ttacactgac acaaatcaac tataacaaga acaaagctaa 240

accccttgca ttctcaattc ttgttctttc caccttttag gtgtgctccg ttcttacggt 300

tctaggcggt tttgcaagcc tggaaataca ccaatctttt tctactagtc attgtgtata 360

tacagaagca gcaaggaaat attctctctc atatttaact gatctagtct cataagacaa 420

gacagctctg catttgtgtt cac 443

<210> 11

<211> 20

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 11

tcatgggcgt aaaggacagt 20

<210> 12

<211> 22

<212> DNA

<213> unknown

<220>

<221> unsure

<223>artificial sequence

<400> 12

gtgaacacaa atgcagagct gt 22

Claims

1. the characteristic sequence group of thin shell mountain pecan Peach cultivars Gloria Grande, sequence group are as follows:

5′-AATTCAGTCAGAGTCGGAGTCGGATTTCATATTTAAACTTTGACAAAATCTGAGTCAAAATCAGATTTA GGGGATATCGACTCTGACTCTATCAGTGCTCAACCCTATGGTGAAACGTCACTTCCCCCTTGCTTGTGTCCGTCAA TACATGTCCATGAACATATCATCAAATATTCTTAAGTCGAAACTGATGAAACATAAAGGTTGCAAGGCTAGGCTCT AAATGAGAGTCTTGCTTGACTCATACTTTGCTCAATCATACGCATGCTCTCAAT-3′

5′-AATTCAATTGGTCACTTTTATCTGTTCAATTATCATTTTCCTTTATATATATCTTAAATTGTATATGAT TCATAGTAGATGCGAGCCAAAGTCCAAACTCATAATAAAACAGAAGGAAGTACTTCCTTTTATAATACACAACAAA TATAAATTATCGTACAAGCTGTGGCCATGAGAATGACCTTATTAATTGGGGGATAATATTACACACAATTAATTAA CACAGCATAGCCATTGGCCTTATTGTTGATGATACAATTAGCAGCTTCTATGGTTACTGCATATAATTGTAACAGA ACATCGGTATATCTGATACCAATATTGGCCTTAATATTGATAATACAACCACACACAAACACACCAA-3′

5′-AATTCATGGGCGTAAAGGACAGTTTGTGTTCAATCTCATCAACAGTTTTGATATCCGGAACCAGAAAAT GCATCACAATTTACAAGCCTACTTTTTCCCTCATCTCTGTCATCTTGTTTAGATTACTTTTTCATTTCAGATGTAC AATTTTTTGGTTGGTGTTTCAAACATACGAGACATTCATAAGATAAAGAATATGCATTTTACACTGACACAAATCA ACTATAACAAGAACAAAGCTAAACCCCTTGCATTCTCAATTCTTGTTCTTTCCACCTTTTAGGTGTGCTCCGTTCT TACGGTTCTAGGCGGTTTTGCAAGCCTGGAAATACACCAATCTTTTTCTACTAGTCATTGTGTATATACAGAAGCA GCAAGGAAATATTCTCTCTCATATTTAACTGATCTAGTCTCATAAGACAAGACAGCTCTGCATTTGTGTTCACTGA GAACTTGGATGTGTATTGAAAACTTACATTTTCG-3′。

2. the molecular specificity labeled primers group of thin shell mountain pecan Peach cultivars Gloria Grande, the primer sequence are as follows:

1) upstream primer: 5 '-AGTCAGAGTCGGAGTCGGAT-3 '

Downstream primer: 5 '-AGCCTAGCCTTGCAACCTTT-3 '

2) upstream primer: 5 '-AGATGCGAGCCAAAGTCCAA-3 '

Downstream primer: 5 '-TGGTGTGTTTGTGTGTGGTTG-3 '

3) upstream primer: 5 '-TCATGGGCGTAAAGGACAGT-3 '

Downstream primer: 5 '-GTGAACACAAATGCAGAGCTGT-3 '.

3. it is a kind of using molecular specificity labeled primers as claimed in claim 2 to thin shell mountain pecan Peach cultivars Gloria Grande The method for carrying out Rapid identification, the method are as follows: extract the genomic DNA of thin shell mountain pecan Peach cultivars blade to be measured as template, Using the molecular specificity labeled primers as amplimer, PCR amplification is carried out, electrophoresis detection is carried out to amplified production, if electric There are 3 specific DNA bands of respectively 214bp, 286bp, 443bp size simultaneously in result of swimming, then apocarya product to be measured Kind is thin shell mountain pecan Peach cultivars Gloria Grande, on the contrary then no；The molecular specificity labeled primers group sequence are as follows:

1) upstream primer: 5 '-AGTCAGAGTCGGAGTCGGAT-3 '

Downstream primer: 5 '-AGCCTAGCCTTGCAACCTTT-3 '

2) upstream primer: 5 '-AGATGCGAGCCAAAGTCCAA-3 '

Downstream primer: 5 '-TGGTGTGTTTGTGTGTGGTTG-3 '

3) upstream primer: 5 '-TCATGGGCGTAAAGGACAGT-3 '

Downstream primer: 5 '-GTGAACACAAATGCAGAGCTGT-3 '.

4. method as claimed in claim 3, it is characterised in that the PCR amplification condition is as follows: after 94 DEG C of initial denaturation 300s, 95 DEG C denaturation 10s, 56 DEG C of annealing times 50s, 72 DEG C of extensions 40s, altogether circulation 30 times, finally in 72 DEG C of filling-in 300s；Final temperature It is 4 DEG C.

5. the method as described in claim 3,4, it is characterised in that the method is as follows:

(1) apocarya blade to be measured is taken, liquid feeding nitrogen is ground, and the extraction of genomic DNA uses the novel quick-speed plant of bioteke The operating instruction of genome DNA extracting reagent kit；

(2) genomic DNA extracted using step (1) is template, using the molecular specificity labeled primers as amplimer, into Row PCR amplification:

The every 15 μ l composition of PCR reaction system is as follows:

2×TsingKE master mix 7.5μl

Each 0.2 μ l of 10 μM of upstream and downstream primers

20 ng/ μ l template DNA, 2 μ l

dd H2O 4.3μl；

PCR amplification condition is as follows:

(3) 3 μ l of step (2) amplified production is taken, is mixed with 1 μ l, 0.25% bromjophenol blue buffer, point sample is solidifying in 1.5% agarose On glue, in 1 × TAE buffer, electrophoresis under 5V/cm voltage, EB is dyed after electrophoresis, and Yu Zidong gel imaging system can photograph well Phase, if 3 DNA specific bands of respectively 214bp, 286bp, 443bp size, shell mountain to be measured occurs simultaneously in electrophoresis result Walnut Cultivars are Gloria Grande, on the contrary then no.