CN109593853A - Primer sets, kit and the method for gene polymorphism sites detection - Google Patents
Primer sets, kit and the method for gene polymorphism sites detection Download PDFInfo
- Publication number
- CN109593853A CN109593853A CN201811654434.8A CN201811654434A CN109593853A CN 109593853 A CN109593853 A CN 109593853A CN 201811654434 A CN201811654434 A CN 201811654434A CN 109593853 A CN109593853 A CN 109593853A
- Authority
- CN
- China
- Prior art keywords
- primer
- detection
- seq
- amplimer
- combination
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses primer sets, kit and the methods of a kind of detection of gene polymorphism sites, are related to genetic polymorphism detection technical field.The primer sets include one of primer combination 1- primer combination 6 or a variety of combinations.The polymorphism of 6 SNP sites of 2 5-FU class pharmaceutical relevant genes can be detected simultaneously using the primer sets, there is the features such as at low cost, result interpretation is simple, noiseless between SNP site.
Description
Technical field
The present invention relates to genetic polymorphism detection technical fields, detect in particular to a kind of gene polymorphism sites
Primer sets, kit and method.
Background technique
5-FU (5 FU 5 fluorouracil) is first according to certain antimetabolite imagined and synthesized, to digestive system cancer and other
Solid tumor has good curative effect.5-FU can generate F-dUMP and FUMP by different approaches, the former and thymidylate synthetase
Activated centre covalent bond inhibits the activity of enzyme, and making deoxyribonucleoside, acid heat, and then inhibits DNA synthesis.In addition, the generation of 5-FU
Thank object can also pseudo- metabolite form be incorporated into RNA and DNA, influence cell function, cytotoxicity generated, in addition to acting on
Outside the cell S phase, also there is effect to the cell of other phases.
Dihydropyrimidine dehydrogenase (DPYD) can specific metabolic inactivation fluorouracil, the 5-FU class drug such as capecitabine,
The active height of DPYD determines the toxicity of drug in vivo, cannot be in time by inaxtivation of drug, poison when DPYD activity reduces
Property can destroy normal tissue, primer toxicity generates side effect.
Methylenetetrahydrofolate reductase (MTHFR) is a kind of metabolic enzyme, and folic acid metabolism access is unobstructed when enzymatic activity is high, first
It is low that side effect risk occurs when the drug therapies such as aminopterin.Therefore it can predict to judge that drug is controlled by checking mthfr gene
The curative effect and mucositis and serology toxicity for the treatment of, and suitable drug is chosen according to the genotype of patient, i.e., according to individual inheritance
Feature (genotype), selects effective therapeutic scheme.Realize " gene targeting type " Individual drug treatment and " amount body medication ".
Traditional detection method is mainly sanger sequencing, fragment analysis or Single base extension technology, and each reaction is only
Detect 1 or several gene locis.Its there are detection efficiencies low, low problem of flux.Traditional detection method is completed primary
Detection cycle is longer, needs experimenter more；It detects in matched reagent simultaneously, needs fluorescent dye primer or ddNTP or length
Fragment primer, higher cost.Since there are more repetitive sequence, traditional detection methods in genome for drug metabolism gene
To the amplification of gene difficulty, difficult detection.Traditional detection method experiment flow is long, and sample well is uncapped repeatedly, is loaded often；It is same simultaneously
Multiple gene loci competitiveness amplifications, relevant interference are big in one reaction.The baseline results that traditional detection method obtains can not be
Visual display detecting result on instrument, needs laboratory technician's self-setting Parameter analysis, and as a result interpretation is complicated.Traditional detection method
The primer or ddNTP or long segment primer for needing to use fluorescent marker, the exposure long period under room temperature or illumination condition,
Or multigelation number excessively easily causes detection to fail, and failure rate is high.
In consideration of it, the present invention is specifically proposed.
Summary of the invention
The purpose of the present invention is to provide a kind of primer sets of gene polymorphism sites detection, can be same using the primer sets
When the polymorphism of 6 SNP sites of 2 5-FU class pharmaceutical relevant genes is detected, there is the interpretation letter of at low cost, result
Singly, the features such as noiseless between SNP site.
Another object of the present invention is to provide a kind of kits of gene polymorphism sites detection, can using the kit
To detect simultaneously to the polymorphism of 6 SNP sites of 2 5-FU class pharmaceutical relevant genes, there is at low cost, result interpretation
Simply, the features such as noiseless between SNP site.
Another object of the present invention is to provide a kind of method of gene polymorphism sites detection, this method can be right simultaneously
The polymorphism of 6 SNP sites of 2 5-FU class pharmaceutical relevant genes is detected, at low cost, result interpretation is simple, SNP
The features such as noiseless between site.
The present invention is implemented as follows:
On the one hand, the present invention provides a kind of primer sets of gene polymorphism sites detection, the gene is 5-FU class medicine
Object related gene, the primer sets include one of primer combination 1- primer combination 6 or a variety of combinations；
Wherein, primer combination 1 includes: inspection shown in amplimer shown in SEQ ID NO.1-2 and SEQ ID NO.13
Survey primer；
Primer combination 2 includes: to detect to draw shown in amplimer shown in SEQ ID NO.3-4 and SEQ ID NO.14
Object；
Primer combination 3 includes: to detect to draw shown in amplimer shown in SEQ ID NO.5-6 and SEQ ID NO.15
Object；
Primer combination 4 includes: to detect to draw shown in amplimer shown in SEQ ID NO.7-8 and SEQ ID NO.16
Object；
Primer combination 5 includes: to detect to draw shown in amplimer shown in SEQ ID NO.9-10 and SEQ ID NO.17
Object；
Primer combination 6 includes: to detect to draw shown in amplimer shown in SEQ ID NO.11-12 and SEQ ID NO.18
Object.
It, can be simultaneously to 2 5-FU class drug phases in conjunction with ionization time of flight using primer sets provided by the invention
6 SNP site example rs3918290, rs55886062 of correlation gene such as DPYD and MTHFR, rs1801265, rs67376798,
The polymorphism of rs1801131 and rs1801133 is detected, and has that at low cost, result interpretation is simple, each SNP site detection knot
The features such as noiseless between fruit.
Wherein, the positional relationship of above-mentioned 2 5-FU class pharmaceutical relevant genes and 6 SNP sites adds the following table 1.
Table 1
| Gene name | Chromosome location | SNP site | Mutation type | Base mutation type |
| DPYD*2A | chr 1 | rs3918290 | Point mutation | GG/GA/AA |
| DPYD*13 | chr 1 | rs55886062 | Point mutation | TT/TG/GG |
| DPYD*9A | chr 1 | rs1801265 | Point mutation | TT/TC/CC |
| DPYD*9B | chr 1 | rs67376798 | Point mutation | AA/AT/TT |
| MTHFR.A1298C | chr 1 | rs1801131 | Point mutation | AA/AC/CC |
| MTHFR.C677T | chr 1 | rs1801133 | Point mutation | CC/CT/TT |
The sequence of the amplimer of above-mentioned primer combination 1- primer combination 6 see the table below 2.
Table 2
Note: F: upstream primer is used in amplification；R: downstream primer is used in amplification
The sequence of detection primer and the SNP of detection of above-mentioned primer combination 1- primer combination 6 see the table below 3.
Table 3
The detection primer of above-mentioned primer combination 1- primer combination 6 with the peak position of the molecular size range of its amplified production and
Its corresponding SNP site genotype see the table below 4.
Table 4
On the other hand, the present invention provides a kind of kits of gene polymorphism sites detection comprising above-mentioned primer
Group.
It, can be simultaneously to 2 5-FU class drug phases in conjunction with ionization time of flight using kit provided by the invention
6 SNP site example rs3918290, rs55886062 of correlation gene such as DPYD and MTHFR, rs1801265, rs67376798,
The polymorphism of rs1801131 and rs1801133 is detected, and has that at low cost, result interpretation is simple, each SNP site detection knot
The features such as noiseless between fruit.
Further, in some embodiments of the present invention, kit further includes having following component: Mg2+, dNTPs and
Taq archaeal dna polymerase.
On the other hand, the present invention provides a kind of method of gene polymorphism sites detection, the gene is 5-FU class medicine
Object related gene comprising following steps:
(1) PCR amplification is carried out to sample using the amplimer in above-mentioned primer sets, obtains the first amplified production；
(2) the first amplified production after alkaline phosphatase treatment is carried out using the detection primer in above-mentioned primer sets single
Base extension obtains the second amplified production；
(3) polymorphism of second amplified production is analyzed using ionization time of flight.
When judging result, according to the molecular size range of detection primer amplification and peak position, the gene of each each SNP site of determination
Type.
Further, in some embodiments of the present invention, in step (1), the system for carrying out PCR amplification contains:
Primer combines the amplimer of 1- primer combination 6, Mg2+, dNTPs and Taq archaeal dna polymerase.
Further, in some embodiments of the present invention, in step (1), the amplimer is in system
Concentration is 0.8-1.2 μM.
Further, in some embodiments of the present invention, in step (1), the annealing of the program of PCR amplification is carried out
Temperature are as follows: 55-57 DEG C.
Further, in some embodiments of the present invention, in step (2), the body of single base extension is carried out
System is contained: primer combines the detection primer and the first amplified production of 1- primer combination 6.
Further, in some embodiments of the present invention, system of the detection primer in single base extension
In total concentration be 5-7 μM.
Further, in some embodiments of the present invention, each detection primer of primer combination 1- primer combination 6 is in list
Concentration in the system of base extension be respectively as follows: 1.125 μM, 0.983 μM, 1.005 μM, 0.808 μM, 0.907 μM and
1.078μM。
Further, in some embodiments of the present invention, in step (2), the journey of single base extension is carried out
The annealing temperature of sequence are as follows: 51-53 DEG C, annealing time are as follows: 4-6s.
Further, in some embodiments of the present invention, the elongating temperature of the program of single base extension is carried out
It is 79-81 DEG C, time 4-6s.
It, can be simultaneously to 2 5-FU class drugs in conjunction with ionization time of flight using detection method provided by the invention
6 SNP site example rs3918290, rs55886062 of related gene such as DPYD and MTHFR, rs1801265,
The polymorphism of rs67376798, rs1801131 and rs1801133 are detected, at low cost, result interpretation is simple, each SNP
The features such as noiseless between site primer result.
Detailed description of the invention
In order to illustrate the technical solution of the embodiments of the present invention more clearly, below will be to needed in the embodiment attached
Figure is briefly described, it should be understood that the following drawings illustrates only certain embodiments of the present invention, therefore is not construed as pair
The restriction of range for those of ordinary skill in the art without creative efforts, can also be according to this
A little attached drawings obtain other relevant attached drawings.
Fig. 1 is the testing result of the control primer pair 1 in experimental example 1.
Fig. 2 is the testing result of the primer combination 6 in experimental example 1.
Fig. 3 is the testing result of the control primer pair 2 in experimental example 2.
Fig. 4 is the testing result of the primer combination 3 in experimental example 2.
Fig. 5 is the testing result of the control primer pair 3 in experimental example 3.
Fig. 6 is the testing result of the primer combination 2 in experimental example 3.
Fig. 7 is the testing result of the control primer pair 4 in experimental example 4.
Fig. 8 is the testing result of the primer combination 5 in experimental example 4.
Specific embodiment
It in order to make the object, technical scheme and advantages of the embodiment of the invention clearer, below will be in the embodiment of the present invention
Technical solution be clearly and completely described.The person that is not specified actual conditions in embodiment, according to normal conditions or manufacturer builds
The condition of view carries out.Reagents or instruments used without specified manufacturer is the conventional production that can be obtained by commercially available purchase
Product.
Feature and performance of the invention are described in further detail with reference to embodiments.
Embodiment 1
The kit of 5-FU class pharmaceutical relevant gene polymorphic site detection provided in this embodiment comprising be used for 5-FU
The primer sets of class pharmaceutical relevant gene polymorphic site detection, the primer sets include following primer combination 1- primer combination 6.
Primer combination 1 includes: to detect to draw shown in amplimer shown in SEQ ID NO.1-2 and SEQ ID NO.13
Object；
Primer combination 2 includes: to detect to draw shown in amplimer shown in SEQ ID NO.3-4 and SEQ ID NO.14
Object；
Primer combination 3 includes: to detect to draw shown in amplimer shown in SEQ ID NO.5-6 and SEQ ID NO.15
Object；
Primer combination 4 includes: to detect to draw shown in amplimer shown in SEQ ID NO.7-8 and SEQ ID NO.16
Object；
Primer combination 5 includes: to detect to draw shown in amplimer shown in SEQ ID NO.9-10 and SEQ ID NO.17
Object；
Primer combination 6 includes: to detect to draw shown in amplimer shown in SEQ ID NO.11-12 and SEQ ID NO.18
Object.
The amplimer of each primer combination and the sequence of detection primer and SNP site detected see above table 2- table 4.
Certainly, it should be noted that in other examples, primer sets include in primer combination 1- primer combination 6
Any a kind, 2 kinds, 3 kinds, 4 kinds or 5 kinds of combination.On the basis of the invention discloses the combination of above-mentioned primer, art technology
Personnel can carry out any combination from primer combination 1- primer combination 6 according to the classification and quantity of testing goal gene.No matter
It is which kind of combination, as long as it is belonged to the scope of protection of the present invention selected from primer combination 1- primer combination 6.
The kit of the present embodiment can be simultaneously to 6 of 2 5-FU class pharmaceutical relevant genes such as DPYD and MTHFR
SNP site example rs3918290, rs55886062, rs1801265, rs67376798, rs1801131 and rs1801133's is polymorphic
Property detected, have it is at low cost, result interpretation is simple, it is noiseless between each SNP site testing result the features such as.
The method detected using the kit is as follows:
(1) PCR amplification is carried out to sample using the amplimer in above-mentioned primer sets, obtains the first amplified production；
PCR amplification system is as follows:
| Reagent | Volume (μ L) | Final concentration |
| ddH2O | 0.8 | n/a |
| 10x PCR buffer | 0.5 | 1x |
| MgCl2 | 0.4 | 2mM |
| dNTP Mix | 0.1 | 500μM |
| Primer Mix | 1.0 | 1μM |
| PCR Enzyme | 0.2 | 0.2U/μL |
| DNA sample | 2.0 | 10-20ng |
| total | 5.0 | n/a |
Note: all detections with reagent are purchased from Agena Bioscience (base receive biotechnology (Shanghai) in 1. present invention
Co., Ltd), similarly hereinafter；
2.Primer Mix is the mixture that is configured to the concentration ratio of 1:1 of all amplimers, and when reaction is all to draw
Final concentration of 1 μM (final concentration of 1 μM of i.e. every amplimer) of object；
3.n/a indicates that this is meaningless.
PCR amplification program is as follows:
(2) the first amplified production after alkaline phosphatase treatment is carried out using the detection primer in above-mentioned primer sets single
Base extension obtains the second amplified production；
Single base extension system is as follows:
Wherein, IPLEX Primer Mix is the mixture of all detection primers, and detection primer allocation list is (to configure 100 μ
For L, surplus ddH2O complements to 100 μ L) as follows:
Single base extension program is as follows:
(3) polymorphism of second amplified production is analyzed using ionization time of flight.
It can determine the gene of SNP site according to the peak position of detection primer and its molecular size range of the second amplified production
Type is shown in Table 4.
Embodiment 2
Using the kit and method of embodiment 1, (clinic, sample are all to 20 parts of samples of known SNP site genotype
Category type is whole blood or buccal swab) it is detected, as a result as shown in table 5 below.
Table 5
The known results of table 5 are the sample using conventional method (fragment analysis, Single base extension and sanger sequencing) detection
This result statistics, right side testing result are the result detected using the primer sets of embodiment 1.As the result is shown using embodiment 1
The result of primer sets and detection method is consistent with conventional method result.
Experimental example 1
There are rs150847674, rs776956662 and rs1057519362 within the scope of 3 bases before and after the site rs1801133
Totally 3 SNP sites have SNP site 9 within the scope of the base of 10, the site distance rs1801133, have 17 within 20 bases
A SNP site, due to having up to 3 high-frequency insertion and deletions and 4 high-frequency point mutation sites, to target gene
Detection easily causes detection to fail.In addition, extremely easy expand obtains non-target fragment there are pseudogene in genome, therefore
General strategy is amplification segment as long as possible in design of primers, then is detected, and easily causes single detection site few, flux is few (such as
Sequencing analysis, fragment analysis)；If reducing amplification length, easily detection failure.Various the drawing of these cause descriptions primer sets of the present invention
The design needs of object make the creative labor.
Based on this, for the site rs1801133, design compares primer pair 1:
F (represents upstream primer, similarly hereinafter): CCTTGAACAGGTGGAGGCC；
R (represents downstream primer, similarly hereinafter): CAAAGAAAAGCTGCGTGAT.
Amplified production 158bp can be obtained using control primer pair 1.It is as shown in Figure 1 using the result of mass spectral analysis to product.
Rs1801133 represents detection primer in figure, and right side marks black G/A and represents detection product, can determine that into 3 kinds not according to the presence or absence of peak
Homogenic type, since product peak and background value are very close in result as shown in the figure, there are false positive may, can not judgement sample
Genotype.As a result there is false positive, product peak is low, and amplification efficiency is poor.Therefore using this primer detection site result inaccuracy.
And the amplimer pair of the primer combination 6 for the site rs1801133 provided using the embodiment of the present invention 1:
F:GTGCATGCCTTCACAAAGCG；
R:CACTTGAAGGAGAAGGTGTC。
It is expanded, it is as shown in Figure 2 to be analyzed by mass spectrometry result to product.Left side rs1801133 represents detection and draws in figure
Object, right side mark black G/A and represent detection product, can determine that into 3 kinds of different genotypes, result sample as shown in the figure according to the presence or absence of peak
This genotype is GA heterozygosis.
Testing result is preferable as the result is shown, and Genotyping is clear, and non-false positive product generates.It indicates to use this primer detection
The site, can succeed parting.
Experimental example 2
The connected base in the site rs1801265 is known SNP site rs528768620 and rs1397008025, and
Having 10 SNP sites within the scope of 10 bases, due to more than the polymorphic site of sample herein and corresponding base type not
Know, therefore easily causes detection to fail since 3 end end bases of most critical can not form pairing in detection primer detection, this
It is external also to contain 16 SNP sites within the scope of 20 bases of target site.
For the site rs1801265, design compares primer pair 2:
F:GTCTAATTTCTTGGCCGAAG；
R:GTCTTTAGAGTATCCTGGC。
Amplified production 80bp can be obtained using the control amplification of primer pair 2.Result such as Fig. 4 institute of mass spectral analysis is used product
Show.Left side rs1801265 represents detection primer in figure, and right side G/A represents detection product, can determine that into 3 kinds according to the presence or absence of peak
Different genotype, since product peak and background value are very close in result as shown in the figure, there are false positive may, can not judge sample
This genotype.As a result there is false positive, product peak is low, and amplification efficiency is poor.Therefore inaccurate using this primer detection site result
Really.
And the amplimer pair of the primer combination 3 for the site rs1801265 provided using the embodiment of the present invention 1:
F:CTTGTCTAATTTCTTGGCCG；
R:ATCCTGGCTTTAAATCCTCG。
It is expanded, it is as shown in Figure 4 to be analyzed by mass spectrometry result to product.Left side rs1801265 represents detection and draws in figure
Object, right side G/A represent detection product, can determine that into 3 kinds of different genotypes according to the presence or absence of peak, are as shown in the figure as the result is shown AA
Homozygous genotype.Testing result is preferable as the result is shown, and Genotyping is clear, and non-false positive product generates.It indicates to use this primer
The site is detected, can succeed parting.
Experimental example 3
There are the SNP site rs1057516968 of 1 high-frequency mutation in 2 bases before the site rs55886062, should
Site is the main bugbear for designing rs55886062 detection primer, and the detection of target site can largely be caused to fail, this
It is outer that there are also SNP site such as rs201615754 and rs1314015254 within the scope of 3 bases, and at a distance of target site 10
There are SNP site 11 within the scope of a base, there are 17 SNP sites before and after the site rs4986893 between 20 bases, wherein mesh
The high frequency subsite of preceding existing research report has 11.
For the site rs55886062, design compares primer pair 3:
F:GAGAAAGTTTTGGTGAGGGC；
R:TGGTCTTGCTAGCGCAACTC。
Amplified production 92bp can be obtained using the control amplification of primer pair 3.Result such as Fig. 5 institute of mass spectral analysis is used product
Show.Left side rs55886062 represents detection primer in figure, and right side T/C/A represents detection product, be can determine that into according to the presence or absence of peak
A variety of different genotypes, result as shown in the figure, which shows detection primer peak, a large amount of residues, and the peak product A is unobvious, with background value difference
Less, sample genotype is not can determine that.As a result there is false positive, product peak is low, illustrates that amplification efficiency is poor.Therefore this primer is used
Detect the site result inaccuracy.
And the amplimer pair of the primer combination 2 for the site rs55886062 provided using the embodiment of the present invention 1:
F:TCCTTTTGGTCTTGCTAGCG；
R:CAAAACCCCATCCAGCTTCA。
It is expanded, it is as shown in Figure 6 to be analyzed by mass spectrometry result to product.Left side rs55886062 represents detection and draws in figure
Object, right side T/C/A represent detection product, can determine that into 3 kinds of different genotypes according to the presence or absence of peak, be as the result is shown as shown in the figure
AA homozygous genotype.Testing result is preferable as the result is shown, and Genotyping is clear, and non-false positive product generates.Expression is drawn using this
The analyte detection site, can succeed parting.
Experimental example 4
There are the SNP site rs149533586 of 2 high-frequencies mutation in 10 bases around the site rs1801131
And rs765619217, two sites are the main bugbears for designing rs55886062 detection primer, can largely cause mesh
The detection of mark point fails, furthermore there are also SNP site 16 within the scope of 20 bases, wherein there is long segment missing prominent
Become (rs1334349459), the presence in the site is the where the shoe pinches of purpose of design gene magnification primer, may cause purpose base
Because of the generation of the false positive of detection.
For the site rs1801131, design compares primer pair 4:
F:GCAAGTCCCCCAAGGAGG；
R:GGTCCCCACTTCCAGCATC。
Amplified production 145bp can be obtained using the control amplification of primer pair 4.Result such as Fig. 7 of mass spectral analysis is used product
It is shown.Left side rs1801131 represents detection primer in figure, and right side G/T represents detection product, can determine that into 3 according to the presence or absence of peak
Kind different genotype, as shown in the figure detection failure as the result is shown.Extension primer shows that gene magnification fails without amplification, therefore makes
It cannot be used for detecting the site with this primer.
And the amplimer pair of the primer combination 5 for the site rs1801131 provided using the embodiment of the present invention 1:
F:AGAGCAAGTCCCCCAAGGAG；
R:TCTCCCGAGAGGTAAAGAAC。
It is expanded, it is as shown in Figure 8 to be analyzed by mass spectrometry result to product.Left side rs1801131 represents detection and draws in figure
Object, right side G/T represent detection product, can determine that into 3 kinds of different genotypes according to the presence or absence of peak, are as shown in the figure as the result is shown T
Homozygous genotype.Testing result is preferable as the result is shown, and Genotyping is clear, and non-false positive product generates.It indicates to use this primer
The site is detected, can succeed parting.
The foregoing is only a preferred embodiment of the present invention, is not intended to restrict the invention, for the skill of this field
For art personnel, the invention may be variously modified and varied.All within the spirits and principles of the present invention, made any to repair
Change, equivalent replacement, improvement etc., should all be included in the protection scope of the present invention.
SEQUENCE LISTING
<110>Guangzhou Kingmed Center for Clinical Laboratory Co., Ltd.
<120>primer sets, kit and the method for gene polymorphism sites detection
<160> 18
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
aacattcacc aacttatgcc 20
<210> 2
<211> 20
<212> DNA
<213>artificial sequence
<400> 2
tcactgaact aaaggctgac 20
<210> 3
<211> 20
<212> DNA
<213>artificial sequence
<400> 3
tccttttggt cttgctagcg 20
<210> 4
<211> 20
<212> DNA
<213>artificial sequence
<400> 4
caaaacccca tccagcttca 20
<210> 5
<211> 20
<212> DNA
<213>artificial sequence
<400> 5
cttgtctaat ttcttggccg 20
<210> 6
<211> 20
<212> DNA
<213>artificial sequence
<400> 6
atcctggctt taaatcctcg 20
<210> 7
<211> 20
<212> DNA
<213>artificial sequence
<400> 7
gcaacgtaga gcaagttgtg 20
<210> 8
<211> 20
<212> DNA
<213>artificial sequence
<400> 8
cttacctggt agccagaatc 20
<210> 9
<211> 20
<212> DNA
<213>artificial sequence
<400> 9
agagcaagtc ccccaaggag 20
<210> 10
<211> 20
<212> DNA
<213>artificial sequence
<400> 10
tctcccgaga ggtaaagaac 20
<210> 11
<211> 20
<212> DNA
<213>artificial sequence
<400> 11
gtgcatgcct tcacaaagcg 20
<210> 12
<211> 20
<212> DNA
<213>artificial sequence
<400> 12
cacttgaagg agaaggtgtc 20
<210> 13
<211> 25
<212> DNA
<213>artificial sequence
<400> 13
ggttttagat gttaaatcac actta 25
<210> 14
<211> 22
<212> DNA
<213>artificial sequence
<400> 14
gcatccacca gcacatcaat ga 22
<210> 15
<211> 22
<212> DNA
<213>artificial sequence
<400> 15
aattgcttgg ccgaagtgga ac 22
<210> 16
<211> 18
<212> DNA
<213>artificial sequence
<400> 16
aagttgtggc tatgattg 18
<210> 17
<211> 20
<212> DNA
<213>artificial sequence
<400> 17
ctcggagctg accagtgaag 20
<210> 18
<211> 24
<212> DNA
<213>artificial sequence
<400> 18
cccccctgcg tgatgatgaa atcg 24
Claims (9)
1. a kind of primer sets of gene polymorphism sites detection, which is characterized in that the gene is 5-FU class pharmaceutical relevant gene,
The primer sets include one of primer combination 1- primer combination 6 or a variety of combinations；
Wherein, primer combination 1 includes: to detect to draw shown in amplimer shown in SEQ ID NO.1-2 and SEQ ID NO.13
Object；
Primer combination 2 includes: detection primer shown in amplimer shown in SEQ ID NO.3-4 and SEQ ID NO.14；
Primer combination 3 includes: detection primer shown in amplimer shown in SEQ ID NO.5-6 and SEQ ID NO.15；
Primer combination 4 includes: detection primer shown in amplimer shown in SEQ ID NO.7-8 and SEQ ID NO.16；
Primer combination 5 includes: detection primer shown in amplimer shown in SEQ ID NO.9-10 and SEQ ID NO.17；
Primer combination 6 includes: detection primer shown in amplimer shown in SEQ ID NO.11-12 and SEQ ID NO.18.
2. a kind of kit of gene polymorphism sites detection, which is characterized in that it includes primer sets described in claim 1.
3. a kind of method of gene polymorphism sites detection, which is characterized in that the gene is 5-FU class pharmaceutical relevant gene,
Include the following steps:
(1) PCR amplification is carried out to sample using the amplimer in primer sets described in claim 1, obtains the first amplification production
Object；
(2) the first amplification after alkaline phosphatase treatment is produced using the detection primer in primer sets described in claim 1
Object carries out single base extension, obtains the second amplified production；
(3) polymorphism of second amplified production is analyzed using ionization time of flight.
4. according to the method described in claim 3, it is characterized in that, the amplimer is dense in system in step (1)
Degree is 0.8-1.2 μM.
5. according to the method described in claim 3, it is characterized in that, carrying out the annealing of the program of PCR amplification in step (1)
Temperature are as follows: 55-57 DEG C.
6. according to the method described in claim 3, it is characterized in that, the system for carrying out PCR amplification contains: drawing in step (1)
Object combines the amplimer of 1- primer combination 6, Mg2+, dNTPs and Taq archaeal dna polymerase.
7. according to the described in any item methods of claim 3-6, which is characterized in that in step (2), it is anti-to carry out Single base extension
The system answered contains: primer combines the detection primer and the first amplified production of 1- primer combination 6.
8. the method according to the description of claim 7 is characterized in that the detection primer is in the system of single base extension
Total concentration be 5-7 μM.
9. according to the method described in claim 8, it is characterized in that, each detection primer of primer combination 1- primer combination 6 is in list
Concentration in the system of base extension be respectively as follows: 1.125 μM, 0.983 μM, 1.005 μM, 0.808 μM, 0.907 μM and
1.078μM。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811654434.8A CN109593853A (en) | 2018-12-30 | 2018-12-30 | Primer sets, kit and the method for gene polymorphism sites detection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811654434.8A CN109593853A (en) | 2018-12-30 | 2018-12-30 | Primer sets, kit and the method for gene polymorphism sites detection |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109593853A true CN109593853A (en) | 2019-04-09 |
Family
ID=65965845
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811654434.8A Pending CN109593853A (en) | 2018-12-30 | 2018-12-30 | Primer sets, kit and the method for gene polymorphism sites detection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109593853A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114317748A (en) * | 2021-12-28 | 2022-04-12 | 江苏先声医学诊断有限公司 | DDPCR-based AML minimal residual lesion monitoring method, kit and application thereof |
-
2018
- 2018-12-30 CN CN201811654434.8A patent/CN109593853A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| A RUZZO等: "Dihydropyrimidine dehydrogenase pharmacogenetics for predicting fluoropyrimidine-related toxicity in the randomised, phase III adjuvant TOSCA trial in high-risk colon cancer patients", 《BRITISH JOURNAL OF CANCER》 * |
| ARSALAN AMIRFALLAH等: "DPYD, TYMS and MTHFR Genes Polymorphism Frequencies in a Series of Turkish Colorectal Cancer Patients", 《J PERS MED》 * |
| ZHANG X等: "Polymorphism of methylenetetrahydrofolate reductase gene is associated with response to fluorouracil-based chemotherapy in Chinese patients with gastric cancer", 《CHIN MED J (ENGL)》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114317748A (en) * | 2021-12-28 | 2022-04-12 | 江苏先声医学诊断有限公司 | DDPCR-based AML minimal residual lesion monitoring method, kit and application thereof |
| CN114317748B (en) * | 2021-12-28 | 2023-09-29 | 江苏先声医学诊断有限公司 | AML minimal residual lesion monitoring method based on ddPCR, kit and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109593854A (en) | Nucleic acid group and application suitable for the detection of tumour class pharmaceutical relevant gene SNP site | |
| CN109468377A (en) | For the primer sets of antipsychotics related gene polymorphism site primer, kit and method | |
| CN114085903B (en) | Primer pair probe combination product for detecting mitochondria 3243A & gtG mutation, kit and detection method thereof | |
| EP3438283A1 (en) | Method for detecting gene mutation | |
| CN109182509B (en) | Primer group, kit and method for detecting polymorphic sites of hypertension-related drug genes | |
| WO2023142619A1 (en) | Marker for dilated cardiomyopathy genetic detection and use thereof | |
| CN104830852A (en) | Multiplex real-time fluorescent PCR (polymerase chain reaction) method for detecting HLA-B*15:02 alleles | |
| CN112226505A (en) | Respiratory system disease gene SNP locus typing optimization method | |
| CN106834434B (en) | Nucleic acid, kit and method for detecting COX-1, COX-2 and GPIIIa gene polymorphism | |
| US20060073479A1 (en) | Single nucleotide polymorphisms and combinations thereof predictive for paclitaxel responsiveness | |
| CN109593853A (en) | Primer sets, kit and the method for gene polymorphism sites detection | |
| CN109468379A (en) | Detect the nucleotide and detection method of the SNP site of gene relevant to anti-epileptic class drug | |
| Liu et al. | A mixture detection method based on separate amplification using primer specific alleles of INDELs-a study based on two person's DNA mixture | |
| CN109385479A (en) | Detect the kit and method for dredging purine medicaments related gene SNP | |
| CN110157800B (en) | Detection primer group, kit, system and method for mental drug related gene | |
| CN105886599A (en) | ARMS-qPCR detection kit and detection method for ABCB1 genotyping | |
| ES2907028T3 (en) | Method for confirming variants in an NGS panel test by SNP genotyping | |
| CN101796185A (en) | The method of amplification methylated nucleic acid or non-methylated nucleic acid | |
| CN102676661B (en) | Fluorescent polarization based homogeneous phase detection method of single nucleotide polymorphism of codon118 of ERCC1 (excision repair cross-complementing 1) gene | |
| WO2020064006A2 (en) | Gene group used for breast cancer molecular typing and distant metastasis risk, diagnostic product, and application | |
| CN109385480A (en) | Detect the primer sets and detection method in platinum medicine related gene polymorphism site | |
| CN104789652A (en) | ABCB1 genotype rapid detection kit and method thereof | |
| CN104152542B (en) | Tumor ABL1 gene loci parting detecting reagent, using method and application | |
| CN111197078A (en) | Method for distinguishing nifedipine personalized medicine by mass spectrometry through product detection | |
| CN104419759A (en) | Detection method and detection kit for single nucleotide polymorphism site rs7975232 of lung cancer susceptibility gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190409 |
|
| RJ01 | Rejection of invention patent application after publication |