CN109182509B - Primer group, kit and method for detecting polymorphic sites of hypertension-related drug genes - Google Patents
Primer group, kit and method for detecting polymorphic sites of hypertension-related drug genes Download PDFInfo
- Publication number
- CN109182509B CN109182509B CN201811272890.6A CN201811272890A CN109182509B CN 109182509 B CN109182509 B CN 109182509B CN 201811272890 A CN201811272890 A CN 201811272890A CN 109182509 B CN109182509 B CN 109182509B
- Authority
- CN
- China
- Prior art keywords
- seq
- primer
- detection
- amplification
- primers shown
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer group, a kit and a method for detecting gene polymorphism sites of hypertension-related drugs, and relates to the technical field of gene polymorphism detection. The primer group comprises one or more of a primer combination 1-a primer combination 19. The primer group can be used for simultaneously detecting the polymorphism of a plurality of SNP sites of a plurality of hypertension-related drug genes, and has the characteristics of low cost, simple result interpretation, no interference among the SNP sites and the like.
Description
Technical Field
The invention relates to the technical field of gene polymorphism detection, in particular to a primer group, a kit and a method for detecting gene polymorphism sites of hypertension-related medicines.
Background
Hypertension is the most common chronic non-infectious disease, causes complications of organs such as heart, brain, kidney and the like, is the most important risk factor of cardiovascular diseases, and is influenced by genetic and environmental factors. At present, the new drugs for treating hypertension are endlessly developed, but the control of blood pressure cannot be obviously improved, the main reasons are that the curative effect and the adverse reaction of the drugs are unstable, the difference among individuals is obvious, and genetic factors are one of the main factors influencing the difference of drug reactions.
Researches find that the occurrence of hypertension is related to multiple gene phenotypes, and the gene phenotypes are different, so that the treatment effects of the antihypertensive drugs are remarkably different. Therefore, in order to obtain the best antihypertensive effect, doctors should select appropriate antihypertensive drugs according to the genotype data of patients, i.e., select effective treatment schemes according to individual genetic characteristics (genotypes). Realizes gene-oriented individualized medicine treatment and 'quantitative medicine application'.
The traditional detection method mainly comprises sanger sequencing, fragment analysis or single base extension technology, and only 1 or a plurality of gene loci are detected in each reaction. The problems of low detection efficiency and low flux exist. The traditional detection method has a long detection period for completing one detection, and needs more experimenters; meanwhile, in the detection matching reagent, a fluorescence labeling primer or ddNTP or a long-fragment primer is needed, so the cost is higher. Because the drug metabolism genes have more repetitive sequences in the genome, the traditional detection method is difficult to amplify and detect the genes. The traditional detection method has long experimental process, repeated uncovering of sample holes and multiple sample adding times; meanwhile, multiple gene loci in the same reaction are amplified competitively, and the related interference is large. The original results obtained by the traditional detection method cannot be visually displayed on an instrument, a laboratory technician is required to set parameter analysis by himself, and the result interpretation is complex. The traditional detection method needs a fluorescence-labeled primer or ddNTP or a long-segment primer, and detection failure is easily caused by long-time exposure at room temperature or under the condition of illumination or excessive repeated freezing and thawing times, and the failure rate is high.
In view of this, the invention is particularly proposed.
Disclosure of Invention
The invention aims to provide a primer group for detecting the polymorphic sites of hypertension-related drug genes, which can be used for simultaneously detecting the polymorphism of a plurality of SNP sites of a plurality of hypertension-related drug genes and has the characteristics of low cost, simple result interpretation, no interference among the SNP sites and the like.
The invention also aims to provide a kit for detecting the polymorphic sites of the hypertension-related drug genes, which can be used for simultaneously detecting the polymorphism of a plurality of SNP sites of a plurality of hypertension-related drug genes and has the characteristics of low cost, simple result interpretation, no interference among the SNP sites and the like.
The invention also aims to provide a method for detecting the polymorphic sites of the hypertension-related drug genes, which can simultaneously detect the polymorphism of a plurality of SNP sites of a plurality of hypertension-related drug genes and has the characteristics of low cost, simple result interpretation, no interference among the SNP sites and the like.
The invention is realized by the following steps:
in one aspect, the invention provides a primer group for detecting a gene polymorphism site of a hypertension-related medicine, which comprises one or more of a primer combination 1-a primer combination 19;
wherein, the primer combination 1 comprises: an amplification primer shown as SEQ ID NO.1-2 and a detection primer shown as SEQ ID NO. 40;
the primer combination 2 comprises: an amplification primer shown in SEQ ID NO.3-4 and a detection primer shown in SEQ ID NO. 41;
the primer combination 3 comprises: amplification primers shown as SEQ ID NO.5-6 and detection primers shown as SEQ ID NO. 42;
the primer combination 4 comprises: amplification primers shown as SEQ ID NO.7-8 and detection primers shown as SEQ ID NO. 43;
the primer combination 5 comprises: amplification primers shown as SEQ ID NO.9-10 and detection primers shown as SEQ ID NO. 44;
the primer combination 6 comprises: amplification primers shown as SEQ ID NO.11-12 and detection primers shown as SEQ ID NO. 45;
the primer combination 7 includes: amplification primers shown as SEQ ID NO.13-14 and detection primers shown as SEQ ID NO. 46;
the primer combination 8 includes: amplification primers shown as SEQ ID NO.15-16 and detection primers shown as SEQ ID NO. 47;
the primer combination 9 includes: amplification primers shown as SEQ ID NO.17-18 and detection primers shown as SEQ ID NO. 48;
the primer combination 10 includes: amplification primers shown as SEQ ID NO.19-20 and detection primers shown as SEQ ID NO. 49;
the primer combination 11 includes: the amplification primers shown as SEQ ID NO.21-22 and the detection primers shown as SEQ ID NO. 50;
the primer combination 12 includes: the amplification primers shown in SEQ ID NO.23-24 and the detection primer shown in SEQ ID NO. 51;
the primer combination 13 includes: the amplification primers shown as SEQ ID NO.25-26 and the detection primer shown as SEQ ID NO. 52;
the primer combination 14 includes: amplification primers shown as SEQ ID NO.27-28 and detection primers shown as SEQ ID NO. 53;
the primer combination 15 includes: amplification primers shown as SEQ ID NO.29-30 and detection primers shown as SEQ ID NO. 54;
the primer combination 16 includes: amplification primers shown as SEQ ID NO.31-32 and detection primers shown as SEQ ID NO. 55;
the primer combination 17 includes: amplification primers shown as SEQ ID NO.33-34 and detection primers shown as SEQ ID NO. 56;
the primer combination 18 includes: the amplification primers shown as SEQ ID NO.35-36 and the detection primers shown as SEQ ID NO. 57;
the primer combination 19 includes: amplification primers shown as SEQ ID NO.37-39 and detection primers shown as SEQ ID NO. 58.
The genes detected by the primer combinations 1-19 and the corresponding SNP site information are shown in the following table 1.
TABLE 1
Note: WT represents wild type; ATA-CCC is a long fragment insertion with the specific sequence of ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC.
By adopting the primer group provided by the invention, 19 hypertension-related drug genes such as NAT2, ADRB2, CYP2C9, PLCD3, PRKCA, NAT2, ADRB1, CYP3A4, MMP3, YEATS4, CYP2C19, ACE, NPPA, AGTR1, GNB3, YEATS4, CYP3A5 and 19 SNP sites corresponding to ACE, such as rs1041983, rs1042714, rs1057910, rs12946454, rs16960228, rs1799930, rs 1801251253, rs 6722409, rs3025058, rs 9772610, rs4244285, rs4291, rs4344, rs5065, rs5186, rs5443, rs7297610, rs776746 and rs1799752 are detected at the same time by combining with a time-of-flight mass spectrometry technology, and the method has the characteristics of low cost, simple and interference-free detection results of SNP sites, and the like.
In another aspect, the invention provides a kit for detecting a gene polymorphism site of a hypertension-related drug, which comprises the primer set.
By adopting the kit provided by the invention, 19 hypertension-related drug genes such as NAT2, ADRB2, CYP2C9, PLCD3, PRKCA, NAT2, ADRB1, CYP3A4, MMP3, YEATS4, CYP2C19, ACE, NPPA, AGTR1, GNB3, YEATS4, CYP3A5 and 19 SNP sites corresponding to ACE such as rs 1981043, rs1042714, rs1057910, rs12946454, rs 169022968, rs1799930, rs 1801251253, rs 6722409, rs 5053023023023023023023028, rs7297610, rs4244285, rs4291, rs4344, rs5065, rs5186, rs5443, rs7297610, rs 776776752 and rs1799752 polymorphisms can be detected simultaneously by combining with a time-of-flight mass spectrometry technology, and the kit has the characteristics of low cost, simple operation and non-interference detection results, simple detection results, and non-interference detection results of SNP sites, etc.
In another aspect, the present invention provides a method for detecting a polymorphic site of a gene of a hypertension-related drug, comprising the following steps:
(1) performing PCR amplification on a sample by using the amplification primers in the primer set according to claim 1 to obtain a first amplification product;
(2) performing a single base extension reaction on the first amplification product treated with alkaline phosphatase by using the detection primers in the primer set according to claim 1 to obtain a second amplification product;
(3) analyzing the second amplification product for polymorphisms using time-of-flight mass spectrometry techniques.
Further, in some embodiments of the present invention, in step (1), the system for performing PCR amplification comprises: amplification primers for primer combination 1-primer combination 19, Mg2+dNTPs and Taq DNA polymerase.
Further, in some embodiments of the present invention, in step (1), the system for performing PCR amplification is as follows:
| reagent | Volume (μ L) |
| ddH2O | 0.8 |
| 10x PCR buffer | 0.5 |
| MgCl2 | 0.4 |
| dNTP Mix | 0.1 |
| Primer Mix | 1.0 |
| PCR Enzyme | 0.2 |
| DNA | 2.0 |
| total | 5.0 |
Further, in some embodiments of the present invention, in step (1), the annealing temperature of the procedure for performing PCR amplification is: 55-57 ℃.
Further, in some embodiments of the present invention, in step (1), the procedure for performing PCR amplification is as follows:
further, in some embodiments of the present invention, in the step (2), the system for performing the single base extension reaction comprises: primer combination 1-detection primer of primer combination 19 and first amplification product.
Further, in some embodiments of the present invention, in the step (2), the system for performing the single base extension reaction is as follows:
| reagent | Volume (μ L) |
| ddH2O | 0.62 |
| IPLEX buffer | 0.2 |
| IPLEX Termination Mix | 0.2 |
| IPLEX Primer Mix | 0.94 |
| IPLEX Pro Enzyme | 0.04 |
| First amplification product | 7.0 |
| total | 9.0 |
Further, in some embodiments of the invention, in step (2), the annealing temperature of the procedure for performing the single base extension reaction is: the annealing time is as follows at 51-53℃: 4-6 s.
Further, in some embodiments of the present invention, in step (2), the procedure for performing the single base extension reaction is as follows:
by adopting the kit provided by the invention, 19 hypertension-related drug genes such as NAT2, ADRB2, CYP2C9, PLCD3, PRKCA, NAT2, ADRB1, CYP3A4, MMP3, YEATS4, CYP2C19, ACE, NPPA, AGTR1, GNB3, YEATS4, CYP3A5 and 19 SNP sites corresponding to ACE such as rs 1981043, rs1042714, rs1057910, rs12946454, rs 169022968, rs1799930, rs 1801251253, rs 6722409, rs 5053023023023023023023028, rs7297610, rs4244285, rs4291, rs4344, rs5065, rs5186, rs5443, rs7297610, rs 776776752 and rs1799752 polymorphisms can be detected simultaneously by combining with a time-of-flight mass spectrometry technology, and the kit has the characteristics of low cost, simple operation and non-interference detection results, simple detection results, and non-interference detection results of SNP sites, etc.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.
FIG. 1 shows the results of detection of control primer 1 in Experimental example 1.
FIG. 2 shows the results of detection of control primer 2 in Experimental example 1.
FIG. 3 shows the results of detection of the primer set 19 in Experimental example 1.
FIG. 4 shows the results of detection of samples by the control primer 3 in Experimental example 2.
FIG. 5 shows the results of detection of samples by the control primer 3 in Experimental example 2.
FIG. 6 shows the result of the wild homozygous detection of the primer set 10 in Experimental example 2.
FIG. 7 shows the results of mutation hybridization detection of the primer set 10 in Experimental example 2.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
The features and properties of the present invention are described in further detail below with reference to examples.
Example 1
The kit for detecting the polymorphic sites of the hypertension-related drug gene comprises a primer group for detecting the polymorphic sites of the hypertension-related drug gene, wherein the primer group comprises the following primer combination 1-primer combination 19.
Wherein, the primer combination 1 comprises: amplification primers shown as SEQ ID NO.1-2 (rs1041983-F and rs1041983-R) and a detection primer shown as SEQ ID NO.40 (rs 1041983-E);
the primer combination 2 comprises: amplification primers (rs1042714-F and rs1042714-R) shown in SEQ ID NO.3-4 and a detection primer (rs1042714-E) shown in SEQ ID NO. 41;
the primer combination 3 comprises: amplification primers (rs1057910-F and rs1057910-R) shown in SEQ ID NO.5-6 and a detection primer (rs1057910-E) shown in SEQ ID NO. 42;
the primer combination 4 comprises: amplification primers (rs12946454-F and rs12946454-R) shown in SEQ ID NO.7-8 and a detection primer (rs12946454-E) shown in SEQ ID NO. 43;
the primer combination 5 comprises: amplification primers (rs16960228-F and rs16960228-R) shown in SEQ ID NO.9-10 and a detection primer (rs16960228-E) shown in SEQ ID NO. 44;
the primer combination 6 comprises: amplification primers (rs1799930-F and rs1799930-R) shown in SEQ ID NO.11-12 and detection primers (rs1799930-E) shown in SEQ ID NO. 45;
the primer combination 7 includes: amplification primers (rs1801253-F and rs1801253-R) shown in SEQ ID NO.13-14 and detection primers (rs1801253-E) shown in SEQ ID NO. 46;
the primer combination 8 includes: amplification primers (rs2246709-F and rs2246709-R) shown in SEQ ID NO.15-16 and a detection primer (rs2246709-E) shown in SEQ ID NO. 47;
the primer combination 9 includes: amplification primers (rs3025058-F and rs3025058-R) shown in SEQ ID NO.17-18 and a detection primer (rs3025058-E) shown in SEQ ID NO. 48;
the primer combination 10 includes: amplification primers (rs4149601-F and rs4149601-R) shown in SEQ ID NO.19-20 and detection primer (rs4149601-E) shown in SEQ ID NO. 49;
the primer combination 11 includes: amplification primers (rs4244285-F and rs4244285-R) shown as SEQ ID NO.21-22 and a detection primer (rs4244285-E) shown as SEQ ID NO. 50;
the primer combination 12 includes: amplification primers (rs4291-F and rs4291-R) shown in SEQ ID NO.23-24 and a detection primer (rs4291-E) shown in SEQ ID NO. 51;
the primer combination 13 includes: amplification primers (rs4344-F and rs4344-R) shown in SEQ ID NO.25-26 and a detection primer (rs4344-E) shown in SEQ ID NO. 52;
the primer combination 14 includes: amplification primers (rs5065-F and rs5065-R) shown in SEQ ID NO.27-28 and a detection primer (rs5065-E) shown in SEQ ID NO. 53;
the primer combination 15 includes: amplification primers (rs5186-F and rs5186-R) shown as SEQ ID NO.29-30 and a detection primer (rs5186-E) shown as SEQ ID NO. 54;
the primer combination 16 includes: amplification primers (rs5443-F and rs5443-R) shown in SEQ ID NO.31-32 and a detection primer (rs5443-E) shown in SEQ ID NO. 55;
the primer combination 17 includes: amplification primers (rs7297610-F and rs7297610-R) shown in SEQ ID NO.33-34 and detection primer (rs7297610-E) shown in SEQ ID NO. 56;
the primer combination 18 includes: amplification primers shown as SEQ ID NO.35-36 (rs776746-F and rs776746-R) and detection primer shown as SEQ ID NO.57 (rs 776746-E);
the primer combination 19 includes: the amplification primers (rs1799752-F, rs1799752-R1 and rs1799752-R2) shown in SEQ ID NO.37-39 and the detection primer (rs1799752-E) shown in SEQ ID NO. 58.
The primer sequences are shown in table 2 below:
TABLE 2
The sequences of the detection primers are shown in table 3:
TABLE 3
Of course, in other embodiments, the primer set includes any combination of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 and 18 of the primer combinations 1-19. On the basis of the present invention, those skilled in the art can arbitrarily combine the primer combinations 1 to 19 according to the type and number of the target gene to be detected. Any combination is within the scope of the present invention as long as it is selected from the group consisting of primer combination 1-primer combination 19.
The kit of the embodiment can simultaneously detect 19 hypertension-related drug genes, namely NAT2, ADRB2, CYP2C9, PLCD3, PRKCA, NAT2, ADRB1, CYP3A4, MMP3, YEATS4, CYP2C19, ACE, NPPA, AGTR1, GNB3, YEATS4, CYP3A5 and 19 SNP sites corresponding to ACE, namely rs1041983, rs1042714, rs1057910, rs12946454, rs16960228, rs1799930, rs1801253, rs 6722409, rs3025058, rs7297610, rs4244285, rs4291, rs4344, rs5065, rs5186, rs 54746, rs7297610, rs 17776752 and rs1799752 polymorphisms, and has the characteristics of low cost, simple interpretation of results, no interference between SNP detection results and the like.
The detection method by adopting the kit comprises the following steps:
(1) carrying out PCR amplification on a sample by using the amplification primers in the primer group to obtain a first amplification product;
the method comprises the following steps:
| reagent | Volume (μ L) | Final concentration |
| ddH2O | 0.8 | n/a |
| 10x PCR buffer | 0.5 | 1x |
| MgCl2 | 0.4 | 2mM |
| dNTP Mix | 0.1 | 500μM |
| Primer Mix | 1.0 | 1μM |
| PCR Enzyme | 0.2 | 0.2U/μL |
| DNA | 2.0 | 10-20ng |
| total | 5.0 | n/a |
Note: 1. all reagents for detection in the present invention were purchased from Agena Bioscience (Kinna Biotechnology (Shanghai) Co., Ltd.), and the same applies below;
the Primer Mix is a mixture prepared by all amplification primers in a concentration ratio of 1:1, and the final concentration of all the primers in the reaction is 1 mu M;
n/a indicates this is not significant.
The procedure is as follows:
(2) carrying out single base extension reaction on the first amplification product treated by alkaline phosphatase by using the detection primer in the primer group to obtain a second amplification product;
the system is as follows:
note: IPLEX Primer Mix is a mixture of all detection primers, and the detection Primer configuration table (taking the configuration of 100. mu.L as an example) is as follows:
the procedure was as follows:
(3) analyzing the second amplification product for polymorphism using time-of-flight mass spectrometry.
The genotype of the SNP site can be determined according to the peak position of the molecular weight of the detection primer and the second amplification product thereof, as shown in Table 4 below:
TABLE 4
Note: WT represents wild type; ATA-CCC is a long fragment insertion with the specific sequence of ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC.
Example 2
20 samples (all from clinical, sample type was whole blood or buccal swab) with known SNP site genotypes listed in Table 1 were tested using the kit and method of example 1, and the results are shown in tables 5-7 below.
TABLE 5
TABLE 6
TABLE 7
Experimental example 1
Aiming at the locus rs1799752, the gene structure is complex, and more SNP loci exist around the locus. The NCBI database shows that 4 SNP sites exist within 3 bases of the rs1799752 site, such as rs1314686756, rs200461879, rs199774979 and rs 144611316; there are 9 SNP sites within the range of 5 bases, 16 SNP sites within the range of 10 bases, and 23 SNP sites within the range of 20 detection ranges. At the positions of the SNP sites, the detection primers are easy to mismatch or fail to pair, and the detection fails. In addition, the rs1799752 site is not a single base mutation, is a single base G insertion mutation or a long fragment insertion mutation, has a longer fragment repetitive sequence, is similar to the mutation forms (including insertion sequence fragments) of the rs4340, rs13447447 and rs4646994 sites and is grafted in by sites, and the mutation forms of the sites are shown as follows:
wild type:
TCCCATTTCTCTAGACCTGCTGCCTATACAGTCACTTTTATGTGGTTTCG；
mutant 1:
TCCCATTTCTCTAGACCTGCTGCCTATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCT GTCGCCCATACAGTCACTTTTATGTGGTTTCG；
mutant type 2:
TCCCATTTCTCTAGACCTGCTGCCTGATACAGTCACTTTTATGTGGTTTCG。
the insertion mutant sequence is underlined.
In addition, the genome has pseudogenes, which are very easy to amplify to obtain non-target fragments, so that the general strategy in primer design is to amplify as long as possible fragments, and then to detect, which easily causes less single detection sites and less flux (such as sequencing analysis and fragment analysis); if the amplification length is reduced, the detection is easy to fail.
Compared with other primer schemes, the primer combination 19 for detecting the rs1799752 locus polymorphism, which is obtained by the inventor through scientific and reasonable design, has a better amazing effect. The results of comparison of the detection effects of the primer combination 19 and other control primers are as follows:
(1) control amplification primer 1:
CTGGAGACCACTCCCATCCTTTCT;
r (representing a downstream primer, the same applies hereinafter) GATGTGGCCATCACATTCGTCAGAT.
The wild type amplification product 191bp and the mutant type amplification product 192bp or 241bp can be obtained by using the pair of amplification primers.
The results of mass spectrometry using the control amplification primer 1 are shown in FIG. 1. The leftmost red line in the graph represents the detection primer, the right 3 lines represent the detection product, and the results are genotype WT/G (i.e., G-insert heterozygote) as shown by the 3 different genotypes. As a result, false positives (G base insertion positives) were found, and the frequency of G insertion mutations was less than 0.1% in the real case, as shown by the NCBI database. This indicates that the site is unstable and false positive is present when the primer is used.
(2) Control amplification primer 2:
F:GGGAGCTCAGAGAATTTCAG；
R:CTCCCATTTCTCTAGACCTG。
the wild type amplification product 88bp and the mutant type amplification product 89bp or 138bp can be obtained by using the pair of amplification primers.
The results of mass spectrometry using this control amplification primer 2 are shown in FIG. 2. The leftmost red line in the graph represents the detection primer, the right 3 lines represent the detection product, and the results are genotype WT/G (i.e., G-insert heterozygote) as shown by the 3 different genotypes. False positive (G base insertion positive) exists in the result, and the frequency of G insertion mutation is less than 0.1% under the real condition according to the NCBI database display; meanwhile, the existence of the remaining primers for detection and the uneven peak heights of the products detected by the wild type and the mutant type are also shown, which means that the site is not stable and false positive exists when the primers are used for detection.
(3) Aiming at the locus rs1799752, a single amplification fragment is designed, the amplification length is designed to be about 100bp, and insertion mutation can be specifically amplified.
Insertion type:
F:ACGTTGGATGGAGCCACTCCCATCCTTTCT，
R:ACGTTGGATGTGACTGTATGGGCGACAGAG。
wild type:
F:ACGTTGGATGGAGCCACTCCCATCCTTTCT，
R:ACGTTGGATGGCTTGTAAGGGGAGCTCAGA。
the detection is carried out, the amplification length is about 100bp, the insertion mutation can be specifically amplified, and the mass spectrometry result is shown in figure 3. The leftmost red line in the figure represents the detection primer, the right 2 color-labeled lines represent the detection product, and the results are shown as wild type, and the 2 different genotypes are respectively indicated. The result shows that the detection result is better, the genotyping is clear, and no false positive product is generated. Indicating that the primer can be used to detect the site, and the typing can be successfully carried out.
Experimental example 2
(1) The following control amplification primer 3 was designed for rs4149601 site:
F:AGGAAGGTAAAACCTCCTCC，
R:CTCCTAAATGAGACGTCTCG。
the amplification product can be obtained by 101bp by using the pair of amplification primers.
The results of mass spectrometry of two samples (No. 5 and No. 10) using the control primer are shown in FIG. 4 (No. 5) and FIG. 5 (No. 10), wherein the leftmost red line represents the detection primer, the right 2 red marked lines represent the detection product, and indicate 2 different genotypes, respectively, as shown in the figure, the results in FIG. 6 are no typing results, and the results in FIG. 7 are no typing results. The results showed that the primers for detection remained, no amplification resulted, and the genotyping failed. Indicating that the primer was used to detect the site and that typing could not be successful.
(2) The primer combination for detecting rs4149601 site polymorphism provided by the invention comprises the following components:
F:ACGTTGGATGAGGAAGGTAAAACCTCCTCC，
R:ACGTTGGATGTCCTAAATGAGACGTCTCGC。
the results of multiple mass spectrometric analyses using this primer combination are shown in fig. 6 (wild homozygous result, sample No. 5) and fig. 7 (mutant heterozygous result, sample No. 10), the leftmost red line in the figure represents the detection primer, the right 2 color marker lines represent the detection product, and simultaneously indicate 2 different genotypes, respectively, the result is G homozygous as shown in fig. 6, and the result is GA heterozygous as shown in fig. 7. The result shows that the detection result is better, the genotyping is clear, and no false positive product is generated. Indicating that the primer can be used to detect the site, and the typing can be successfully carried out.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> Guangzhou gold region medical examination group GmbH, Guangzhou gold region medical examination center GmbH
<120> primer group, kit and method for detecting polymorphic sites of hypertension-related drug genes
<160> 58
<170> PatentIn version 3.5
<210> 1
<211> 30
<212> DNA
<213> Artificial sequence
<400> 1
acgttggatg cagaccacaa tgttaggagg 30
<210> 2
<211> 30
<212> DNA
<213> Artificial sequence
<400> 2
acgttggatg ccatgccagt gctgtatttg 30
<210> 3
<211> 30
<212> DNA
<213> Artificial sequence
<400> 3
acgttggatg atgagagaca tgacgatgcc 30
<210> 4
<211> 29
<212> DNA
<213> Artificial sequence
<400> 4
acgttggatg agcgccttct tgctggcac 29
<210> 5
<211> 30
<212> DNA
<213> Artificial sequence
<400> 5
acgttggatg ctacacagat gctgtggtgc 30
<210> 6
<211> 30
<212> DNA
<213> Artificial sequence
<400> 6
acgttggatg tgtcacaggt cactgcatgg 30
<210> 7
<211> 29
<212> DNA
<213> Artificial sequence
<400> 7
acgttggatg tgccttcatc caacctgcc 29
<210> 8
<211> 30
<212> DNA
<213> Artificial sequence
<400> 8
acgttggatg tttatctgga gggcatcagg 30
<210> 9
<211> 30
<212> DNA
<213> Artificial sequence
<400> 9
acgttggatg tggtcactct cctctttctg 30
<210> 10
<211> 30
<212> DNA
<213> Artificial sequence
<400> 10
acgttggatg agatctgcag tacagctgtg 30
<210> 11
<211> 30
<212> DNA
<213> Artificial sequence
<400> 11
acgttggatg cctgccaaag aagaaacacc 30
<210> 12
<211> 30
<212> DNA
<213> Artificial sequence
<400> 12
acgttggatg acgtctgcag gtatgtattc 30
<210> 13
<211> 30
<212> DNA
<213> Artificial sequence
<400> 13
acgttggatg tcaaccccat catctactgc 30
<210> 14
<211> 29
<212> DNA
<213> Artificial sequence
<400> 14
acgttggatg ggtctccgtg ggtcgcgtg 29
<210> 15
<211> 30
<212> DNA
<213> Artificial sequence
<400> 15
acgttggatg ctgtcacaaa ccctgtcatc 30
<210> 16
<211> 30
<212> DNA
<213> Artificial sequence
<400> 16
acgttggatg atgaagtgtc cagaataggc 30
<210> 17
<211> 30
<212> DNA
<213> Artificial sequence
<400> 17
acgttggatg ccctgtattt caatcaggac 30
<210> 18
<211> 30
<212> DNA
<213> Artificial sequence
<400> 18
acgttggatg gcacctggcc taaagacatt 30
<210> 19
<211> 30
<212> DNA
<213> Artificial sequence
<400> 19
acgttggatg aggaaggtaa aacctcctcc 30
<210> 20
<211> 30
<212> DNA
<213> Artificial sequence
<400> 20
acgttggatg tcctaaatga gacgtctcgc 30
<210> 21
<211> 30
<212> DNA
<213> Artificial sequence
<400> 21
acgttggatg cactttccat aaaagcaagg 30
<210> 22
<211> 30
<212> DNA
<213> Artificial sequence
<400> 22
acgttggatg gcaataattt tcccactatc 30
<210> 23
<211> 30
<212> DNA
<213> Artificial sequence
<400> 23
acgttggatg gcagaggaag ctggagaaag 30
<210> 24
<211> 30
<212> DNA
<213> Artificial sequence
<400> 24
acgttggatg tcgggtgttc cggcaaactg 30
<210> 25
<211> 30
<212> DNA
<213> Artificial sequence
<400> 25
acgttggatg cacaatgttg tgatgggtgc 30
<210> 26
<211> 30
<212> DNA
<213> Artificial sequence
<400> 26
acgttggatg atctatgtcg ggcaagtcac 30
<210> 27
<211> 30
<212> DNA
<213> Artificial sequence
<400> 27
acgttggatg gtcaccaagc cagatatgtc 30
<210> 28
<211> 30
<212> DNA
<213> Artificial sequence
<400> 28
acgttggatg cctcttgcag tctgtcccta 30
<210> 29
<211> 30
<212> DNA
<213> Artificial sequence
<400> 29
acgttggatg ccacataatg cattttctcc 30
<210> 30
<211> 30
<212> DNA
<213> Artificial sequence
<400> 30
acgttggatg agaacattcc tctgcagcac 30
<210> 31
<211> 30
<212> DNA
<213> Artificial sequence
<400> 31
acgttggatg tcgtagccag cgaatagtag 30
<210> 32
<211> 30
<212> DNA
<213> Artificial sequence
<400> 32
acgttggatg tctcccacga gagcatcatc 30
<210> 33
<211> 30
<212> DNA
<213> Artificial sequence
<400> 33
acgttggatg taaccccgtt ttcccaacac 30
<210> 34
<211> 30
<212> DNA
<213> Artificial sequence
<400> 34
acgttggatg tcaaatcact cctcctttgc 30
<210> 35
<211> 30
<212> DNA
<213> Artificial sequence
<400> 35
acgttggatg gtaatgtggt ccaaacaggg 30
<210> 36
<211> 30
<212> DNA
<213> Artificial sequence
<400> 36
acgttggatg acccagctta acgaatgctc 30
<210> 37
<211> 30
<212> DNA
<213> Artificial sequence
<400> 37
acgttggatg gagccactcc catcctttct 30
<210> 38
<211> 30
<212> DNA
<213> Artificial sequence
<400> 38
acgttggatg gcttgtaagg ggagctcaga 30
<210> 39
<211> 30
<212> DNA
<213> Artificial sequence
<400> 39
acgttggatg tgactgtatg ggcgacagag 30
<210> 40
<211> 23
<212> DNA
<213> Artificial sequence
<400> 40
acaatgttag gagggtattt tta 23
<210> 41
<211> 15
<212> DNA
<213> Artificial sequence
<400> 41
acacctcgtc ccttt 15
<210> 42
<211> 17
<212> DNA
<213> Artificial sequence
<400> 42
accaggtcca gagatac 17
<210> 43
<211> 17
<212> DNA
<213> Artificial sequence
<400> 43
acactcactc ctgccca 17
<210> 44
<211> 20
<212> DNA
<213> Artificial sequence
<400> 44
<210> 45
<211> 22
<212> DNA
<213> Artificial sequence
<400> 45
gacttattta cgcttgaacc tc 22
<210> 46
<211> 16
<212> DNA
<213> Artificial sequence
<400> 46
acgcaaggcc ttccag 16
<210> 47
<211> 19
<212> DNA
<213> Artificial sequence
<400> 47
ccactaatca actttctgc 19
<210> 48
<211> 19
<212> DNA
<213> Artificial sequence
<400> 48
cggacaagac atggttttt 19
<210> 49
<211> 19
<212> DNA
<213> Artificial sequence
<400> 49
aagtcttacc gagtgttac 19
<210> 50
<211> 23
<212> DNA
<213> Artificial sequence
<400> 50
ttaagtaatt tgttatgggt tcc 23
<210> 51
<211> 15
<212> DNA
<213> Artificial sequence
<400> 51
gggcctcctc tcttt 15
<210> 52
<211> 21
<212> DNA
<213> Artificial sequence
<400> 52
aagattatta acttcttccc c 21
<210> 53
<211> 19
<212> DNA
<213> Artificial sequence
<400> 53
agtgttctct ttgcagtac 19
<210> 54
<211> 21
<212> DNA
<213> Artificial sequence
<400> 54
tcaattctga aaagtagcta a 21
<210> 55
<211> 16
<212> DNA
<213> Artificial sequence
<400> 55
cgagggagaa ggccac 16
<210> 56
<211> 21
<212> DNA
<213> Artificial sequence
<400> 56
gccagaattc atagaaggaa a 21
<210> 57
<211> 18
<212> DNA
<213> Artificial sequence
<400> 57
ccaaacaggg aagagata 18
<210> 58
<211> 24
<212> DNA
<213> Artificial sequence
<400> 58
cctgctgcct atacagtcac tttt 24
Claims (7)
1. A primer group for detecting the polymorphic sites of hypertension-related drug genes is characterized by comprising a primer combination 1-a primer combination 19;
wherein, the primer combination 1 is: an amplification primer shown as SEQ ID NO.1-2 and a detection primer shown as SEQ ID NO. 40;
the primer combination 2 is as follows: an amplification primer shown as SEQ ID NO.3-4 and a detection primer shown as SEQ ID NO. 41;
the primer combination 3 is as follows: amplification primers shown as SEQ ID NO.5-6 and detection primers shown as SEQ ID NO. 42;
the primer combination 4 is: amplification primers shown as SEQ ID NO.7-8 and detection primers shown as SEQ ID NO. 43;
the primer combination 5 is as follows: amplification primers shown as SEQ ID NO.9-10 and detection primers shown as SEQ ID NO. 44;
the primer combination 6 is as follows: amplification primers shown as SEQ ID NO.11-12 and detection primers shown as SEQ ID NO. 45;
the primer combination 7 is: amplification primers shown as SEQ ID NO.13-14 and detection primers shown as SEQ ID NO. 46;
the primer combination 8 is: amplification primers shown as SEQ ID NO.15-16 and detection primers shown as SEQ ID NO. 47;
the primer combination 9 is: amplification primers shown as SEQ ID NO.17-18 and detection primers shown as SEQ ID NO. 48;
the primer combination 10 is: amplification primers shown as SEQ ID NO.19-20 and detection primers shown as SEQ ID NO. 49;
the primer combination 11 is: the amplification primers shown as SEQ ID NO.21-22 and the detection primers shown as SEQ ID NO. 50;
the primer combination 12 is: the amplification primers shown in SEQ ID NO.23-24 and the detection primer shown in SEQ ID NO. 51;
the primer combination 13 is: the amplification primers shown as SEQ ID NO.25-26 and the detection primer shown as SEQ ID NO. 52;
the primer combination 14 is: amplification primers shown as SEQ ID NO.27-28 and detection primers shown as SEQ ID NO. 53;
the primer combination 15 is: amplification primers shown as SEQ ID NO.29-30 and detection primers shown as SEQ ID NO. 54;
the primer combination 16 is: amplification primers shown as SEQ ID NO.31-32 and detection primers shown as SEQ ID NO. 55;
the primer combination 17 is: amplification primers shown as SEQ ID NO.33-34 and detection primers shown as SEQ ID NO. 56;
the primer combination 18 is: the amplification primers shown as SEQ ID NO.35-36 and the detection primers shown as SEQ ID NO. 57;
the primer combination 19 is: amplification primers shown as SEQ ID NO.37-39 and detection primers shown as SEQ ID NO. 58.
2. A kit for detecting a gene polymorphism site of a hypertension-related drug, which comprises a primer set consisting of the 19 primer sets of claim 1.
3. The use of the primer set for detecting polymorphic sites in a gene of a hypertension-related drug according to claim 1 or the kit for detecting polymorphic sites in a gene of a hypertension-related drug according to claim 2 for preparing a reagent for detecting polymorphic sites in a gene of a hypertension-related drug, comprising the steps of:
(1) performing PCR amplification on a sample by using the amplification primers in the primer set according to claim 1 to obtain a first amplification product;
(2) performing a single base extension reaction on the first amplification product treated with alkaline phosphatase by using the detection primers in the primer set according to claim 1 to obtain a second amplification product;
(3) analyzing the second amplification product for polymorphism using time-of-flight mass spectrometry.
4. The use according to claim 3, wherein in step (1), the PCR amplification system comprises: amplification primers for primer combination 1-primer combination 19, Mg2+dNTPs and Taq DNA polymerase.
5. Use according to claim 3, wherein in step (1), the annealing temperature of the procedure for performing PCR amplification is: at the temperature of 55-57 ℃.
6. The use according to claim 3, wherein in step (2), the single base extension reaction is carried out in a system comprising: primer combination 1-detection primer of primer combination 19 and first amplification product.
7. Use according to claim 3, wherein in step (2) the annealing temperature of the procedure for carrying out the single base extension reaction is: the annealing time is as follows at 51-53℃: 4-6 s.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811272890.6A CN109182509B (en) | 2018-10-29 | 2018-10-29 | Primer group, kit and method for detecting polymorphic sites of hypertension-related drug genes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811272890.6A CN109182509B (en) | 2018-10-29 | 2018-10-29 | Primer group, kit and method for detecting polymorphic sites of hypertension-related drug genes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109182509A CN109182509A (en) | 2019-01-11 |
| CN109182509B true CN109182509B (en) | 2022-05-06 |
Family
ID=64944421
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811272890.6A Active CN109182509B (en) | 2018-10-29 | 2018-10-29 | Primer group, kit and method for detecting polymorphic sites of hypertension-related drug genes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109182509B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109652514A (en) * | 2019-02-25 | 2019-04-19 | 北京市理化分析测试中心 | A kind of CYP3A5 gene rs776746 loci polymorphism nucleic acid Mass Spectrometry detection method |
| CN110396539A (en) * | 2019-04-29 | 2019-11-01 | 广州海思医疗科技有限公司 | For detecting the kit and method of hypertension medication related gene polymorphism |
| CN111793682A (en) * | 2020-07-08 | 2020-10-20 | 广西医大睿谷医学检验有限公司 | Detection kit for polymorphism of gene related to individualized medication and application thereof |
| CN117286246A (en) * | 2023-11-21 | 2023-12-26 | 中日友好医院(中日友好临床医学研究所) | Method for screening antihypertensive effect of hydrochlorothiazide according to genotyping result |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101180408A (en) * | 2005-05-19 | 2008-05-14 | 西尼尔根茨生物科学有限公司 | Methods for the assessment of risk of developing lung cancer using analysis of genetic polymorphisms |
| CN101928757A (en) * | 2009-06-26 | 2010-12-29 | 上海主健生物工程有限公司 | Detection of curative effect of antihypertensive drug |
| CN106367479A (en) * | 2016-08-25 | 2017-02-01 | 杭州百迈生物股份有限公司 | Detection composition for guiding hypertension medication, applications of detection composition, kit and detection method |
| EP3149487A1 (en) * | 2014-05-29 | 2017-04-05 | Geneticure LLC | Improved therapeutic regimen for hypertension |
| CN106893783A (en) * | 2017-04-05 | 2017-06-27 | 李爱娟 | It is a kind of for the accurate early warning of cardiovascular and cerebrovascular disease risk and the detection method and primer special of accurate medication |
| CN107022611A (en) * | 2017-04-05 | 2017-08-08 | 李爱娟 | It is a kind of to be used for the method and primer special of 4 kinds of accurate medications of common clinical cardiovascular and cerebrovascular disease medicine of detection |
| CN107557432A (en) * | 2017-08-21 | 2018-01-09 | 上海派森诺医学检验所有限公司 | A kind of primer sets and detection kit for detecting hypertension medication related gene polymorphism |
| CN108004312A (en) * | 2017-12-20 | 2018-05-08 | 德诺杰亿（北京）生物科技有限公司 | Detect primer sets, kit and the method for angiocardiopathy related gene polymorphism |
| CN108531578A (en) * | 2018-04-26 | 2018-09-14 | 宁波美丽人生医学检验所有限公司 | A kind of Primer composition and kit for detecting hypertension medication related gene |
-
2018
- 2018-10-29 CN CN201811272890.6A patent/CN109182509B/en active Active
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101180408A (en) * | 2005-05-19 | 2008-05-14 | 西尼尔根茨生物科学有限公司 | Methods for the assessment of risk of developing lung cancer using analysis of genetic polymorphisms |
| CN101928757A (en) * | 2009-06-26 | 2010-12-29 | 上海主健生物工程有限公司 | Detection of curative effect of antihypertensive drug |
| EP3149487A1 (en) * | 2014-05-29 | 2017-04-05 | Geneticure LLC | Improved therapeutic regimen for hypertension |
| CN106367479A (en) * | 2016-08-25 | 2017-02-01 | 杭州百迈生物股份有限公司 | Detection composition for guiding hypertension medication, applications of detection composition, kit and detection method |
| CN108690876A (en) * | 2016-08-25 | 2018-10-23 | 杭州百迈生物股份有限公司 | Detect primer, probe and application, kit and the detection method of ACE gene pleiomorphisms |
| CN106893783A (en) * | 2017-04-05 | 2017-06-27 | 李爱娟 | It is a kind of for the accurate early warning of cardiovascular and cerebrovascular disease risk and the detection method and primer special of accurate medication |
| CN107022611A (en) * | 2017-04-05 | 2017-08-08 | 李爱娟 | It is a kind of to be used for the method and primer special of 4 kinds of accurate medications of common clinical cardiovascular and cerebrovascular disease medicine of detection |
| CN107557432A (en) * | 2017-08-21 | 2018-01-09 | 上海派森诺医学检验所有限公司 | A kind of primer sets and detection kit for detecting hypertension medication related gene polymorphism |
| CN108004312A (en) * | 2017-12-20 | 2018-05-08 | 德诺杰亿（北京）生物科技有限公司 | Detect primer sets, kit and the method for angiocardiopathy related gene polymorphism |
| CN108531578A (en) * | 2018-04-26 | 2018-09-14 | 宁波美丽人生医学检验所有限公司 | A kind of Primer composition and kit for detecting hypertension medication related gene |
Non-Patent Citations (2)
| Title |
|---|
| Association of VEGF and VEGFR2 Single Nucleotide Polymorphisms with Hypertension and Clinical Outcome in Metastatic Clear Cell Renal Cell Carcinoma Patients Treated With Sunitinib;Jenny J. Kim,等;《Cancer》;20120401;1946-1954 * |
| Hypertension and SNP Genotyping in Antihypertensive Treatment;Lisa Kurland，et al;《Cardiovascular Toxicology》;20051231;133-142 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109182509A (en) | 2019-01-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109182509B (en) | Primer group, kit and method for detecting polymorphic sites of hypertension-related drug genes | |
| Lahr et al. | Reducing the impact of PCR-mediated recombination in molecular evolution and environmental studies using a new-generation high-fidelity DNA polymerase | |
| US11319589B2 (en) | Methods of determining the presence or absence of a plurality of target polynucleotides in a sample | |
| EP2660331B1 (en) | Method for single cell genome analysis and kit therefor | |
| JP2009502137A (en) | Method for rapid identification and quantification of nucleic acid variants | |
| Almeida et al. | Interlaboratory study to validate a STR profiling method for intraspecies identification of mouse cell lines | |
| CN109468377A (en) | For the primer sets of antipsychotics related gene polymorphism site primer, kit and method | |
| CN111394506B (en) | Wheat molecular marker and application thereof in identifying wheat grain weight characteristics | |
| WO2014101655A1 (en) | Method for analyzing high-throughput nucleic acid and application thereof | |
| US20220205025A1 (en) | Comparative analysis of microsatellites by capillary electrophoresis (ce) dna profiles | |
| TWI715900B (en) | A primer for next generation sequencer and a method for producing the same, a dna library obtained through the use of a primer for next generation sequencer and a method for producing the same, and a dna analyzing method using a dna library | |
| CN109593854A (en) | Nucleic acid group and application suitable for the detection of tumour class pharmaceutical relevant gene SNP site | |
| KR20180077871A (en) | SNP markers for discrimination of Jubilee type or Crimson type watermelon cultivar | |
| CN109715798A (en) | The production method of DNA library and the genomic DNA analysis method for using DNA library | |
| CN110564861B (en) | Fluorescent marker composite amplification kit for human Y chromosome STR locus and InDel locus and application thereof | |
| CN110846408A (en) | Primer combination for detecting TTN gene mutation and application thereof | |
| CN109468379A (en) | Detect the nucleotide and detection method of the SNP site of gene relevant to anti-epileptic class drug | |
| EP3371320A2 (en) | Systems and methods of diagnosing and characterizing infections | |
| Li et al. | Application of microarray-based method for methylenetetrahydrofolate reductase (MTHFR) polymorphisms in the risk of gastric carcinoma in east China population | |
| Fortuna et al. | Polymorphic microsatellite markers for the tetrapolar anther-smut fungus Microbotryum saponariae based on genome sequencing | |
| CN112708658B (en) | Liquid chip primer group for detecting multiple drug-resistant genes and application thereof | |
| RU2740798C1 (en) | Markers for marker selection of soya according to utility signs | |
| Shirk et al. | Development and characterization of microsatellite primers in Geranium carolinianum (Geraniaceae) with 454 sequencing | |
| WO2018212318A1 (en) | Set of random primers and method for preparing dna library using the same | |
| KR102575912B1 (en) | Single nucleotide polymorphism marker for discriminating cabbage having low content of sinigrin and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |