CN109468379A - Detect the nucleotide and detection method of the SNP site of gene relevant to anti-epileptic class drug - Google Patents
Detect the nucleotide and detection method of the SNP site of gene relevant to anti-epileptic class drug Download PDFInfo
- Publication number
- CN109468379A CN109468379A CN201811654872.4A CN201811654872A CN109468379A CN 109468379 A CN109468379 A CN 109468379A CN 201811654872 A CN201811654872 A CN 201811654872A CN 109468379 A CN109468379 A CN 109468379A
- Authority
- CN
- China
- Prior art keywords
- primer
- seq
- detection
- amplimer
- primer combination
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the nucleotide and detection method of a kind of SNP site of detection gene relevant to anti-epileptic class drug, are related to genetic polymorphism detection technical field.The nucleotide includes one of primer combination 1- primer combination 9 or a variety of combinations.The polymorphism of 9 SNP sites of 6 anti-epileptic class pharmaceutical relevant genes can be detected simultaneously using the primer sets, there is the features such as at low cost, result interpretation is simple, noiseless between SNP site.
Description
Technical field
The present invention relates to genetic polymorphism detection technical fields, in particular to a kind of detection and anti-epileptic class drug
The nucleotide and detection method of the SNP site of relevant gene.
Background technique
Epilepsy be due to various reasons caused by brain tissue local neuron exception high-frequency discharge, lead to surrounding brain function
The syndrome of of short duration imbalance.In China, epilepsy is the psychiatric condition for being only second to headache, and drug therapy is then current control epilepsy
The main means of breaking-out, to reduce or prevent epileptic attack.But obvious individual is also presented in curative effect of medication and adverse reaction
Difference.There is the reason of difference, other than pathology, physiology, gender, age, height, weight, compliance etc., inherent cause is shadow
An important factor for ringing drug response difference.
The study found that the curative effect of the drug for treating epilepsy is related to several genes phenotype, gene phenotype is different, drug
Therapeutic effect there is significant difference.In recent years, pharmacogenomics are developed rapidly, in the medicine of U.S. FDA approval
In product specification, there are many information that antiepileptic is added to pharmacogenomics.Therefore to obtain optimum therapeuticing effect,
Doctor should choose suitable drug according to the genotype data of patient, i.e., according to individual inheritance feature (genotype), selection is effective
Therapeutic scheme.Realize " gene targeting type " Individual drug treatment and " amount body medication ".
Traditional detection method is mainly sanger sequencing, fragment analysis or Single base extension technology, and each reaction is only
Detect 1 or several gene locis.Its there are detection efficiencies low, low problem of flux.Traditional detection method is completed primary
Detection cycle is longer, needs experimenter more；It detects in matched reagent simultaneously, needs fluorescent dye primer or ddNTP or length
Fragment primer, higher cost.Since there are more repetitive sequence, traditional detection methods in genome for drug metabolism gene
To the amplification of gene difficulty, difficult detection.Traditional detection method experiment flow is long, and sample well is uncapped repeatedly, is loaded often；It is same simultaneously
Multiple gene loci competitiveness amplifications, relevant interference are big in one reaction.The baseline results that traditional detection method obtains can not be
Visual display detecting result on instrument, needs laboratory technician's self-setting Parameter analysis, and as a result interpretation is complicated.Traditional detection method
The primer or ddNTP or long segment primer for needing to use fluorescent marker, the exposure long period under room temperature or illumination condition,
Or multigelation number excessively easily causes detection to fail, and failure rate is high.
In consideration of it, the present invention is specifically proposed.
Summary of the invention
The purpose of the present invention is to provide a kind of nucleosides of the SNP site of detection gene relevant to anti-epileptic class drug
Acid can simultaneously detect the polymorphism of 9 SNP sites of 6 anti-epileptic class pharmaceutical relevant genes using the nucleotide,
With at low cost, result interpretation is simple, it is noiseless between SNP site the features such as.
Another object of the present invention is to provide a kind of examinations of the SNP site of detection gene relevant to anti-epileptic class drug
Agent box can simultaneously examine the polymorphism of 9 SNP sites of 6 anti-epileptic class pharmaceutical relevant genes using the kit
It surveys, there is the features such as at low cost, result interpretation is simple, noiseless between SNP site.
Another object of the present invention is to provide a kind of detection sides of the SNP site of gene relevant to anti-epileptic class drug
Method, this method can simultaneously the polymorphism of 9 SNP sites of 6 anti-epileptic class pharmaceutical relevant genes is detected, have at
The features such as this is low, result interpretation is simple, noiseless between SNP site.
The present invention is implemented as follows:
On the one hand, the present invention provides a kind of nucleotide of the SNP site of relevant to the anti-epileptic class drug gene of detection,
It includes one of primer combination 1- primer combination 9 or a variety of combinations；
Wherein, primer combination 1 includes: inspection shown in amplimer shown in SEQ ID NO.1-2 and SEQ ID NO.19
Survey primer；
Primer combination 2 includes: to detect to draw shown in amplimer shown in SEQ ID NO.3-4 and SEQ ID NO.20
Object；
Primer combination 3 includes: to detect to draw shown in amplimer shown in SEQ ID NO.5-6 and SEQ ID NO.21
Object；
Primer combination 4 includes: to detect to draw shown in amplimer shown in SEQ ID NO.7-8 and SEQ ID NO.22
Object；
Primer combination 5 includes: to detect to draw shown in amplimer shown in SEQ ID NO.9-10 and SEQ ID NO.23
Object；
Primer combination 6 includes: to detect to draw shown in amplimer shown in SEQ ID NO.11-12 and SEQ ID NO.24
Object；
Primer combination 7 includes: to detect to draw shown in amplimer shown in SEQ ID NO.13-14 and SEQ ID NO.25
Object；
Primer combination 8 includes: to detect to draw shown in amplimer shown in SEQ ID NO.15-16 and SEQ ID NO.26
Object；
Primer combination 9 includes: to detect to draw shown in amplimer shown in SEQ ID NO.17-18 and SEQ ID NO.27
Object.
It, can be simultaneously to 6 anti-epileptic class drugs in conjunction with ionization time of flight using nucleotide provided by the invention
Totally 9 SNP sites of related gene such as ABCB1, CYP2C19, CYP2C9, HLA-B, POLG and SCN2A are for example
rs1045642、rs4244285、rs4986893、rs12248560、rs1799853、rs1057910、rs10484555、
The polymorphism of rs3087374 and rs2304016 is detected, and has that at low cost, result interpretation is simple, the detection of each SNP site
As a result the features such as noiseless between.
Wherein, the positional relationship of above-mentioned 6 anti-epileptic class pharmaceutical relevant genes and 9 SNP sites adds the following table 1.
Table 1
| Gene name | Chromosome location | Detection site | Mutation type | Base mutation type |
| ABCB1 | chr 7 | rs1045642 | Point mutation | AA/AG/GG |
| CYP2C19 | chr 10 | rs4244285 | Point mutation | GG/GA/AA |
| CYP2C19 | chr 10 | rs4986893 | Point mutation | GG/GA/AA |
| CYP2C19 | chr 10 | rs12248560 | Point mutation | CC/CT/TT |
| CYP2C9 | chr 10 | rs1799853 | Point mutation | TT/TC/CC |
| CYP2C9 | chr 10 | rs1057910 | Point mutation | CC/CA/AA |
| HLA-B | chr 6 | rs10484555 | Point mutation | CC/CT/TT |
| POLG | chr 15 | rs3087374 | Point mutation | CC/CA/AA |
| SCN2A | chr 2 | rs2304016 | Point mutation | GG/GA/AA |
The sequence of the amplimer of above-mentioned primer combination 1- primer combination 9 see the table below 2.
Table 2
Note: F: upstream primer is used in amplification；R: downstream primer is used in amplification
The sequence of detection primer and the SNP of detection of above-mentioned primer combination 1- primer combination 9 see the table below 3.
Table 3
Note: E: primer is used in detection
The detection primer of above-mentioned primer combination 1- primer combination 9 with the peak position of the molecular size range of its amplified production and
Its corresponding SNP site genotype see the table below 4.
Table 4
On the other hand, the present invention provides a kind of reagents of the SNP site of detection gene relevant to anti-epileptic class drug
Box comprising above-mentioned primer sets.
It, can be simultaneously to 6 anti-epileptic class drugs in conjunction with ionization time of flight using kit provided by the invention
Totally 9 SNP sites of related gene such as ABCB1, CYP2C19, CYP2C9, HLA-B, POLG and SCN2A are for example
rs1045642、rs4244285、rs4986893、rs12248560、rs1799853、rs1057910、rs10484555、
The polymorphism of rs3087374 and rs2304016 is detected, and has that at low cost, result interpretation is simple, the detection of each SNP site
As a result the features such as noiseless between.
Further, in some embodiments of the present invention, kit further includes having following component: Mg2+, dNTPs and
Taq archaeal dna polymerase.
On the other hand, the present invention provides the detection method of the SNP site of gene relevant to anti-epileptic class drug, packets
Include following steps:
(1) PCR amplification is carried out to sample using the amplimer in above-mentioned nucleotide, obtains the first amplified production；
(2) the first amplified production after alkaline phosphatase treatment is carried out using the detection primer in above-mentioned nucleotide single
Base extension obtains the second amplified production；
(3) polymorphism of second amplified production is analyzed using ionization time of flight.
When judging result, according to the molecular size range of detection primer amplification and peak position, the gene of each each SNP site of determination
Type.
Further, in some embodiments of the present invention, in step (1), the system for carrying out PCR amplification contains:
Primer combines the amplimer of 1- primer combination 9, Mg2+, dNTPs and Taq archaeal dna polymerase.
Further, in some embodiments of the present invention, in step (1), the amplimer is in system
Concentration is 0.8-1.2 μM.
Further, in some embodiments of the present invention, in step (1), the annealing of the program of PCR amplification is carried out
Temperature are as follows: 55-57 DEG C.
Further, in some embodiments of the present invention, in step (2), the body of single base extension is carried out
System is contained: primer combines the detection primer and the first amplified production of 1- primer combination 9.
Further, in some embodiments of the present invention, system of the detection primer in single base extension
In total concentration be 7-9 μM.
Further, in some embodiments of the present invention, each detection primer of primer combination 1- primer combination 9 is in list
Concentration in the system of base extension is respectively: 0.582 μM, 0.742 μM, 0.836 μM, 0.843 μM, 0.857 μM,
0.882 μM, 1.000 μM, 1.017 μM and 1.122 μM, the volume of the system of single base extension is 9 μ L.
Further, in some embodiments of the present invention, in step (2), the journey of single base extension is carried out
The annealing temperature of sequence are as follows: 51-53 DEG C, annealing time are as follows: 4-6s.
Further, in some embodiments of the present invention, the elongating temperature of the program of single base extension is carried out
It is 79-81 DEG C, time 4-6s.
It, can be simultaneously to 6 anti-epileptic class medicines in conjunction with ionization time of flight using detection method provided by the invention
Totally 9 SNP sites of object related gene such as ABCB1, CYP2C19, CYP2C9, HLA-B, POLG and SCN2A are for example
rs1045642、rs4244285、rs4986893、rs12248560、rs1799853、rs1057910、rs10484555、
The polymorphism of rs3087374 and rs2304016 is detected, and has that at low cost, result interpretation is simple, the detection of each SNP site
As a result the features such as noiseless between.
Detailed description of the invention
In order to illustrate the technical solution of the embodiments of the present invention more clearly, below will be to needed in the embodiment attached
Figure is briefly described, it should be understood that the following drawings illustrates only certain embodiments of the present invention, therefore is not construed as pair
The restriction of range for those of ordinary skill in the art without creative efforts, can also be according to this
A little attached drawings obtain other relevant attached drawings.
Fig. 1 is the testing result of the control primer pair 1 in experimental example 1.
Fig. 2 is the testing result of the primer combination 4 in experimental example 1.
Fig. 3 is the testing result of the control primer pair 2 in experimental example 2.
Fig. 4 is the testing result of the primer combination 7 in experimental example 2.
Fig. 5 is the testing result of the control primer pair 3 in experimental example 3.
Fig. 6 is the testing result of the primer combination 2 in experimental example 3.
Fig. 7 is the testing result of the control primer pair 4 in experimental example 4.
Fig. 8 is the testing result of the primer combination 1 in experimental example 4.
Specific embodiment
It in order to make the object, technical scheme and advantages of the embodiment of the invention clearer, below will be in the embodiment of the present invention
Technical solution be clearly and completely described.The person that is not specified actual conditions in embodiment, according to normal conditions or manufacturer builds
The condition of view carries out.Reagents or instruments used without specified manufacturer is the conventional production that can be obtained by commercially available purchase
Product.
Feature and performance of the invention are described in further detail with reference to embodiments.
Embodiment 1
The kit of anti-epileptic class pharmaceutical relevant gene polymorphic site detection provided in this embodiment comprising for resisting
The nucleotide of epilepsy class pharmaceutical relevant gene polymorphic site detection, the nucleotide include following primer combination 1- primer combination 9.
Wherein, primer combination 1 includes: inspection shown in amplimer shown in SEQ ID NO.1-2 and SEQ ID NO.19
Survey primer；
Primer combination 2 includes: to detect to draw shown in amplimer shown in SEQ ID NO.3-4 and SEQ ID NO.20
Object；
Primer combination 3 includes: to detect to draw shown in amplimer shown in SEQ ID NO.5-6 and SEQ ID NO.21
Object；
Primer combination 4 includes: to detect to draw shown in amplimer shown in SEQ ID NO.7-8 and SEQ ID NO.22
Object；
Primer combination 5 includes: to detect to draw shown in amplimer shown in SEQ ID NO.9-10 and SEQ ID NO.23
Object；
Primer combination 6 includes: to detect to draw shown in amplimer shown in SEQ ID NO.11-12 and SEQ ID NO.24
Object；
Primer combination 7 includes: to detect to draw shown in amplimer shown in SEQ ID NO.13-14 and SEQ ID NO.25
Object；
Primer combination 8 includes: to detect to draw shown in amplimer shown in SEQ ID NO.15-16 and SEQ ID NO.26
Object；
Primer combination 9 includes: to detect to draw shown in amplimer shown in SEQ ID NO.17-18 and SEQ ID NO.27
Object.
The amplimer of each primer combination and the sequence of detection primer and SNP site detected see above table 2- table 4.
Certainly, it should be noted that in other examples, primer sets include in primer combination 1- primer combination 9
Any a kind, 2 kinds, 3 kinds, 4 kinds, 5 kinds, 6 kinds, 7 kinds or 8 kinds of combination.The invention discloses the bases that above-mentioned primer combines
On, those skilled in the art can carry out from primer combination 1- primer combination 9 according to the classification and quantity of testing goal gene
Any combination.Either which kind of combination, as long as it is belonged to of the invention selected from primer combination 1- primer combination 9
Protection scope.
The kit of the present embodiment can simultaneously to 6 anti-epileptic class pharmaceutical relevant gene, that is, ABCB1, CYP2C19,
Totally 9 SNP sites of CYP2C9, HLA-B, POLG and SCN2A include rs1045642, rs4244285, rs4986893,
The polymorphism of rs12248560, rs1799853, rs1057910, rs10484555, rs3087374 and rs2304016 carry out
Detection has the features such as at low cost, result interpretation is simple, noiseless between each SNP site testing result.
The method detected using the kit is as follows:
(1) PCR amplification is carried out to sample using the amplimer in above-mentioned primer sets, obtains the first amplified production；
PCR amplification system is as follows:
| Reagent | Volume (μ L) | Final concentration |
| ddH2O | 0.8 | n/a |
| 10x PCR buffer | 0.5 | 1x |
| MgCl2 | 0.4 | 2mM |
| dNTP Mix | 0.1 | 500μM |
| Primer Mix | 1.0 | 1μM |
| PCR Enzyme | 0.2 | 0.2U/μL |
| DNA sample | 2.0 | 10-20ng |
| total | 5.0 | n/a |
Note: all detections with reagent are purchased from Agena Bioscience (base receive biotechnology (Shanghai) in 1. present invention
Co., Ltd), similarly hereinafter；
2.Primer Mix is the mixture that is configured to the concentration ratio of 1:1 of all amplimers, and when reaction is all to draw
Final concentration of 1 μM (final concentration of 1 μM of i.e. every amplimer) of object；
3.n/a indicates that this is meaningless.
PCR amplification program is as follows:
(2) the first amplified production after alkaline phosphatase treatment is carried out using the detection primer in above-mentioned primer sets single
Base extension obtains the second amplified production；
Single base extension system is as follows:
Wherein, IPLEX Primer Mix is the mixture of all detection primers, and detection primer allocation list is (to configure 100 μ
For L, surplus ddH2O complements to 100 μ L) as follows:
Single base extension program is as follows:
(3) polymorphism of second amplified production is analyzed using ionization time of flight.
It can determine the gene of SNP site according to the peak position of detection primer and its molecular size range of the second amplified production
Type is shown in Table 4.
Embodiment 2
Using the kit and method of embodiment 1, (clinic, sample are all to 20 parts of samples of known SNP site genotype
Category type is whole blood or buccal swab) it is detected, as a result as shown in following table 5-6.
Table 5
Table 6
Known results in table 5-6 are using conventional method (fragment analysis, Single base extension and sanger sequencing) detection
Sample results statistics, right side testing result be use embodiment 1 primer sets detect result.Embodiment is used as the result is shown
1 primer sets and the result of detection method and the result of conventional method are consistent.
Experimental example 1
There is the SNP site rs1024814428 of a high mutation rate within the scope of the base of 3, the site distance rs12248560,10
There are SNP site 2 within the scope of a base, there are 7 SNP sites before and after the site rs4986893 between 20 bases.In addition, base
Because, there are pseudogene, extremely easy amplification obtains non-target fragment in group, therefore general strategy is that amplification to the greatest extent may be used in design of primers
The long segment of energy, then detect, easily cause single detection site few, flux is few (such as sequencing analysis, fragment analysis)；If reducing amplification
Length, easily detection failure.The design of the various primers of these cause descriptions primer sets of the present invention is to need to make the creative labor
's.
Based on this, for the site rs12248560, design compares primer pair 1:
F (represents upstream primer, similarly hereinafter): CGTGGCGCATTATCTCTTAC；
R (represents downstream primer, similarly hereinafter): AACAAAGTTTTAGCAAACG.
Amplified production 86bp can be obtained using control primer pair 1.It is as shown in Figure 1 using the result of mass spectral analysis to product.
Rs12248560 represents detection primer in figure, and right side marks black C/A/T and represents detection product, can determine that into 3 according to the presence or absence of peak
Kind of different genotype can not judgement sample genotype due to no product peak in result as shown in the figure.As a result it is difficult to judge, parting
Failure.
And the amplimer pair of the primer combination 4 for the site rs12248560 provided using the embodiment of the present invention 1:
F:AACAAAGTTTTAGCAAACG；
R:GGATTTGAGCTGAGGTCTTC。
It is expanded, it is as shown in Figure 2 to be analyzed by mass spectrometry result to product.Left side rs12248560 represents detection and draws in figure
Object, right side mark black C/A/T and represent detection product, can determine that into 3 kinds of different genotypes, result as shown in the figure according to the presence or absence of peak
Sample genotype is CC homozygous.
Testing result is preferable as the result is shown, and Genotyping is clear, and non-false positive product generates.It indicates to use this primer detection
The site, can succeed parting.
Experimental example 2
There are numerous SNP sites before and after the site rs4244285, within the scope of 3 bases of distance, there are
4 SNP sites such as rs879130837, rs6413438, rs1316237390 and rs1362033140, within the scope of 10 bases
Then there are 8 SNP sites, there are SNP site 16 within the scope of 20 bases.
For the site rs4244285, design compares primer pair 2:
F:TGCAATAATTTTCCCACTATCATT；
R:TGGTGTTCTTTTACTTTCTCCA。
Amplified production 110bp can be obtained using the control amplification of primer pair 2.Result such as Fig. 3 of mass spectral analysis is used product
It is shown.Left side rs4244285 represents detection primer in figure, and right side G/C/A represents detection product, be can determine that into according to the presence or absence of peak
3 kinds of different genotypes may be simultaneously present 3 kinds of genotype as the result is shown as shown in the figure.As a result there is false positive, it is vicious
Product peak generates.It is shown according to ncbi database, under truth, the frequency of C mutation is extremely low, i.e., would not produce in this experiment
Object peak is produced, therefore uses this primer detection site result inaccuracy.
And the amplimer pair of the primer combination 7 for the site rs4244285 provided using the embodiment of the present invention 1:
F:TCCATCGATTCTTGGTGTTC；
R:GCAATAATTTTCCCACTATC。
It is expanded, it is as shown in Figure 4 to be analyzed by mass spectrometry result to product.Left side rs4244285 represents detection and draws in figure
Object, right side G/C/A represent detection product, can determine that into 3 kinds of different genotypes according to the presence or absence of peak, be as the result is shown as shown in the figure
G homozygous genotype.
Testing result is preferable as the result is shown, and Genotyping is clear, and non-false positive product generates.It indicates to use this primer detection
The site, can succeed parting.
Experimental example 3
Have before and after the site rs1057910 within the scope of 3 bases rs1057909, rs1201563690, rs56165452 and
Tetra- SNP sites of rs774992703, and be all triallelic, i.e., each site forms the possibility of base, this section by 3 kinds
There are up to 162 kinds of permutation and combination in the sequence of 7bp, detection is easily caused to fail；And in 10, the site distance rs1057910 base
There are SNP site 11 in range, there are 24 SNP sites before and after the site rs4986893 between 20 bases.
For the site rs1057910, design compares primer pair 3:
F:ATGCAAGACAGGAGCCACA；
R:CATGGGGCAGGCTGGTGGG。
Amplified production 91bp can be obtained using the control amplification of primer pair 3.Result such as Fig. 5 institute of mass spectral analysis is used product
Show.Rs1057910 represents detection primer in figure, and right side marks black C/A and represents detection product, can determine that into 3 according to the presence or absence of peak
Kind of different genotype can not judgement sample genotype due to no product peak in result as shown in the figure.As a result it is difficult to judge, parting
Failure.
And the amplimer pair of the primer combination 2 for the site rs1057910 provided using the embodiment of the present invention 1:
F:AGGAAGAGATTGAACGTGTG；
R:TGTCACAGGTCACTGCATGG。
It is expanded, it is as shown in Figure 6 to be analyzed by mass spectrometry result to product.Left side rs1057910 represents inspection in figure in figure
Primer is surveyed, right side C/A represents detection product, can determine that into 3 kinds of different genotypes according to the presence or absence of peak, as shown in the figure as the result is shown
For AA homozygous genotype.
Testing result is preferable as the result is shown, and Genotyping is clear, and non-false positive product generates.It indicates to use this primer detection
The site, can succeed parting.
Experimental example 4
Having a three loci rs779788253 close to 1, the site rs1045642 base distance and position, downstream away from
The site rs2229107 that from 12 base positions have a high frequency to be mutated is that the main of rs1045642 site primer failure is caused to be dived
In reason, while in the range of 20 bases before and after the site, there are also 10 SNP sites.
For the site rs1045642, design compares primer pair 4:
F:GTGTCCCAGGAGCCCATC；
R:GCTCCCAGGCTGTTTATTTG。
Amplified production 177bp can be obtained using the control amplification of primer pair 4.Result such as Fig. 7 of mass spectral analysis is used product
It is shown.Rs1045642 represents detection primer in figure, and right side marks black G/T/A and represents detection product, can determine that according to the presence or absence of peak
At 3 kinds of different genotypes, since the peak G is short and small in result as shown in the figure, miscellaneous peak interference or correct amplified production can not be judged,
It therefore can not the homozygous still GA heterozygosis of judgement sample frequency of genotypes AA.As a result it is difficult to judge, parting failure.
And the amplimer pair of the primer combination 1 for the site rs1045642 provided using the embodiment of the present invention 1:
F:TAGGCAGTGACTCGATGAAG；
R:TATGGAGACAACAGCCGGGT。
It is expanded, it is as shown in Figure 8 to be analyzed by mass spectrometry result to product.Left side rs1045642 represents detection and draws in figure
Object, right side A/G/T represent detection product, can determine that into 3 kinds of different genotypes according to the presence or absence of peak, be as the result is shown as shown in the figure
AG heterozygous genotypes.
Testing result is preferable as the result is shown, and Genotyping is clear, and non-false positive product generates.It indicates to use this primer detection
The site, can succeed parting.
The foregoing is only a preferred embodiment of the present invention, is not intended to restrict the invention, for the skill of this field
For art personnel, the invention may be variously modified and varied.All within the spirits and principles of the present invention, made any to repair
Change, equivalent replacement, improvement etc., should all be included in the protection scope of the present invention.
SEQUENCE LISTING
<110>Guangzhou Kingmed Center for Clinical Laboratory Co., Ltd.
<120>nucleotide and detection method of the SNP site of gene relevant to anti-epileptic class drug are detected
<160> 27
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
taggcagtga ctcgatgaag 20
<210> 2
<211> 20
<212> DNA
<213>artificial sequence
<400> 2
tatggagaca acagccgggt 20
<210> 3
<211> 20
<212> DNA
<213>artificial sequence
<400> 3
aggaagagat tgaacgtgtg 20
<210> 4
<211> 20
<212> DNA
<213>artificial sequence
<400> 4
tgtcacaggt cactgcatgg 20
<210> 5
<211> 20
<212> DNA
<213>artificial sequence
<400> 5
gactgtaagt ggtttctcag 20
<210> 6
<211> 20
<212> DNA
<213>artificial sequence
<400> 6
aacatcagga ttgtaagcac 20
<210> 7
<211> 19
<212> DNA
<213>artificial sequence
<400> 7
aacaaagttt tagcaaacg 19
<210> 8
<211> 20
<212> DNA
<213>artificial sequence
<400> 8
ggatttgagc tgaggtcttc 20
<210> 9
<211> 20
<212> DNA
<213>artificial sequence
<400> 9
ttgaactcac caaaggctcc 20
<210> 10
<211> 20
<212> DNA
<213>artificial sequence
<400> 10
agcaaataca gagcctccag 20
<210> 11
<211> 20
<212> DNA
<213>artificial sequence
<400> 11
cagtgatatg gagtagggtc 20
<210> 12
<211> 19
<212> DNA
<213>artificial sequence
<400> 12
ctgcggaatt ttgggatgg 19
<210> 13
<211> 20
<212> DNA
<213>artificial sequence
<400> 13
tccatcgatt cttggtgttc 20
<210> 14
<211> 20
<212> DNA
<213>artificial sequence
<400> 14
gcaataattt tcccactatc 20
<210> 15
<211> 20
<212> DNA
<213>artificial sequence
<400> 15
agagcatcat tttgcccctc 20
<210> 16
<211> 20
<212> DNA
<213>artificial sequence
<400> 16
gggtggctga agtgttttac 20
<210> 17
<211> 20
<212> DNA
<213>artificial sequence
<400> 17
cactcctgaa gtgaaaactc 20
<210> 18
<211> 20
<212> DNA
<213>artificial sequence
<400> 18
atcccaagat aatccacggc 20
<210> 19
<211> 15
<212> DNA
<213>artificial sequence
<400> 19
ctttgctgcc ctcac 15
<210> 20
<211> 17
<212> DNA
<213>artificial sequence
<400> 20
acgaggtcca gagatac 17
<210> 21
<211> 19
<212> DNA
<213>artificial sequence
<400> 21
ttcctggcct tacctggat 19
<210> 22
<211> 19
<212> DNA
<213>artificial sequence
<400> 22
gtgtcttctg ttctcaaag 19
<210> 23
<211> 19
<212> DNA
<213>artificial sequence
<400> 23
acgtggaaaa acgaagcca 19
<210> 24
<211> 20
<212> DNA
<213>artificial sequence
<400> 24
ccaggcttcc tcttgaacac 20
<210> 25
<211> 22
<212> DNA
<213>artificial sequence
<400> 25
taagtaattt gttatgggtt cc 22
<210> 26
<211> 22
<212> DNA
<213>artificial sequence
<400> 26
gagaaaggaa tagaaagaat ca 22
<210> 27
<211> 25
<212> DNA
<213>artificial sequence
<400> 27
caaaatttat ggatttactt cattg 25
Claims (8)
1. a kind of nucleotide for the SNP site for detecting gene relevant to anti-epileptic class drug, which is characterized in that it includes primer
Combine one of 1- primer combination 9 or a variety of combinations；
Wherein, primer combination 1 includes: to detect to draw shown in amplimer shown in SEQ ID NO.1-2 and SEQ ID NO.19
Object；
Primer combination 2 includes: detection primer shown in amplimer shown in SEQ ID NO.3-4 and SEQ ID NO.20；
Primer combination 3 includes: detection primer shown in amplimer shown in SEQ ID NO.5-6 and SEQ ID NO.21；
Primer combination 4 includes: detection primer shown in amplimer shown in SEQ ID NO.7-8 and SEQ ID NO.22；
Primer combination 5 includes: detection primer shown in amplimer shown in SEQ ID NO.9-10 and SEQ ID NO.23；
Primer combination 6 includes: detection primer shown in amplimer shown in SEQ ID NO.11-12 and SEQ ID NO.24；
Primer combination 7 includes: detection primer shown in amplimer shown in SEQ ID NO.13-14 and SEQ ID NO.25；
Primer combination 8 includes: detection primer shown in amplimer shown in SEQ ID NO.15-16 and SEQ ID NO.26；
Primer combination 9 includes: detection primer shown in amplimer shown in SEQ ID NO.17-18 and SEQ ID NO.27.
2. a kind of detection method of the SNP site of gene relevant to anti-epileptic class drug, which is characterized in that it includes following step
It is rapid:
(1) PCR amplification is carried out to sample using the amplimer in nucleotide described in claim 1, obtains the first amplification production
Object；
(2) the first amplification after alkaline phosphatase treatment is produced using the detection primer in nucleotide described in claim 1
Object carries out single base extension, obtains the second amplified production；
(3) polymorphism of second amplified production is analyzed using ionization time of flight.
3. detection method according to claim 2, which is characterized in that in step (1), the system for carrying out PCR amplification contains
Have: primer combines the amplimer of 1- primer combination 9.
4. detection method according to claim 2, which is characterized in that in step (1), carry out the program of PCR amplification
Annealing temperature are as follows: 55-57 DEG C.
5. detection method according to claim 2, which is characterized in that in step (1), the amplimer is in system
Concentration be 0.8-1.2 μM.
6. according to the described in any item detection methods of claim 2-5, which is characterized in that in step (2), carry out single base and prolong
The system for stretching reaction contains: primer combines the detection primer and the first amplified production of 1- primer combination 9.
7. detection method according to claim 6, which is characterized in that body of the detection primer in single base extension
Total concentration in system is 7-9 μM.
8. detection method according to claim 7, which is characterized in that primer combines each detection primer of 1- primer combination 9
Concentration in the system of single base extension is respectively: 0.582 μM, 0.742 μM, 0.836 μM, 0.843 μM, 0.857 μM,
0.882 μM, 1.000 μM, 1.017 μM and 1.122 μM, the volume of the system of single base extension is 9 μ L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811654872.4A CN109468379A (en) | 2018-12-30 | 2018-12-30 | Detect the nucleotide and detection method of the SNP site of gene relevant to anti-epileptic class drug |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811654872.4A CN109468379A (en) | 2018-12-30 | 2018-12-30 | Detect the nucleotide and detection method of the SNP site of gene relevant to anti-epileptic class drug |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109468379A true CN109468379A (en) | 2019-03-15 |
Family
ID=65678551
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811654872.4A Pending CN109468379A (en) | 2018-12-30 | 2018-12-30 | Detect the nucleotide and detection method of the SNP site of gene relevant to anti-epileptic class drug |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109468379A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109825574A (en) * | 2019-03-20 | 2019-05-31 | 宁波海尔施基因科技有限公司 | A kind of multiple gene detection kit and its application method for antiepileptic medication guide |
| CN111118149A (en) * | 2020-03-03 | 2020-05-08 | 上海康黎医学检验所有限公司 | Kit for guiding medication of people for epileptic diseases and application thereof |
-
2018
- 2018-12-30 CN CN201811654872.4A patent/CN109468379A/en active Pending
Non-Patent Citations (6)
| Title |
|---|
| A ORTEGA-VÁZQUEZ等: "CYP2C9, CYP2C19, ABCB1 genetic polymorphisms and phenytoin plasma concentrations in Mexican-Mestizo patients with epilepsy", 《THE PHARMACOGENOMICS JOURNAL》 * |
| ALESSANDRO ORSINI等: "Personalized medicine in epilepsy patients", 《JOURNAL OF TRANSLATIONAL GENETICS AND GENOMICS》 * |
| LI, XI等: "Polymorphisms of ABAT, SCN2A and ALDH5A1 may affect valproic acid responses in the treatment of epilepsy in Chinese", 《PHARMACOGENOMICS》 * |
| SEAN HENNESSY等: "CYP2C9, CYP2C19, and ABCB1 Genotype and Hospitalization for Phenytoin Toxicity", 《J CLIN PHARMACOL》 * |
| SILKE APPENZELLER等: "Febrile infection-related epilepsy syndrome (FIRES) is not caused by SCN1A, POLG, PCDH19 mutations or rare copy number variations", 《DEVELOPMENTAL MEDICINE & CHILD NEUROLOGY》 * |
| 冒萧萧等: "耐药性癫痫机制及精准化治疗研究进展", 《国际神经病学神经外科学杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109825574A (en) * | 2019-03-20 | 2019-05-31 | 宁波海尔施基因科技有限公司 | A kind of multiple gene detection kit and its application method for antiepileptic medication guide |
| CN111118149A (en) * | 2020-03-03 | 2020-05-08 | 上海康黎医学检验所有限公司 | Kit for guiding medication of people for epileptic diseases and application thereof |
| CN111118149B (en) * | 2020-03-03 | 2020-12-25 | 上海康黎医学检验所有限公司 | Kit for guiding medication of people for epileptic diseases and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109468377A (en) | For the primer sets of antipsychotics related gene polymorphism site primer, kit and method | |
| CN110184345B (en) | Primer group, application, product and method for detecting SNP (single nucleotide polymorphism) sites related to drug administration for mental and neurological diseases | |
| CN109593854A (en) | Nucleic acid group and application suitable for the detection of tumour class pharmaceutical relevant gene SNP site | |
| CN108048561B (en) | Primer group and kit for detecting pharmacogenomic genotype and detection method for guiding personalized medicine | |
| Wang et al. | Optimized double-digest genotyping by sequencing (ddGBS) method with high-density SNP markers and high genotyping accuracy for chickens | |
| CN108823299A (en) | A kind of detection method and kit of depression medication related gene | |
| Hutchinson et al. | Allele-specific methylation occurs at genetic variants associated with complex disease | |
| CN109182509B (en) | Primer group, kit and method for detecting polymorphic sites of hypertension-related drug genes | |
| CN109468379A (en) | Detect the nucleotide and detection method of the SNP site of gene relevant to anti-epileptic class drug | |
| CN112226505A (en) | Respiratory system disease gene SNP locus typing optimization method | |
| CN106834434B (en) | Nucleic acid, kit and method for detecting COX-1, COX-2 and GPIIIa gene polymorphism | |
| Rondinone et al. | Genetic characterization of Bacillus anthracis strains circulating in Italy from 1972 to 2018 | |
| CN106957902B (en) | Non-labeled probe for detecting drug-induced deafness related sites | |
| US20060073479A1 (en) | Single nucleotide polymorphisms and combinations thereof predictive for paclitaxel responsiveness | |
| CN113584147A (en) | Gene polymorphism detection kit for guiding medication of psychosis | |
| CN109385479A (en) | Detect the kit and method for dredging purine medicaments related gene SNP | |
| CN110157800B (en) | Detection primer group, kit, system and method for mental drug related gene | |
| CN109593853A (en) | Primer sets, kit and the method for gene polymorphism sites detection | |
| CN111235251A (en) | Kit for detecting gene of nitrendipine individualized medication guidance of antihypertensive drug | |
| CN107937493A (en) | A kind of hair clip Mdification primer for allele PCR | |
| CN110923312A (en) | Real-time fluorescent PCR method for detecting rs762551 site of CYP1A2 gene and primer probe combination thereof | |
| CN109385480A (en) | Detect the primer sets and detection method in platinum medicine related gene polymorphism site | |
| Han et al. | Regulation of pharmacogene expression by microRNA in the cancer genome atlas (TCGA) research network | |
| JP6728556B2 (en) | Single nucleotide polymorphism detection kit and method | |
| CN112708658B (en) | Liquid chip primer group for detecting multiple drug-resistant genes and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190315 |
|
| RJ01 | Rejection of invention patent application after publication |