CN117867099A - Detection composition and kit for epileptic medication guidance and application of detection composition and kit - Google Patents

Detection composition and kit for epileptic medication guidance and application of detection composition and kit Download PDF

Info

Publication number
CN117867099A
CN117867099A CN202311870109.6A CN202311870109A CN117867099A CN 117867099 A CN117867099 A CN 117867099A CN 202311870109 A CN202311870109 A CN 202311870109A CN 117867099 A CN117867099 A CN 117867099A
Authority
CN
China
Prior art keywords
hla
primer
epileptic
detection
base extension
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202311870109.6A
Other languages
Chinese (zh)
Other versions
CN117867099B (en
Inventor
冯振
刘利勤
郭启雷
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yingsheng Beijing Biotechnology Co ltd
Shandong Ying Sheng Biotechnology Co ltd
Original Assignee
Yingsheng Beijing Biotechnology Co ltd
Shandong Ying Sheng Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yingsheng Beijing Biotechnology Co ltd, Shandong Ying Sheng Biotechnology Co ltd filed Critical Yingsheng Beijing Biotechnology Co ltd
Priority to CN202311870109.6A priority Critical patent/CN117867099B/en
Publication of CN117867099A publication Critical patent/CN117867099A/en
Application granted granted Critical
Publication of CN117867099B publication Critical patent/CN117867099B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6858Allele-specific amplification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to the technical field of medical treatment and biological detection, and particularly provides a detection composition for epileptic medication guidance, a kit and application thereof. The method has the advantages of high accuracy, strong specificity, high sensitivity, large flux and the like, simultaneously has the advantages of sample saving, short detection period, simple operation, convenient analysis and the like, and can provide guiding significance for the individual treatment of epileptic patients.

Description

Detection composition and kit for epileptic medication guidance and application of detection composition and kit
Technical Field
The invention belongs to the technical field of medical treatment and biological detection, and particularly relates to a detection composition and kit for epileptic medication guidance and application thereof.
Background
The statements in this section merely provide background information related to the present disclosure and may not necessarily constitute prior art.
Epilepsy is one of the most common chronic neurological disorders, and epilepsy is a clinical syndrome of transient disturbance of central nervous system function caused by various causes, and is a sudden, transient, and episodic chronic neurological disorder caused by abnormal supersynchronous discharge of brain cell populations. Patients with epilepsy need to take anti-epileptic drugs for treatment for a long period of time or even for life. Among patients taking antiepileptic drugs, there are still some patients with phenomena of undefined diagnosis or irregular treatment; patients are too worried about the side effects of antiepileptic drugs, have poor medication compliance, and stop, decrement or change drugs at will. Some non-specialists have inaccurate diagnosis and classification of epilepsy, irregular treatment, improper medicine selection and blind use of multi-medicine treatment. Aiming at the same diseases and the same crowd, the same drugs and dosages are often adopted, and due to the individuation difference of drug reactions, partial patients may have poor curative effects after taking the drugs, and even serious adverse reactions occur. The reasons for the individuation difference of the drug response are age, weight, sex, diet, degree of compliance with medical advice, simultaneous occurrence of other diseases, simultaneous taking of other drugs, race, genetic factors and the like, and research shows that the genetic factors play a major role in the treatment of epilepsy drugs and possibly are predictive factors of epilepsy curative effect and adverse reaction.
In the current epileptic drug gene detection technology, detection means based on PCR (polymerase chain reaction) such as RT PCR, ARMS (automatic repeat request) PCR, first-generation sequencing and the like are partially adopted, and the detection means can only detect a small number of loci of a small number of genes at a time, so that a pointed experimental basis is difficult to provide for clinical drug; and part of high-flux gene detection technology, such as second generation sequencing, has high cost and long period, has high requirements on experimental operation and data analysis, can only be used as an experimental means, and is difficult to popularize in actual clinical operation.
Disclosure of Invention
In order to overcome the defects in the prior art, one of the purposes of the invention is to provide a primer group for guiding epileptic medication; the second purpose of the invention is to provide a kit for epileptic medication guidance; a third object of the present invention is to provide the use of the above primer set or kit for guiding the medication of epilepsy; the fourth object of the invention is to provide a method for detecting SNP locus genotypes related to anti-epileptic drug metabolism and drug resistance.
To achieve the above object, one or more embodiments of the present invention provide the following technical solutions:
in a first aspect of the invention, there is provided a primer set for detecting an epileptic SNP comprising: rs1045642, rs3789243, rs2032582, rs1800497, rs1799853, rs1057910, rs4244285, rs 496893, rs1051740, rs2234922, rs1061235, rs2517754, rs10484555, rs144012689, rs3909184, rs2844682, rs2074491, rs4711240, rs1265110, rs9263726, rs1801280, rs1799930, rs113994095, rs113994097, rs3812718, rs2304016, rs4240803, rs2011425, rs1042597, rs28365062, and rs7668258;
the primer group comprises amplification primers, and the sequences of the amplification primers are shown as SEQ ID NO. 1-62.
In a specific embodiment of the present invention, the primer set further comprises 31 single base extension primers;
the single base extension primer sequence is shown as SEQ ID NO. 63-94.
In a specific embodiment of the present invention, the molar concentration of the 31 single base extension primers is 0.3 to 2.9. Mu.M.
In a specific embodiment of the present invention, the amplification primer and the single base extension primer are added in the following amounts:
in a second aspect of the invention, there is provided a composition for epileptic medication guidance detection, the composition comprising a primer set according to the first aspect.
In a third aspect of the invention there is provided a product for epileptic medication guidance testing, the composition comprising a primer set according to the first aspect.
In a fourth aspect of the invention, a kit for epileptic medication guided detection, the composition comprising a primer set according to the first aspect.
In a specific embodiment of the invention, the kit further comprises conventional reagent components for MALDI-TOF MS nucleic acid mass spectrometry detection.
In a fifth aspect of the invention, there is provided the use of the primer set of the first aspect for the preparation of a epileptic drug guide assay product.
In a sixth aspect of the present invention, there is provided a method for detecting the genotype of SNP locus related to anti-epileptic drug metabolism and drug resistance in a sample to be detected, comprising the steps of:
1) Performing PCR amplification on the sample to be detected by using the amplification primer of the first aspect to obtain a PCR amplification product;
2) Performing alkaline phosphatase digestion on the PCR amplification product to obtain a digestion product;
3) Carrying out single base extension reaction on the digestion product by using a single base extension primer in the primers to obtain a single base extension reaction product;
4) Purifying the single-base extension reaction product, and then performing matrix-assisted laser analysis ionization time-of-flight mass spectrometry detection on a sample application machine to obtain the genotype of SNP locus related to epileptic drug metabolism and drug resistance in a sample to be detected;
preferably, the template for PCR amplification is genomic DNA of a sample to be tested;
the PCR amplification procedure was: 95 ℃ for 15min;95℃for 15s, 59℃for 30s, 72℃for 30s,35 cycles; 60 ℃ for 10min;
the single base extension reaction is performed by the following steps: 95℃30s,95℃5s, (52℃5s, 80℃5s,5 cycles), 40 cycles, and 72℃3min.
The one or more of the above technical solutions have the following beneficial effects:
the technical scheme can efficiently complete the detection of a plurality of SNP loci related to epileptic medication resistance at one time, thereby completing the accurate drug gene detection of the epileptic, and effectively reducing the experimental cost and the clinical detection cost; the PCR primer and the extension primer designed according to each SNP locus have higher specificity. The method has high application value for guiding the clinical accurate medication of the epilepsy, thereby guiding doctors to administer the individual medication of the epilepsy according to the genetic condition of patients, reducing adverse reactions of the medicines while the patients obtain the maximum curative effect of the medicines, and greatly promoting the individual medication process.
The invention can detect a plurality of mutation sites in one reaction system simultaneously, improves detection accuracy, improves flux, reduces detection cost and improves detection efficiency, thereby being convenient for clinical popularization and use.
The MALDI-TOF MS technology is used for overcoming the problem of insufficient multiple amplification capability of the PCR technology, and solving the requirement of simultaneous detection of a plurality of variation sites in the detection of a drug genome; the method is independent of the detection flow of the fluorescent probe and the fluorescent reagent, and the high accuracy and the high sensitivity of the mass spectrum technology ensure the high accuracy and the repeatability of the detection; meanwhile, compared with the second generation sequencing technology, the detection cost of the method has higher cost performance.
In conclusion, the technical scheme is simple to operate, has the accuracy of mass spectrum, has stable detection results, and improves the detection positive rate, so that the method has good practical application value.
Additional aspects of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.
Drawings
The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention.
FIG. 1 is a mass spectrum corresponding to a second rs2844682 site primer sequence before optimization in the embodiment of the invention.
FIG. 2 is a mass spectrum diagram corresponding to the optimized primer sequence at the second rs2844682 locus in the embodiment of the invention.
FIG. 3 is a mass spectrum corresponding to the second rs7668258 locus primer sequence before optimization.
FIG. 4 is a mass spectrum diagram corresponding to the second rs7668258 locus primer sequence in the embodiment of the invention after optimization.
Fig. 5 is a mass spectrum diagram corresponding to the third system 1 of the embodiment of the present invention.
Fig. 6 is a mass spectrum diagram corresponding to the third system 2 of the embodiment of the present invention.
Fig. 7 is a mass spectrum diagram corresponding to the third system 3 of the embodiment of the present invention.
Fig. 8 is a mass spectrum diagram corresponding to the third system 4 of the embodiment of the present invention.
Detailed Description
It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the present invention.
In the present invention, the main materials and instrument sources used are shown in the following table
Experimental example one establishment of the detection method of the present invention
1. DNA sample extraction
Whole blood sample DNA extraction is performed according to the instruction of a nucleic acid extraction or purification kit (Tiangen DP 348), and the extracted DNA sample can be stored at-20+ -5 ℃.
2. Detection procedure and results
PCR amplification reaction
1) And taking out the PCR reagent, thawing at room temperature, placing on an ice box for standby, shaking and uniformly mixing for 3-5s before use, and performing instantaneous centrifugation. According to the number of the detection samples (including positive control and negative control in the kit), a PCR reaction system (10% loss of the problems required by the preparation of the components in the preparation process) is prepared according to the following table, and then the reagent is put back to below-20 ℃ for storage.
TABLE 1 preparation of PCR amplification reaction System
2) The PCR reaction tube is put in a PCR instrument for amplification, and the reaction conditions are set as follows:
TABLE 2PCR amplification reaction conditions
2. Enzymolysis reaction
1) Preparation of enzymolysis system
Taking out the enzymolysis reagent, placing SAP enzyme on an ice box, thawing the rest components at room temperature, placing on the ice box for standby, mixing for 3-5s by using pre-shaking, and centrifuging instantaneously. According to the detected amount, an enzymolysis reaction system (10% loss of the problems required by the preparation of various components in the preparation process) is prepared according to the following table, and then the reagent is put back to below-20 ℃ for storage.
TABLE 3 preparation of enzymolysis reaction System
2) Adding enzymolysis mixed solution
The amount of 2. Mu.L/well was added to a PCR tube which had finished the PCR amplification reaction, and the mixture was mixed by shaking for 30s and centrifuged at 3000rpm for 30s. All the liquid on the pipe wall is thrown to the bottom of the pipe, if bubbles exist, the pipe is flicked, and the pipe is centrifuged until the bubbles are removed.
3) Enzymolysis reaction
The PCR tube is put into a PCR instrument for enzymolysis, and the reaction conditions are set as follows:
TABLE 4 enzymolysis reaction conditions
Step (a) Cycle number Temperature (temperature) Time
1 1 37℃ 40min
2 1 85℃ 5min
3 1 4℃ Hold
3. Extension reaction
1) Preparation of extension reaction system
Taking out the extension reaction reagent, placing MPE enzyme on an ice box, thawing the rest components at room temperature, placing on the ice box for standby, shaking and mixing for 3-5s before use, and performing instantaneous centrifugation. According to the detected amount, an enzymolysis reaction system (10% loss of the problems required by the preparation of various components in the preparation process) is prepared according to the following table, and then the reagent is put back to below-20 ℃ for storage.
TABLE 5 preparation of extension reaction System
2) Adding an extension reagent
The amount of 4. Mu.L/well was added to the PCR tube which had ended the enzymatic hydrolysis reaction, and the mixture was stirred and stirred for 30s and centrifuged at 3000rpm for 30s. All the liquid on the pipe wall is thrown to the bottom of the pipe, if bubbles exist, the pipe is flicked, and the pipe is centrifuged until the bubbles are removed.
3) Extension reaction
The PCR tube is put into a PCR instrument for enzymolysis, and the reaction conditions are set as follows:
TABLE 6 elongation reaction conditions
5. Resin desalination
1) After the reaction was completed, the mixture was centrifuged at 3000rpm for 30 seconds. The liquid on the pipe wall is totally thrown to the bottom of the pipe. 14. Mu.L of deionized water was added to each PCR tube.
2) Then 10 mu L/resin is added into each PCR tube, the mixture is vibrated and evenly mixed for 30s, and the mixture is centrifuged at 3000rpm for 30s, and all the liquid on the tube wall is thrown to the bottom of the tube.
3) The sample tube with the resin was placed in a tumble mixer and centrifuged at 20rpm for 30min.
4) After the mixing is finished, the mixture is centrifuged at 2000rpm for 1min, and the supernatant is measured.
6. Nucleic acid mass spectrometry detection
1) And taking out the target plate and the matrix liquid, thawing the matrix liquid at room temperature, placing the matrix liquid on an ice box for standby, shaking and uniformly mixing for 3-5s before use, and performing instantaneous centrifugation.
2) According to the volume ratio of 1:1, preparing a mixed solution of a substrate and a sample supernatant, taking 1 mu L of the mixed solution to be spotted on the substrate of a target plate, and drying and crystallizing the mixed solution to be tested.
Table 7 kit composition
The genotype of 31 SNP loci can be directly obtained according to the detection report of the time-of-flight mass spectrum detection system, and manual analysis is not needed.
Example one determination of detection sites
Epileptic medications include mainly sodium valproate, lamotrigine, and carbamazepine, and combinations thereof. A large number of clinical studies indicate that each drug has its corresponding target for evaluating its effect, and the efficacy of antiepileptic drugs is mainly related to the expression level of the relevant gene.
According to the invention, the applicant reads through a large amount of documents, gathers evidence, ranks the evidence, and finally determines the evidence by combining genotype frequency data in a self-built Chinese crowd gene mutation type database. Although the gene loci for guiding the medication guidance of epileptic diseases are many according to the existing data records, 31 loci selected by us are loci which have abundant clinical trial evidence support and are suitable for the genetic characteristics of Chinese people.
The ABCB1 gene, which encodes a transmembrane transport protein known as P-glycoprotein. P-glycoproteins are widely found in different tissues and organs of the human body, including the liver, kidneys, intestinal tract, and blood-brain barrier. It plays an important role in drug metabolism and can expel many exogenous compounds from inside and outside the cell, including anticancer drugs, immunosuppressants, cardiovascular drugs, etc. The ABCB1 gene has a plurality of polymorphic sites, such as rs1045642, rs3789243, rs2032582, which have influence on the sensitivity and drug resistance of antiepileptic drugs such as oxcarbazepine, phenobarbital, vigabatrin and the like. Variations in carrying certain ABCB1 genes may result in increased resistance of patients to certain drugs, thereby affecting drug efficacy.
An ANKK gene encoding a protein having multiple helical repeats and kinase domains, the ANKK1 gene being associated with a variety of physiological and pathological processes, particularly with neurological functions wherein the rs1800497 polymorphic site is associated with the function and signaling of the dopamine system and is associated with the risk of a variety of mental disorders and behavioral characteristics.
The CYP2C19 gene is a gene encoding one of the members of the cytochrome P450 family of enzymes in the liver. It is involved in drug metabolism and when mutated by several Single Nucleotide Polymorphisms (SNPs) of rs4244285, rs 496893, it leads to reduced CYP2C19 enzyme function and thus may exhibit reduced metabolic capacity for antiepileptic drugs such as p, clobazaar, brivaracetam, etc.
The CYP2C9 gene is widely expressed in the liver and participates in metabolism of antiepileptic drugs. The most common CYP2C9 variants are CYP2C92 and CYP2C93, etc. CYP2C92 variation is caused by rs1799853, while CYP2C93 variation is caused by rs 1057910. Individuals carrying CYP2C92 or CYP2C93 alleles may exhibit reduced metabolic capacity for phenytoin, valproic acid, antiepileptic drugs, resulting in slower metabolism of the drug, and increased drug concentrations in the body, increasing the risk of adverse reactions.
The EPHX1 gene is a gene encoding a propionic acid epoxy esterase. The enzyme is involved in the metabolism of epoxides in vivo, converting the epoxide into the corresponding diol compound. While there are several common genetic variations in the EPHX1 gene, in which the SNP rs1051740 causes the amino acid sequence of the EPHX1 enzyme to change, thereby affecting the activity and function of the enzyme. Specifically, the mutation changes leucine (Leu) to isoleucine (Ile). Such mutations may have an effect on the stability and catalytic activity of the EPHX1 enzyme, and the mutation of rs2234922 results in a change in the amino acid sequence of the EPHX1 enzyme, thereby affecting the function of the enzyme. Specifically, the mutation results in the substitution of glutamine (Gln) for lysine (Lys). Such mutations may reduce the metabolic activity of the EPHX1 enzyme. The presence of this type of mutation has the effect of affecting the metabolism of the antiepileptic drug carbamazepine.
The HLA-A gene is located in the a region of the MHC, encoding proteins on the surface membrane that are responsible for displaying foreign antigen fragments to T lymphocytes so that the immune system can recognize and mount an immune response against these antigens. When the rs1061235 and rs2517754 sites are mutated, the amino acid position of the protein encoded by the HLA-A gene is changed, so that the function of the immune system is influenced. Such as carbamazepine, levetiracetam, and the like.
The HLA-B gene is a gene encoding a Major Histocompatibility Complex (MHC) molecule in the human immune system. MHC molecules display foreign antigens to T lymphocytes in the immune system in order to recognize and attack these antigens. When the relevant sites (rs 10484555, rs9263726, rs144012689, rs3909184, rs2844682, rs2074491, rs4711240, rs 1265110) are mutated, the effect of anti-epileptic drug (oxcarbazepine, carbamazepine, phenytoin, lamotrigine) drug treatment and the incidence of adverse reactions may be affected.
NAT2 is a gene encoding amic acid N-ethyl transferase, NAT2 x 6A is a common SNP, also known as rs1799930. It is located in the exon region of the NAT2 gene, resulting in amino acid exchange and reduced NAT2 enzyme activity. Such SNPs affect drug metabolism and detoxification capacity, especially the metabolic rate of the toxin to the antiepileptic drug clonazepam.
Mutations in the POLG gene lead to abnormal polymerase gamma function, affecting the process of mitochondrial DNA replication and repair. These mutations can lead to a neurological disease. The rs113994097 mutation of the nucleotide sequence leads to the 1396 th base in the POLG gene from guanine (G) to adenine (A); the rs113994095 mutation results in the 1399 th base in the polymerase gamma gene being changed from guanine (G) to adenine (a) thereby affecting the activity of the antiepileptic drug valproic acid, which is delivered in vivo.
The SCN1A gene and the SCN2A gene are responsible for encoding sodium channel alpha subunit 1 and encoding ion channel protein of which the site rs3812718 and the rs2304016 mutation on nerve cell membranes influence the transmission of anti-epileptic drug signals such as carbamazepine, phenytoin, lamotrigine, topiramate and the like.
UGT1A4, UGT1A8, UGT2B7 belong to the family of UDP-glucosyltransferases, which are widely expressed in the liver and other tissues, and whose main function is to catalyze the binding of drugs, endogenous compounds and exogenous substances to gluconic acid, thus making them easy to excrete. Whereas mutations at four sites of rs1042597, rs28365062, rs7668258 and rs2011425 may change the activity level of enzymes, thereby affecting the metabolism and excretion of valproic acid and lamotrigine as antiepileptic drugs.
Specifically, the invention provides SNP loci related to antiepileptic drugs as follows.
TABLE 8 31 SNP mutation information
Sequence number Gene Site(s) Mutation type Sequence number Gene Site(s) Mutation type
1 ABCB1 rs1045642 A>G 17 HLA-B rs2074491 T>C
2 ABCB2 rs3789243 A>G 18 HLA-B rs4711240 T>C
3 ABCB3 rs2032582 A>C,T 19 HLA-B rs1265110 C>T
4 ANKK1 rs1800497 G>A 20 HLA-B rs9263726 G>A
5 CYP2C9 rs1799853 C>T 21 NAT2 rs1801280 T>C
6 CYP2C9 rs1057910 A>C 22 NAT2 rs1799930 G>A
7 CYP2C19 rs4244285 G>A 23 POLG rs113994095 C>T
8 ABCB1 rs4986893 G>A 24 POLG rs113994097 C>G
9 EPHX1 rs1051740 T>C 25 SCN1A rs3812718 C>T
10 EPHX1 rs2234922 A>G 26 SCN2A rs2304016 A>G
11 HLA-A rs1061235 A>T 27 SLC7A5 rs4240803 G>A
12 HLA-A rs2517754 A>G 28 UGT1A4 rs2011425 T>G
13 HLA-B rs10484555 T>C 29 UGT1A8 rs1042597 C>G
14 HLA-B rs144012689 T>A 30 UGT2B7 rs28365062 A>G
15 HLA-B rs3909184 G>C 31 UGT2B7 rs7668258 T>C
16 HLA-B rs2844682 G>A
Example two primer design and sequence optimization
After 31 gene locus combinations are determined, the inventor designs special primers for each gene locus, and finally selects primer combinations which can reach 31 locus accurate typing for most samples through multiple times of different primer combinations, and blank control does not have abnormal extension, so that the kit with very obvious application effect is finally obtained. But not only can accurately parting 31 sites, but also can not cause abnormal extension, which is very important for obtaining a qualified kit, and is two requirements which must be met at the same time.
For the determined detection sites, primer sequences are initially designed and then sequence optimization is performed, and for reasons of space, the primer sequences of 2 sites are taken as an example in the embodiment.
1. rs2844682 site
A plurality of groups of amplification primers are designed aiming at the rs2844682 locus, the original primer sequence peak diagram is not obvious (figure 1), the obtained fragment peak diagram is obvious (figure 2) after primer sequence optimization, and the detection results show that the product peak of the locus is stable to form a peak by changing and adjusting primer pair sequences and using primer pairs rs2844682-F2 and rs2844682-R2, so that the locus has better sensitivity and detection effect.
Primer(s) Sequence(s)
rs2844682-F1 ACGTTGGATGTAAGGGTAAAGTCAGGATCCCGGG
rs2844682-R1 ACGTTGGATGCTCTGTGCTCAATTCTCTTTT
rs2844682-F2 ACGTTGGATGTAAAATGGGTCAGGATGGGC
rs2844682-R2 ACGTTGGATGCTCTGTGCTCTTTTCTCTGG
2. rs7668258 site
A plurality of groups of amplification primers are designed aiming at the site rs7668258, through testing, the peak diagram of the original primer (rs 7668258-F1/R1) is not obvious (figure 3), after the primer sequence is optimized, the obtained fragment peak diagram is obvious (figure 4), and the detection results show that the primer base sequence of the site rs7668258 is changed by changing the sequence of the adjustment primer pair and using the primer pairs rs7668258-F2 and rs7668258-R2, so that the peak of the product of the site is stable, and the sensitivity and the detection effect are better.
After optimization, a detection primer is designed for the determined detection site
TABLE 9 primer names and sequences
Example III
The invention performs optimal design and optimal concentration design for the amplification primers and the extension primers for simultaneously detecting 31 SNP loci, and mainly solves the problems of non-specific amplification, competitive combination among primers, amplification failure caused by inter-primer combination and the like.
Primer ratio optimization
Under the condition of determining the primer sequence, partial sites have poor detection performance due to insufficient or excessive addition of the amplified primers, so that the addition of the amplified primers is properly adjusted to ensure optimal detection performance.
The initial use of the concentrations in Table 10, system 1, showed that all product peak signal values were not high, as shown in FIG. 5, and the discussion concluded that too little primer input resulted in insufficient DNA amplification template and eventually in overall lower product peak signal intensity, and that the second adjustment increased all primer inputs by 50% with the extended primer inputs unchanged to configure system 2.
Table 10 System 1
System 2: the amplification primers in the system increased from 0.1. Mu.M to 0.15. Mu.M, the remainder being as in Table 10.
As shown in FIG. 6, the signal value of the product peak of the system 2 is obviously better than that of the system 1, all sites except the site of DX6 (rs 28365062), the site of DX9 (rs 1042597) have product peaks, and the product peaks of the sites of DX1 (rs 1045642), DX9 (rs 1042597), DX12 (rs 113994095), DX17 (rs 1799853), DX 19 (rs 4244285) and DX 21 (rs 2844682) are lower, so that the result is unstable.
System 3: ABCB1 (rs 1045642) F/R, ABCB1 (rs 1045642) F/R, HLA-B (rs 2074491) F/R, HLA-B (rs 1265110) F/R, NAT2 (rs 1801280) F/R amplification primers increased from 0.15. Mu.M to 0.18. Mu.M, the remainder being system 2.
As shown in FIG. 7, the problem that the product peak signal values of DX9 (rs 1042597) and DX6 (rs 28365062) are not stable is solved in the optimizing system 3, and for the problem that the product peak signal values of DX1 (rs 1045642), DX12 (rs 113994095), DX17 (rs 1799853), DX 19 (rs 4244285), DX 21 (rs 2844682) and the site that is difficult to amplify have amplification space in order to make the site that is difficult to amplify such as DX12 and DX 19 in a saturated state, the site that has stronger amplification capacity is solved in the optimizing system 3 (rs 1045642), DX17 (rs 1799853), DX 21 (rs 2844682) and the site that is difficult to amplify such as DX12 (rs 113994095) and DX 19) still have the problem that the product peak signal values of DX12 (rs 4244285) are unstable, and the amplification effect of the site that is difficult to amplify such as the site that is stronger in the PCR 12 and the PCR (rs 4244285) is reduced by the amount of the primer that the site that is required to be amplified by reducing the amount of the amplification of the site that is required to be extended to be increased to be as rs 113994095). For this purpose, optimization system 4 was to reduce the site extension primers of DX 5 (rs 7668258), DX 15 (rs 1801280), DX 21 (rs 2844682), DX 22 (rs 1799930), DX 30 (rs 2032582) by 30% and the PCR primers and extension primers of DX 8 (rs 4711240) by 30% on the basis of system 3.
Table 11 System 4
The amplified and extended products were detected on-machine, and the results were shown in FIG. 8, in which all sites were stable in peak and the signal values were relatively high.
Example IV
In the system optimization process, 2-3 samples are verified by Sanger sequencing at each detection site, and the comparison results are consistent, so that the detection result of the embodiment is accurate. In this example, a series of verification experiments, including accuracy and precision, were performed after confirming the optimal reaction system. The specific verification scheme is as follows:
(1) Accuracy experiment verification scheme: one sample of each of the 31 SNP loci was selected for Sanger sequencing, and the results of Sanger sequencing and Mass ARRAY were compared, and the identity was confirmed to be greater than 95%.
(2) The precision experiment verification scheme is as follows: 3 exceptional peripheral blood samples and 3 corresponding oral swab samples are selected, each sample is repeatedly detected for 3 times in one batch, the consistency of the peripheral blood and oral swab results is 100%, and the consistency of the precision between batches and the precision in batches is greater than 95% and passes the verification.
The specific verification process is as follows: first, the solution required for the reaction was prepared according to the system 3 optimized in example III of the present invention. Then, the results were analyzed by the procedure of example one, including PCR amplification, shrimp alkaline phosphatase consumption, single-base extension, desalting, and Mass ARRAY sample application analysis. The accuracy and precision results are shown in Table 12 below.
Table 12 verification of accuracy
As can be seen from comparison of the Mass ARRAY results and Sanger results of 10 samples, the accuracy of the system verification experiment of the invention is 100%.
TABLE 13 results of verification of precision
By comparing the detection results of 3 batches of the 3-exception peripheral blood sample and the corresponding 3-instance oral swab sample, the consistency of the system of the invention among-batch precision, in-batch precision, personnel comparison and reagent comparison is 100%.
Finally, it should be noted that: the foregoing description is only a preferred embodiment of the present invention, and the present invention is not limited thereto, but it is to be understood that modifications and equivalents of some of the technical features described in the foregoing embodiments may be made by those skilled in the art, although the present invention has been described in detail with reference to the foregoing embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (10)

1. A primer set for detecting an epileptic SNP, the SNP comprising: rs1045642, rs3789243, rs2032582, rs1800497, rs1799853, rs1057910, rs4244285, rs 496893, rs1051740, rs2234922, rs1061235, rs2517754, rs10484555, rs144012689, rs3909184, rs2844682, rs2074491, rs4711240, rs1265110, rs9263726, rs1801280, rs1799930, rs113994095, rs113994097, rs3812718, rs2304016, rs4240803, rs2011425, rs1042597, rs28365062, and rs7668258;
the primer group comprises amplification primers, and the sequences of the amplification primers are shown as SEQ ID NO. 1-62.
2. The primer set for detecting an epileptic SNP of claim 1, wherein said primer set further comprises 31 single base extension primers; the single base extension primer sequence is shown as SEQ ID NO. 63-94.
3. The primer set for detecting epileptic SNPs according to claim 2, wherein the molar concentration of the 31 single base extension primers is as follows: 0.3-2.9. Mu.M.
4. The primer set for detecting epileptic SNP according to claim 3, wherein the amplification primer and the single base extension primer are added in the following amounts:
site(s) Name of the name Amplification primer 1 (μM) Extension primer 1 (μM) ABCB1(rs1045642) ABCB1(rs1045642)F/R 0.18/0.18 0.397 ABCB2(rs3789243) ABCB2(rs3789243)F/R 0.15/0.15 0.420 ABCB3(rs2032582) ABCB3(rs2032582)F/R 0.15/0.15 0.440 ANKK1(rs1800497) ANKK1(rs1800497)F/R 0.15/0.15 0.468 CYP2C9(rs1799853) CYP2C9(rs1799853)F/R 0.15/0.15 0.339 CYP2C9(rs1057910) CYP2C9(rs1057910)F/R 0.15/0.15 0.533 CYP2C19(rs4244285) CYP2C19(rs4244285)F/R 0.15/0.15 0.574 ABCB1(rs4986893) CYP2C19(rs4986893)F/R 0.105/0.15 0.430 EPHX1(rs1051740) EPHX1(rs1051740)F/R 0.15/0.15 0.663 EPHX1(rs2234922) EPHX1(rs2234922)F/R 0.15/0.15 0.701 HLA-A(rs1061235) HLA-A(rs1061235)F/R 0.15/0.15 0.758 HLA-A(rs2517754) HLA-A(rs2517754)F/R 0.18/0.18 0.805 HLA-B(rs10484555) HLA-B(rs10484555)F/R 0.15/0.15 0.859 HLA-B(rs144012689) HLA-B(rs144012689)F/R 0.15/0.15 0.914 HLA-B(rs3909184) HLA-B(rs3909184)F/R 0.15/0.15 0.678 HLA-B(rs2844682) HLA-B(rs2844682)F2/R2 0.15/0.15 1.032 HLA-B(rs2074491) HLA-B(rs2074491)F/R 0.18/0.18 1.083 HLA-B(rs4711240) HLA-B(rs4711240)F/R 0.15/0.15 1.146 HLA-B(rs1265110) HLA-B(rs1265110)F/R 0.18/0.18 1.236 HLA-B(rs9263726) HLA-B(rs9263726)F/R 0.15/0.15 1.292 NAT2(rs1801280) NAT2(rs1801280)F/R 0.18/0.18 0.981 NAT2(rs1799930) NAT2(rs1799930)F/R 0.15/0.15 1.028 POLG(rs113994095) POLG(rs113994095)F/R 0.15/0.15 1.553 POLG(rs113994097) POLG(rs113994097)F/R 0.15/0.15 1.622 SCN1A(rs3812718) SCN1A(rs3812718)F/R 0.15/0.15 1.782 SCN2A(rs2304016) SCN2A(rs2304016)F/R 0.15/0.15 1.888 SLC7A5(rs4240803) SLC7A5(rs4240803)F/R 0.15/0.15 1.992 UGT1A4(rs2011425) UGT1A4(rs2011425)F/R 0.15/0.15 2.061 UGT1A8(rs1042597) UGT1A8(rs1042597)F/R 0.15/0.15 2.326 UGT2B7(rs28365062) UGT2B7(rs28365062)F/R 0.15/0.15 1.854 UGT2B7(rs7668258) UGT2B7(rs7668258)F2/R2 0.15/0.15 2.854
5. A composition for epileptic medication guidance detection, characterized in that the composition comprises a primer set according to any one of claims 1-4.
6. A product for epileptic medication guided detection, characterized in that the composition comprises a primer set according to any one of claims 1-4.
7. A kit for epileptic medication guided detection, characterized in that the composition comprises a primer set according to any one of claims 1-4.
8. The kit for epileptic drug-guided detection of claim 7, further comprising conventional reagent components for MALDI-TOF MS nucleic acid mass spectrometry detection.
9. Use of a primer set according to any one of claims 1-4 for the preparation of a epileptic drug-guided test product.
10. The method for detecting the SNP locus genotype related to antiepileptic drug metabolism and drug resistance in the sample to be detected is characterized by comprising the following steps:
1) Performing PCR amplification on a sample to be detected by using the amplification primer according to any one of claims 1 to 4 to obtain a PCR amplification product;
2) Performing alkaline phosphatase digestion on the PCR amplification product to obtain a digestion product;
3) Carrying out single base extension reaction on the digestion product by using a single base extension primer in the primers to obtain a single base extension reaction product;
4) Purifying the single-base extension reaction product, and then performing matrix-assisted laser analysis ionization time-of-flight mass spectrometry detection on a sample application machine to obtain the genotype of SNP locus related to epileptic drug metabolism and drug resistance in a sample to be detected;
preferably, the template for PCR amplification is genomic DNA of a sample to be tested;
the PCR amplification procedure was: 95 ℃ for 15min;95℃for 15s, 59℃for 30s, 72℃for 30s,35 cycles; 60 ℃ for 10min;
the single base extension reaction is performed by the following steps: 95℃30s,95℃5s, (52℃5s, 80℃5s,5 cycles), 40 cycles, and 72℃3min.
CN202311870109.6A 2023-12-29 2023-12-29 Detection composition and kit for epileptic medication guidance and application of detection composition and kit Active CN117867099B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311870109.6A CN117867099B (en) 2023-12-29 2023-12-29 Detection composition and kit for epileptic medication guidance and application of detection composition and kit

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311870109.6A CN117867099B (en) 2023-12-29 2023-12-29 Detection composition and kit for epileptic medication guidance and application of detection composition and kit

Publications (2)

Publication Number Publication Date
CN117867099A true CN117867099A (en) 2024-04-12
CN117867099B CN117867099B (en) 2024-06-11

Family

ID=90585973

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311870109.6A Active CN117867099B (en) 2023-12-29 2023-12-29 Detection composition and kit for epileptic medication guidance and application of detection composition and kit

Country Status (1)

Country Link
CN (1) CN117867099B (en)

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108707658A (en) * 2018-06-12 2018-10-26 东莞博奥木华基因科技有限公司 A kind of personalized medicine gene detecting kit and application
CN109468379A (en) * 2018-12-30 2019-03-15 广州金域医学检验中心有限公司 Detect the nucleotide and detection method of the SNP site of gene relevant to anti-epileptic class drug
CN109825574A (en) * 2019-03-20 2019-05-31 宁波海尔施基因科技有限公司 A kind of multiple gene detection kit and its application method for antiepileptic medication guide
CN111118149A (en) * 2020-03-03 2020-05-08 上海康黎医学检验所有限公司 Kit for guiding medication of people for epileptic diseases and application thereof
WO2021004010A1 (en) * 2019-07-11 2021-01-14 南京先声医学检验有限公司 Primer set, application, product and method for detecting snp loci related to medication for mental and neurological diseases
CN113136424A (en) * 2021-05-21 2021-07-20 广州合一生物科技有限公司 Gene detection kit for individual medication of antiepileptic drugs and application thereof
CN113192649A (en) * 2021-06-01 2021-07-30 山东英盛生物技术有限公司 System for guiding individualized and accurate medication of epileptic diseases

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108707658A (en) * 2018-06-12 2018-10-26 东莞博奥木华基因科技有限公司 A kind of personalized medicine gene detecting kit and application
CN109468379A (en) * 2018-12-30 2019-03-15 广州金域医学检验中心有限公司 Detect the nucleotide and detection method of the SNP site of gene relevant to anti-epileptic class drug
CN109825574A (en) * 2019-03-20 2019-05-31 宁波海尔施基因科技有限公司 A kind of multiple gene detection kit and its application method for antiepileptic medication guide
WO2021004010A1 (en) * 2019-07-11 2021-01-14 南京先声医学检验有限公司 Primer set, application, product and method for detecting snp loci related to medication for mental and neurological diseases
CN111118149A (en) * 2020-03-03 2020-05-08 上海康黎医学检验所有限公司 Kit for guiding medication of people for epileptic diseases and application thereof
CN113136424A (en) * 2021-05-21 2021-07-20 广州合一生物科技有限公司 Gene detection kit for individual medication of antiepileptic drugs and application thereof
CN113192649A (en) * 2021-06-01 2021-07-30 山东英盛生物技术有限公司 System for guiding individualized and accurate medication of epileptic diseases

Also Published As

Publication number Publication date
CN117867099B (en) 2024-06-11

Similar Documents

Publication Publication Date Title
CN110184345B (en) Primer group, application, product and method for detecting SNP (single nucleotide polymorphism) sites related to drug administration for mental and neurological diseases
CN108192966B (en) Complete set of primers for detecting drug metabolizing enzyme gene SNP locus and application thereof
Alda et al. Investigating responders to lithium prophylaxis as a strategy for mapping susceptibility genes for bipolar disorder
CN109136365B (en) Detection method for children personalized medication analysis based on SNP (Single nucleotide polymorphism) locus and application thereof
CN111778329B (en) Molecular marker of asthma-related gene, detection primer set and application thereof
Lin et al. Abnormal peripheral neutrophil transcriptome in newly diagnosed type 2 diabetes patients
CN110699440A (en) Primer and method for detecting SNP (single nucleotide polymorphism) locus of gene related to metformin personalized medicine
CN108823301A (en) It is a kind of for detecting the multiple PCR detection kit of people's drug gene polymorphism
CN109097459B (en) Detection method for adult common anti-infective drug administration analysis based on SNP locus and application thereof
CN107893114A (en) For primer pair, kit and the method for instructing fentanyl class medicine personalized medicine related gene to detect
CN117867099B (en) Detection composition and kit for epileptic medication guidance and application of detection composition and kit
CN112941182B (en) Gene detection method for medicine for treating rheumatic immune diseases based on nucleic acid mass spectrometry and application of gene detection method
CN110358821A (en) Detect primer, kit and the method for glucose 6 phosphate dehydrogenase deficiency G6PD gene mutation
CN101481743B (en) Reagent kit for detecting Marfan's syndrome and preparation thereof
CN103131776A (en) A719G single nucleotide polymorphism detection kit of thiopurine methyltransferase (TPMT) * 3C
CN113755581B (en) Nucleic acid composition, kit and method for detecting gene related to mental disease drug administration by matrix-assisted laser desorption time-of-flight mass spectrometry
CN103695534A (en) Primer and method for detecting C829T mononucleotide polymorphism of DHFR
CN108018351A (en) The relevant biomarker of metabolic disease and its application caused by a kind of high lipid food with intake
CN101445824B (en) Primer for detecting sulfonylureas receptor 1 gene polymorphism sites, the application thereof and kits thereof
CN112646869B (en) Guidance method and kit for atorvastatin personalized medicine genes
US11560595B2 (en) Method for preventing progression to type II Diabetes
CN118726566A (en) Related gene detection kit for guiding medication of epilepsy of human and application thereof
CN109486957A (en) Pig multiple groups integrate accurate breeding method
CN113398247B (en) Application of substance for promoting CD44 level in preparation of product for treating/preventing vascular endothelial inflammation by promoting CD44
CN118406755B (en) Gene polymorphism detection primer set and kit for guiding drug administration of Parkinson's disease

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant