CN109517907A - Primer combines the application in Species estimation and/or the duck identification of duck - Google Patents
Primer combines the application in Species estimation and/or the duck identification of duck Download PDFInfo
- Publication number
- CN109517907A CN109517907A CN201811634125.4A CN201811634125A CN109517907A CN 109517907 A CN109517907 A CN 109517907A CN 201811634125 A CN201811634125 A CN 201811634125A CN 109517907 A CN109517907 A CN 109517907A
- Authority
- CN
- China
- Prior art keywords
- primer
- nucleotide sequence
- duck
- seq
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to field of biotechnology, in particular to application of the primer combination in Species estimation and/or the duck identification of duck.The primer combines high specificity, and duck or duck in energy precise Identification sample.Using LAMP technology in real-time fluorescence PCR instrument the duck nucleic acid DNA in the sample based on meat such as real-time detection raw meat, processed meat food.Primer high sensitivity that the present invention screens, high specificity, the detection method of foundation has the advantages that accuracy rate is high, detection time is short, result can be observed in real time, 1h is only needed from sample treatment to report result, it is easy to operate, there is higher specificity than other PCR methods, there is detection speed faster than existing congenic method.The LAMP primer of detection chicken provided by the invention, can detect the nucleic acid of 20fg, and detected in total reaction time 50min using fluorescence method LAMP, can be observed in real time as a result, avoiding the risk polluted.
Description
Technical field
The present invention relates to field of biotechnology, in particular to primer combination answering in Species estimation and/or the duck identification of duck
With.
Background technique
Meat is the main source of our mankind's good proteins and various nutrients, necessary amino acid rich in and a variety of micro-
Secondary element.In recent years, with the raising of China's Living consumption, only the meat of domestic production is far from meeting the market demand,
It needs from external inlet part meat.These factors are taken advantage of a weak point for domestic and international illegal retailer and are created condition, on the market meat
Adulterated and fraud also have been to be concerned by more and more people.Although duck is a kind of to very healthy meat, but same
When, duck is also often used as adulterated meat to emit the expensive meat such as mutton, beef, and such case can be found everywhere.Institute
With in order to ensure consumer legitimate right, it is very necessary for establishing effective meat source constituent identification method.
For society now, traditional meat form discrimination method by sense organ and experience is no longer satisfied market pair
Meat products adulteration carries out the needs of control supervision.At present to the identification method of meat products mainly in protein and nucleic acid water
It is flat to carry out.In protein level, the common technologies such as ELISA and high performance liquid chromatography are detected, be limited in that instrument,
Reagent and sample treatment require height, and specificity and accuracy are poor when detection processed sample, time-consuming and laborious.Comparatively, it examines
The mode for surveying nucleic acid is more convenient accurate.In nucleic acid level, common nucleic acid level detection technique has PCR and real-time fluorescence PCR.
Round pcr is the method for most common detection meat derived component, because its sensitivity with higher, specificity and can grasp
The property made.But general PCR reacts at least 1.5h, and late detection is needed using gene sequencing and gel electrophoresis, and gel electrophoresis
In EB have strong carcinogenicity, have some potential safety problems.And real-time fluorescence PCR needs expensive instrument and reagent, and anti-
At least 1.5h between seasonable, and have higher requirements to operator, it is difficult to it is promoted in base.
Prior art discloses a kind of LAMP primer for detecting chicken, the pole which detects in total reaction time 60min
It is limited to the nucleic acid of 50fg, the visualization method used is that after the completion of reaction, whether the system after observing response becomes cloudy, this
Although method is easy, due to the individual difference and not no interpretation range of standard, it is easy to caused in result interpretation false sun or
The result erroneous judgement of false yin.Another method for visualizing is to uncap dyestuff is added to make its colour developing after the reaction, during this extremely
It is be easy to cause product pollution, other Testing index is caused false positive phenomenon occur.
Summary of the invention
In view of this, the present invention provides a kind of high specificity, and can in precise Identification sample duck LAMP primer and detection
Method.
In order to achieve the above-mentioned object of the invention, the present invention the following technical schemes are provided:
The present invention provides application of the mitochondrial cytochrome b gene in Species estimation and/or the duck identification of duck.
In addition, there is the nucleotide sequence as shown in SEQ ID NO:7 the present invention also provides a kind of marker.
On this basis, the present invention also provides have the nucleotide of the sequence as shown in SEQ ID NO:7 as marker in duck
Species estimation and/or duck identification in application.
On the basis of the studies above, the present invention also provides primer combinations, comprising: primer-F3, primer-B3, primer-FIP,
Primer-BIP, primer-LF and primer-LB；
Primer-the F3 has any one in nucleotide sequence as follows:
(I), there is nucleotide sequence shown in SEQ ID NO:1；
(II), have nucleotide sequence shown in SEQ ID NO:1 through modification, substitution, one or more alkali are deleted and/or added
The nucleotide sequence that base obtains；
(III), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:1；
(IV), the complementary series of the sequence as shown in (I), (II) or (III)；
Primer-the B3 has any one in nucleotide sequence as follows:
(V), there is nucleotide sequence shown in SEQ ID NO:2；
(VI), have nucleotide sequence shown in SEQ ID NO:2 through modification, substitution, one or more alkali are deleted and/or added
The nucleotide sequence that base obtains；
(VII), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:2；
(VIII), the complementary series of the sequence as shown in (V), (VI) or (VII)；
Primer-the FIP has any one in nucleotide sequence as follows:
(IX), there is nucleotide sequence shown in SEQ ID NO:3；
(X), have nucleotide sequence shown in SEQ ID NO:3 through modification, substitution, one or more alkali are deleted and/or added
The nucleotide sequence that base obtains；
(XI), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:3；
(XII), the complementary series of the sequence as shown in (IX), (X) or (XI)；
Primer-the BIP has any one in nucleotide sequence as follows:
(XIII), there is nucleotide sequence shown in SEQ ID NO:4；
(XIV), have nucleotide sequence shown in SEQ ID NO:4 one or more through modification, substitution, deletion and/or addition
The nucleotide sequence that base obtains；
(XV), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:4；
(XVI), the complementary series of the sequence as shown in (XIII), (XIV) or (XV)；
Primer-the LF has any one in nucleotide sequence as follows:
(XVII), there is nucleotide sequence shown in SEQ ID NO:5；
(XVIII), have nucleotide sequence shown in SEQ ID NO:5 through modification, substitution, deletion and/or addition one or more
The nucleotide sequence that a base obtains；
(XIX), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:5；
(XX), the complementary series of the sequence as shown in (XVII), (XVIII) or (XIX)；
Primer-the LB has any one in nucleotide sequence as follows:
(XXI), there is nucleotide sequence shown in SEQ ID NO:6；
(XXII), have nucleotide sequence shown in SEQ ID NO:6 one or more through modification, substitution, deletion and/or addition
The nucleotide sequence that base obtains；
(XXIII), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:6；
(XXIV), the complementary series of the sequence as shown in (XXI), (XXII) or (XXIII).
In some specific embodiments of the invention, primer-F3 described in primer combination, the primer-B3, described draw
Object-FIP, the primer-BIP, the primer-LF and the primer-LB molar ratio be 0.3:0.3:2.4:2.4:1:1.
The present invention also provides a kind of kits, combine including the primer.
The present invention also provides primer combinations or the kit in Species estimation and/or the duck identification of duck
Using.
On the basis of the studies above, the present invention also provides the methods of the Species estimation of duck, include the following steps:
(1) nucleic acid of sample to be tested is obtained；
(2) primer in primer combination as described in claim 4 or 5 is respectively adopted as template in the nucleic acid extracted using step (1)
Ring mediated isothermal amplification is carried out, amplification is obtained；
(3) obtain qualification result according to the amplification: if specific amplification may be implemented, sample to be tested is duck；Such as
Fruit can not achieve specific amplification, then sample to be tested is not duck.
In addition, including the following steps: the present invention also provides the method for the identification of duck
(1) nucleic acid of sample to be tested is obtained；
(2) primer in primer combination as described in claim 4 or 5 is respectively adopted as template in the nucleic acid extracted using step (1)
Ring mediated isothermal amplification is carried out, amplification is obtained；
(3) obtain qualification result according to the amplification: if specific amplification may be implemented, sample to be tested is duck；
If can not achieve specific amplification, sample to be tested is not duck.
In some specific embodiments of the invention, the reaction system of the ring mediated isothermal amplification are as follows: the outer primer of 0.3mM
Each 0.12 μ L of F3 and B3；Each 0.96 μ L of inner primer FIP and BIP of 2.4mM；Each 0.4 μ L of ring primer LF and LB of 1mM；2 × reaction
10 μ L of buffer；The sample to be tested nucleic acid of 1 μ L adds water to 20 μ L systems.
In some specific embodiments of the invention, the reaction temperature of the ring mediated isothermal amplification is 60 DEG C~65 DEG C, instead
It is 50min between seasonable.
The present invention provides a kind of high specificity, and can in precise Identification sample duck LAMP primer group and methods for using them.Make
With LAMP technology in real-time fluorescence PCR instrument the duck in the sample based on meat such as real-time detection raw meat, processed meat food
Nucleic acid DNA.Primer high sensitivity that the present invention screens, high specificity, when the detection method of foundation has high accuracy rate, detection
Between short, result the advantages of can observing in real time, only need 1h from sample treatment to report result, it is easy to operate, have than other PCR methods
There is higher specificity, there is detection speed faster than existing congenic method.
The LAMP primer of detection chicken provided by the invention, can detect the nucleic acid of 20fg in total reaction time 50min, and
It is detected, is can be observed in real time as a result, avoiding the risk polluted using fluorescence method LAMP.
Detailed description of the invention
It in order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, below will be to embodiment or existing skill
Attached drawing needed in art description is briefly described.
When Fig. 1 shows that the duck nucleic acid DNA of 20ng/ μ L carries out the real-time fluorescence value of LAMP reaction with reacting using primer of the invention
Between scheme；
Fig. 2 shows the positive plasmid containing duck CytB gene, duck nucleic acid DNA, meat of a sheep nucleic acid DNA, the Carnis Bovis seu Bubali core of 20ng/ μ L
When sour DNA, chicken nucleic acid DNA, pork nucleic acid DNA carry out the real-time fluorescence value of LAMP reaction with reacting using primer of the invention
Between scheme, investigate the specificity of primer, as a result positive expand occur in the positive plasmid only containing duck CytB gene and duck nucleic acid DNA
Increase；
Fig. 3 (A)~Fig. 3 (F) shows the positive control sample Plasmid DNA of 20ng/ μ l with 10-1、10-2、10-3、10-4、10-5、10-6's
After dilution carries out gradient dilution, the real-time fluorescence value of LAMP reaction is carried out using primer of the invention and the reaction time schemes；
When Fig. 4 shows that the duck nucleic acid DNA of 20fg/ μ L carries out the real-time fluorescence value of LAMP reaction with reacting using primer of the invention
Between scheme, result be sensitivity under repeatability (20/20) investigate result.
Specific embodiment
The invention discloses a kind of application of primer combination in Species estimation and/or the duck identification of duck, those skilled in the art
Member can use for reference present disclosure, be suitably modified realization of process parameters.In particular, it should be pointed out that all similar substitutions and modifications
Apparent to those skilled in the art, they are considered as being included in the present invention.Method and application of the invention
Be described by preferred embodiment, related personnel obviously can not depart from the content of present invention, in spirit and scope it is right
Method described herein and application are modified or appropriate changes and combinations, carry out implementation and application the technology of the present invention.
The present invention provides a kind of high specificities, and the LAMP of duck is detected with primer, LAMP detection in energy precise Identification sample
Primer are as follows:
Outer primer YZ-F3-1:5 '-GAATGATACTTCCTATTCGCCT-3 ' (as shown in SEQ ID NO:1)；
Outer primer YZ-B3-1:5 '-GGTGAAGTAAGTAATTGATGCG-3 ' (as shown in SEQ ID NO:2)；
Inner primer YZ-FIP-1:5 '-ACCAGGAATAGGATTAGGACGGAGCCATCCTGCGGTCAATC-3 ' (such as SEQ ID
Shown in NO:3)；
Inner primer YZ-BIP-1:5 '-CTCCTATTCTGAACACTAGTGGCCATGCCCGATGATGATGAA-3 ' (such as SEQ ID
Shown in NO:4)；
Ring primer YZ-LF-1:5 '-GACGCCTCCTAGTTTGTTTGG-3 ' (as shown in SEQ ID NO:5)；
Ring primer YZ-LB-1:5 '-GGAAGCCAACCTGTCGAACAC-3 ' (as shown in SEQ ID NO:6).
The primer is designed for the compressed sequence of the Cytb gene of the duck provided in ncbi database；In order to improve
The sensitivity of primer determines by literature survey and selects chondriogen Cytb as test object.In the nt database of NCBI
In be collected into the Cytb sequences of 200 ducks altogether, the sequence being collected into is compared using BioEdit software, and is compressed
Consensus Sequence sequence is generated, this sequence is compressed sequence.In order to improve the specificity of primer, this primer is being set
Timing is compared using the compressed sequence of the compressed sequence and other species, and (other species include: pig, yak, ox, water
The common species such as ox, sheep, goat, donkey, horse, goose, chicken, mouse, cat, dog, fox, rabbit and people), finally having determined can guarantee this
One section of sequence of primer specificity no problem has carried out LAMP primer design.Because the design of the primer LAMP primer needs artificial special
The opposite sex distinguishes other species, therefore the present invention compresses, from the sequence alignment of each species to the comparison of interspecies differences, obtains
The representative gene order section (as shown in SEQ ID NO:7) obtained for above-mentioned analysis, then the method for passing through engineer
More set primer combinations have been obtained, a series of activities such as screening and the modification optimization of primer combination, sensitivity, repeatability are then carried out
With specificity all reach best level primer combination, in test sample whether containing duck ingredient have high specificity
And sensitivity.
SEQ ID NO:7:
CTAGGGGACCCAGAAAACTTCACCCCCGCAAACCCCCTAGTAACCCCACCACACATYAAACCAGAATGATAC
TTCCTATTCGCCTACGCCATCCTGCGGTCAATCCCAAACAAACTAGGAGGCGTCCTAGCACTAGCCGCCTCCGTCC
TAATCCTATTCCTGGTCCCMTTCCTCCACAAATCAAAACAACGARCAATAACATTCCGGCCGCTCTCCCAACTCCT
ATTCTGAACACTAGTGGCCAACCTCCTCGTCCTAACATGAGTGGGAAGCCAACCTGTCGAACACCCATTCATCATC
ATCGGGCAACTCGCATCAATTACTTACTTCACCATCCTCCTATTCCT。
Wherein, Y, M, R are degeneracy base, Y=C/T, M=A/C, R=A/G.
Another aspect of the present invention is to provide a kind of high specificity, and can in precise Identification sample duck LAMP detection method,
It is characterized in that, carrying out LAMP amplification using above-mentioned LAMP primer.
In order to advanced optimize above-mentioned detection method, technical solution provided by the invention further include:
Each 0.12 μ L of outer primer F3 and B3 of 0.3mM；Each 0.96 μ L of inner primer FIP and BIP of 2.4mM；The ring primer LF of 1mM and
Each 0.4 μ L of LB；2 × reaction buffer, 10 μ L；The sample DNA of 1 μ L adds sterilizing purified water to 20 μ L systems.
Above-mentioned LAMP detects reaction condition are as follows: 60 DEG C of -65 DEG C of constant temperature 50min.
Preferably, above-mentioned LAMP detects reaction condition are as follows: 65 DEG C of constant temperature 50min.
In above-mentioned LAMP detection method, testing result can directly pass through the appearance time of observation real-time fluorescence PCR instrument.
Another aspect of the present invention also provides a kind of high specificity, and can in precise Identification sample duck LAMP detection method, duck
It include above-mentioned LAMP detection primer in meat detection method.
The present invention provides a kind of high specificity, and can in precise Identification sample duck LAMP primer group and methods for using them.Make
With LAMP technology in real-time fluorescence PCR instrument the duck in the sample based on meat such as real-time detection raw meat, processed meat food
Nucleic acid DNA.Primer high sensitivity that the present invention screens, high specificity, when the detection method of foundation has high accuracy rate, detection
Between short, result the advantages of can observing in real time, only need 1h from sample treatment to report result, it is easy to operate, have than other PCR methods
There is higher specificity, there is detection speed faster than existing congenic method.
Primer combination provided by the invention raw material and reagent involved in the application in Species estimation and/or the duck identification of duck
It is available on the market.
Below with reference to embodiment, the present invention is further explained:
The preparation of 1 primer of embodiment
The primer sequence is synthesized by Sheng Gong company.6 primers, including two inner primers (FIP and BIP) are designed for target sequence
With two outer primers (F3 and B3) and two ring primers (LF and LB), nucleotide sequence is listed in table 1.
The concrete configuration of LAMP detection architecture is each 0.12 μ L of outer primer F3 and B3 of 0.3mM；The inner primer FIP and BIP of 2.4mM
Each 0.96 μ L；Each 0.4 μ L of ring primer LF and LB of 1mM；2 × reaction buffer, 10 μ L；The sample DNA of 1 μ L, adds sterilizing purified water
To 20 μ L systems.
The LAMP detects reaction condition are as follows: 65 DEG C of constant temperature 50min.
1. loop-mediated isothermal amplification technique the primer information of table
The preparation of 2 nucleic acid DNA template of embodiment
Rigorous aseptic acquires fresh musculature 50mg of duck, sheep, ox, chicken, pig or so and is used as sample, then uses Tiangeng
Animal tissue's genome DNA extracting reagent kit (paramagnetic particle method) extracts the DNA in each tissue respectively.
3 specific test of embodiment
The positive plasmid (positive control) containing duck CytB gene saved respectively with this laboratory, sterilizing purified water are (negative right
According to), duck DNA, meat of a sheep DNA, Carnis Bovis seu Bubali DNA, chicken DNA and pork DNA are that template establishes LAMP reaction system, are carried out
LAMP augmentation detection；Each genomic DNA concentration and purity are measured using NanoDrop 2000C ultramicrospectrophotometer, and will
The genomic DNA of all samples is diluted to 20ng/uL.
The genomic nucleic acids DNA of above-mentioned 5 kinds of control samples, which is extracted, uses Tiangeng animal tissue extracting genome DNA reagent
Box (paramagnetic particle method) is completed；Positive plasmid containing duck CytB gene is that health is that century extraction of plasmid DNA kit is completed.
LAMP reaction result is determined by such as following principle.
As a result the phenomenon that being judged as positive reaction are as follows: it is expanded using real-time fluorescence PCR instrument, observes real-time fluorescence curves,
Reaction time is 50min, observes the appearance time of real-time fluorescence curves.Negative control experiment is done with the purified water that sterilizes, it is negative right
It should be negative according to experimental result.(see Fig. 2)
If 1) Ct≤40, determine that LAMP test result is the positive；
If 2) Ct > 45, do not occur 1) described in phenomenon, determine LAMP test result be feminine gender；
If 3) 40 Ct≤45 <, occur 1) described in phenomenon, determine LAMP test result be it is suspicious, need to test again；
4) after testing again to suspect results, if Ct≤45, phenomenon described in appearance 1) determines that LAMP test result is the positive,
Otherwise it is judged as negative.
(no real-time fluorescence is bent is not detected within the 50min time of reaction to other genomes not containing duck in sample
Line), it is shown as negative reaction.
Table 2. experiment meat and LAMP testing result
Repeated experiment under 4 sensitivity of embodiment and sensitivity
The positive control sample of embodiment 1 is dense using NanoDrop 2000C ultramicrospectrophotometer measurement genomic DNA
Degree and purity, and positive control sample Plasmid DNA is diluted to 20ng/ μ L, then by the positive control sample plasmid of 20ng/ μ l
DNA is with 10-1、10-2、10-3、10-4、10-5、10-6Dilution carry out gradient dilution, finally use the test side LAMP of the invention
Method is measured above-mentioned DNA sample.
When the concentration of duck nucleic acid DNA in sample is 20fg/ μ L, the reacting positive result interpretation time is less than 40min (actual measurement Ct
Value=23.4min) (Fig. 3).
The positive control sample of embodiment 1 is dense using NanoDrop 2000C ultramicrospectrophotometer measurement genomic DNA
Degree and purity, and by positive control sample Plasmid DNA be diluted to 20fg/ μ L (be diluted to the primer can be detected it is minimum
Concentration), repeated measurement finally is carried out to above-mentioned DNA sample using LAMP test method of the invention.Number of repetition is 20 times.
(Fig. 4)
Therefore, the detection sensitivity of LAMP detection method qualitative experiment of the present invention at least can reach 20fg/ μ L (dilution
Degree is 10-6)。
The above is only a preferred embodiment of the present invention, it is noted that those skilled in the art are come
It says, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications also should be regarded as
Protection scope of the present invention.
Sequence table
<110>Capitalbio Corporation Co., Ltd.
<120>application of the primer combination in Species estimation and/or the duck identification of duck
<130> MP1832066
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gaatgatact tcctattcgc ct 22
<210> 2
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
ggtgaagtaa gtaattgatg cg 22
<210> 3
<211> 41
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
accaggaata ggattaggac ggagccatcc tgcggtcaat c 41
<210> 4
<211> 42
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
ctcctattct gaacactagt ggccatgccc gatgatgatg aa 42
<210> 5
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
gacgcctcct agtttgtttg g 21
<210> 6
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
ggaagccaac ctgtcgaaca c 21
<210> 7
<211> 347
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> unsure
<222> (57)..(57)
<223> y=C/T
<220>
<221> unsure
<222> (168)..(168)
<223> m=A/C
<220>
<221> unsure
<222> (193)..(193)
<223> r=A/G
<400> 7
ctaggggacc cagaaaactt cacccccgca aaccccctag taaccccacc acacatyaaa 60
ccagaatgat acttcctatt cgcctacgcc atcctgcggt caatcccaaa caaactagga 120
ggcgtcctag cactagccgc ctccgtccta atcctattcc tggtcccmtt cctccacaaa 180
tcaaaacaac garcaataac attccggccg ctctcccaac tcctattctg aacactagtg 240
gccaacctcc tcgtcctaac atgagtggga agccaacctg tcgaacaccc attcatcatc 300
atcgggcaac tcgcatcaat tacttacttc accatcctcc tattcct 347
Claims (10)
1. application of the mitochondrial cytochrome b gene in Species estimation and/or the duck identification of duck.
2. marker, which is characterized in that have the nucleotide sequence as shown in SEQ ID NO:7.
3. Species estimation and/or duck of the nucleotide with the sequence as shown in SEQ ID NO:7 as marker in duck are identified
In application.
4. primer combines characterized by comprising primer-F3, primer-B3, primer-FIP, primer-BIP, primer-LF and draw
Object-LB；
Primer-the F3 has any one in nucleotide sequence as follows:
(I), there is nucleotide sequence shown in SEQ ID NO:1；
(II), have nucleotide sequence shown in SEQ ID NO:1 through modification, substitution, one or more alkali are deleted and/or added
The nucleotide sequence that base obtains；
(III), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:1；
(IV), the complementary series of the sequence as shown in (I), (II) or (III)；
Primer-the B3 has any one in nucleotide sequence as follows:
(V), there is nucleotide sequence shown in SEQ ID NO:2；
(VI), have nucleotide sequence shown in SEQ ID NO:2 through modification, substitution, one or more alkali are deleted and/or added
The nucleotide sequence that base obtains；
(VII), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:2；
(VIII), the complementary series of the sequence as shown in (V), (VI) or (VII)；
Primer-the FIP has any one in nucleotide sequence as follows:
(IX), there is nucleotide sequence shown in SEQ ID NO:3；
(X), have nucleotide sequence shown in SEQ ID NO:3 through modification, substitution, one or more alkali are deleted and/or added
The nucleotide sequence that base obtains；
(XI), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:3；
(XII), the complementary series of the sequence as shown in (IX), (X) or (XI)；
Primer-the BIP has any one in nucleotide sequence as follows:
(XIII), there is nucleotide sequence shown in SEQ ID NO:4；
(XIV), have nucleotide sequence shown in SEQ ID NO:4 one or more through modification, substitution, deletion and/or addition
The nucleotide sequence that base obtains；
(XV), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:4；
(XVI), the complementary series of the sequence as shown in (XIII), (XIV) or (XV)；
Primer-the LF has any one in nucleotide sequence as follows:
(XVII), there is nucleotide sequence shown in SEQ ID NO:5；
(XVIII), have nucleotide sequence shown in SEQ ID NO:5 through modification, substitution, deletion and/or addition one or more
The nucleotide sequence that a base obtains；
(XIX), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:5；
(XX), the complementary series of the sequence as shown in (XVII), (XVIII) or (XIX)；
Primer-the LB has any one in nucleotide sequence as follows:
(XXI), there is nucleotide sequence shown in SEQ ID NO:6；
(XXII), have nucleotide sequence shown in SEQ ID NO:6 one or more through modification, substitution, deletion and/or addition
The nucleotide sequence that base obtains；
(XXIII), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:6；
(XXIV), the complementary series of the sequence as shown in (XXI), (XXII) or (XXIII).
5. primer as claimed in claim 4 combination, which is characterized in that primer-F3 described in the primer combination, described draw
Object-B3, the primer-FIP, the primer-BIP, the primer-LF and the primer-LB molar ratio be 0.3:0.3:
2.4:2.4:1:1.
6. kit, which is characterized in that combined including primer as described in claim 4 or 5.
7. primer as described in claim 4 or 5 combination or kit as claimed in claim 6 duck Species estimation and/
Or the application in duck identification.
8. the method for the Species estimation of duck, which comprises the steps of:
(1) nucleic acid of sample to be tested is obtained；
(2) primer in primer combination as described in claim 4 or 5 is respectively adopted as template in the nucleic acid extracted using step (1)
Ring mediated isothermal amplification is carried out, amplification is obtained；
(3) obtain qualification result according to the amplification: if specific amplification may be implemented, sample to be tested is duck；Such as
Fruit can not achieve specific amplification, then sample to be tested is not duck.
9. the method for the identification of duck, which comprises the steps of:
(1) nucleic acid of sample to be tested is obtained；
(2) primer in primer combination as described in claim 4 or 5 is respectively adopted as template in the nucleic acid extracted using step (1)
Ring mediated isothermal amplification is carried out, amplification is obtained；
(3) obtain qualification result according to the amplification: if specific amplification may be implemented, sample to be tested is duck；
If can not achieve specific amplification, sample to be tested is not duck.
10. method as claimed in claim 8 or 9, which is characterized in that the reaction system of the ring mediated isothermal amplification are as follows:
Each 0.12 μ L of outer primer F3 and B3 of 0.3mM；Each 0.96 μ L of inner primer FIP and BIP of 2.4mM；Ring the primer LF and LB of 1mM is each
0.4μL；2 × reaction buffer, 10 μ L；The sample to be tested nucleic acid of 1 μ L adds water to 20 μ L systems；
The reaction temperature of the ring mediated isothermal amplification is 60 DEG C~65 DEG C, reaction time 50min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811634125.4A CN109517907A (en) | 2018-12-29 | 2018-12-29 | Primer combines the application in Species estimation and/or the duck identification of duck |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811634125.4A CN109517907A (en) | 2018-12-29 | 2018-12-29 | Primer combines the application in Species estimation and/or the duck identification of duck |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109517907A true CN109517907A (en) | 2019-03-26 |
Family
ID=65797189
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811634125.4A Pending CN109517907A (en) | 2018-12-29 | 2018-12-29 | Primer combines the application in Species estimation and/or the duck identification of duck |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109517907A (en) |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002064822A2 (en) * | 2001-02-05 | 2002-08-22 | Congen Biotechnologie Gmbh | Method and kit for animal species-specific dna identification of a sample |
| US20050014143A1 (en) * | 2001-06-13 | 2005-01-20 | Carole Donne-Gousse | Method for determining the existence of animal or vegetable mixtures in organic substrates |
| US20080085515A1 (en) * | 2000-03-24 | 2008-04-10 | Eppendorf Array Technologies Sa (Eat) | Identification of multiple biological (micro) organisms by detection of their nucleotide sequences on arrays |
| KR101448119B1 (en) * | 2012-04-05 | 2014-10-16 | 김남도 | Composition for discrimination of mixing meat containing specific primer set for CytB gene |
| CN104328195A (en) * | 2014-11-13 | 2015-02-04 | 西北民族大学 | Kit for detecting animal-derived components in feed and detection method of kit |
| CN104404145A (en) * | 2014-11-18 | 2015-03-11 | 广州绿洲生化科技股份有限公司 | Kit for quickly detecting meat adulteration based on LAMP method |
| CN107937562A (en) * | 2017-12-05 | 2018-04-20 | 厦门出入境检验检疫局检验检疫技术中心 | Detect the primer and its design method of the LAMP method of duck derived component |
| CN108396067A (en) * | 2017-02-06 | 2018-08-14 | 上海市农业科学院 | A kind of the LAMP primer group and detection method of duck derived component |
| CN108796089A (en) * | 2017-05-03 | 2018-11-13 | 杭州众测生物科技有限公司 | The kit and detection method of duck derived components in a kind of detection food |
-
2018
- 2018-12-29 CN CN201811634125.4A patent/CN109517907A/en active Pending
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080085515A1 (en) * | 2000-03-24 | 2008-04-10 | Eppendorf Array Technologies Sa (Eat) | Identification of multiple biological (micro) organisms by detection of their nucleotide sequences on arrays |
| WO2002064822A2 (en) * | 2001-02-05 | 2002-08-22 | Congen Biotechnologie Gmbh | Method and kit for animal species-specific dna identification of a sample |
| US20050014143A1 (en) * | 2001-06-13 | 2005-01-20 | Carole Donne-Gousse | Method for determining the existence of animal or vegetable mixtures in organic substrates |
| KR101448119B1 (en) * | 2012-04-05 | 2014-10-16 | 김남도 | Composition for discrimination of mixing meat containing specific primer set for CytB gene |
| CN104328195A (en) * | 2014-11-13 | 2015-02-04 | 西北民族大学 | Kit for detecting animal-derived components in feed and detection method of kit |
| CN104404145A (en) * | 2014-11-18 | 2015-03-11 | 广州绿洲生化科技股份有限公司 | Kit for quickly detecting meat adulteration based on LAMP method |
| CN108396067A (en) * | 2017-02-06 | 2018-08-14 | 上海市农业科学院 | A kind of the LAMP primer group and detection method of duck derived component |
| CN108796089A (en) * | 2017-05-03 | 2018-11-13 | 杭州众测生物科技有限公司 | The kit and detection method of duck derived components in a kind of detection food |
| CN107937562A (en) * | 2017-12-05 | 2018-04-20 | 厦门出入境检验检疫局检验检疫技术中心 | Detect the primer and its design method of the LAMP method of duck derived component |
Non-Patent Citations (4)
| Title |
|---|
| AE-RI CHO 等: "Meat Species Identification using Loop-mediated Isothermal Amplification Assay Targeting Species-specific Mitochondrial DNA", 《KOREAN J FOOD SCI ANIM RESOUR》 * |
| JOANA S.AMARA 等: "Identification of duck, partridge, pheasant, quail, chicken and turkey meats by species-specific PCR assays to assess the authenticity of traditional game meat Alheira sausages", 《FOOD CONTROL》 * |
| 宋涛平 等: "动物源性成分实时等温扩增检测方法的建立", 《食品安全质量检测学报》 * |
| 李向丽 等: "基于LAMP法快速检测羊肉及其制品中的猪、鸭和羊源性成分", 《中国食品卫生杂志》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104946788B (en) | A kind of PCR primer and kit for differentiating 8 kinds of animal derived materials | |
| CN106520977B (en) | The primer and method of ring mediated isothermal amplification method detection causing root rot disease of Medicago sativa bacterium | |
| CN106811541A (en) | Primer, probe and kit for field quick detection pasteurella multocida | |
| CN104946790B (en) | A kind of PCR method for 8 kinds of animal derived materials of identification of tracing to the source | |
| CN109504786A (en) | Primer combines the application in Species estimation and/or the meat of a sheep identification of sheep | |
| CN110004250A (en) | A kind of African swine fever virus LAMP visual detection kit | |
| CN110358866A (en) | Novel goose astrovirus SYBR Green dye method fluorescent quantificationally PCR detecting kit | |
| CN102864228A (en) | Loop-mediated isothermal amplification (LAMP) kit for rapidly detecting vibrio parahaemolyticus | |
| CN106282416B (en) | A kind of the multi-fluorescence immunoassay primer, kit and method of 5 kinds of fowl immunosupress cause of diseases of quick differentiation | |
| CN106048034B (en) | Animal-derived component forms in based on PCR-RLFP-DHPLC technology scanning analysis food | |
| CN105603123A (en) | Real-time fluorescence RPA reagent kit and test strip RPA reagent kit for rapidly detecting porcine parvovirus and application of reagent kits | |
| CN101514373B (en) | Method for quickly detecting duck viral enteritis by real-time fluorescence quantitative PCR and kit thereof | |
| CN102851362B (en) | Method for quickly identifying Brucella based on mass spectrum technology and application thereof | |
| CN110218806A (en) | The quick detection primer group of detection of Salmonella fimW gene novel visual LAMP and kit | |
| CN109457015A (en) | Primer combines the application in Species estimation and/or the beef identification of ox | |
| CN109504785A (en) | Primer combination and its application in Species estimation and/or the chicken identification of chicken | |
| CN109517907A (en) | Primer combines the application in Species estimation and/or the duck identification of duck | |
| CN104962650B (en) | A kind of synchronous PCR method and kit for differentiating animal derived materials | |
| CN108192954A (en) | A kind of RAD sequencings screening Chinese giant salamander, Andrias davidianus female specific fragment and genetic sex detection method | |
| CN109680101A (en) | A kind of rapid detection method for distinguishing the strong and weak poison of H7N9 subtype avian influenza virus | |
| CN109706250A (en) | Primer combination and its application in Species estimation and/or the pork identification of pig | |
| CN109234402A (en) | A kind of ox Taylor worm identifies the method and kit of detection | |
| CN109055613A (en) | I type astrovirus ring mediated isothermal amplification detection primer group of chicken, kit and its detection method | |
| CN105734143B (en) | A kind of Europe huso sturgeon real-time fluorescence PCR specific detection system and application | |
| CN106868185A (en) | A kind of specific primer group and its application for detecting rat derived component |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190326 |