CN107937562A - Detect the primer and its design method of the LAMP method of duck derived component - Google Patents
Detect the primer and its design method of the LAMP method of duck derived component Download PDFInfo
- Publication number
- CN107937562A CN107937562A CN201711263549.XA CN201711263549A CN107937562A CN 107937562 A CN107937562 A CN 107937562A CN 201711263549 A CN201711263549 A CN 201711263549A CN 107937562 A CN107937562 A CN 107937562A
- Authority
- CN
- China
- Prior art keywords
- duck
- primer
- derived component
- lamp
- design method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the primer and its design method of the LAMP method of detection duck derived component, as shown in sequence table, design method comprises the following steps primer sequence：Step 1, NCBI websites are logged in, search the Mitochondrial gene sequence of duck；Step 2, the Mitochondrial gene sequence of duck is compared with DNAman softwares, finds out the specific sequence of duck；Step 3, design of primers is carried out as auxiliary using software, the design principle of primer includes the distance between Tm values, the stability of prime end, G/C content, primer, secondary structure；Step 4, LAMP detection method, optimizational primer working concentration, inside and outside primer concentration ratio and reaction temperature are established.The present invention has the advantages that easy to operate, quick, high specificity, high sensitivity, most soon only need to be less than 10 minutes, so that it may detect duck derived component in real time, greatly accelerate the detection of duck derived component.The clearance speed of port cargoes imported and exported can be significantly facilitated, for preventing and controlling China's animal derived materials are adulterated to have important practical significance.
Description
Technical field
The present invention relates to the detection of duck derived component, is specifically related to a kind of LAMP primer for being used to detect duck derived component
And its design method.
Background technology
In recent years detect animal derived adulterated technology primarily directed to animal specificity nucleic acid or albumen, have western blot,
ELISA, nucleic acid probe, PCR and fluorescent PCR etc., the most widely used at present is PCR and fluorescent PCR.PCR method is due to it
It can be widely used with higher sensitivity in animal derived materials detection.But in practice, still
The problem of being difficult to overcome there are some, such as false negative, false positive, non-specific amplification and sheet traction, Coating tape
Deng.
Ring mediated isothermal amplification (Loop-mediated isothermal amplification, LAMP), is a kind of new
The nucleic acid amplification method of type, its main feature is that 4 species-specific primers are designed for 6 regions of target gene, in strand displacement archaeal dna polymerase
Under the action of (Bst DNA polymerase), 60~65 DEG C of constant-temperature amplifications, 15~60 min or so can be achieved 109~1010
Nucleic acid amplification again, has the characteristics that easy to operate, high specificity, product easily detect.When DNA is synthesized, from deoxyribose core
Magnesium ion reaction in the pyrophosphate ion and reaction solution that are separated out in sour triphosphoric acid substrate (dNTPs), produces a large amount of pyrophosphoric acids
Magnesium precipitate, is presented white.Therefore, can be using turbidity as the index reacted, the white opacity that only detects by an unaided eye precipitation, with regard to energy
Whether identification amplification, without cumbersome electrophoresis and ultraviolet visualization.Due to loop-mediated isothermal amplification be not required PCR instrument and
Expensive reagent, has a wide range of applications.
Genie II isothermal duplication fluorescence detecting systems are open detection platforms, using " isothermal amplification technique " principle,
With reference to detection technique of fluorescence, work is used for quickly detecting on the basis of molecular level available for all kinds of isothermal amplifications.
The common PCR of duck derived component detection and fluorescence quantifying PCR method, conventional PCR method need the PCR of 2h or so to react
The electrophoresis time and configuration gel of or so time, 30min and the time of dyeing；Fluorescence quantifying PCR method, probably needs 1h left
The right time, and fluorescence probe and instrument are all costly.
The content of the invention
In order to solve the quickly duck derived component of detection inlet and outlet and in the market, present invention offer is a kind of to be used to detect duck source
The LAMP primer and its design method of property component, which has the advantages that simple, sensitive, quick, special.
To achieve these goals, the present invention adopts the following technical scheme that：
A kind of LAMP primer for being used to detect duck derived component, primer sequence are as follows：
Duck F3：5′-GAGTAATCCTACTGCTCACTC-3′
Duck B3：5′-GCCTGATTCGTGTAGGAAG-3′
Duck FIP：5′-TTACGGTAGCTCCTCAGAACGATTATAGCAACTGCCTTCGTAG-3′
Duck BIP：5′-ACCCTGGTAGAATGAGCCTGATGAATGGCGAAGAATCGG-3′
Duck LoopF：5′- TCCTCATGGCAGGACATAAC-3′
Duck LoopB：5′-GGAGGATTCTCAGTGGATAACC-3′
The design method of the above-mentioned LAMP primer for being used to detect duck derived component, comprises the following steps：
Step 1, NCBI websites are logged in, search the Mitochondrial gene sequence of duck；
Step 2, the Mitochondrial gene sequence of duck is compared with DNAman softwares, finds out the specific sequence of duck；
Step 3, design of primers is carried out as auxiliary using software, the design principle of primer includes Tm values, prime end is stabilized
The distance between property, G/C content, primer, secondary structure；
Step 4, LAMP detection method, optimizational primer working concentration, inside and outside primer concentration ratio and reaction temperature are established.
In above-mentioned design method, in step 2, the Mitochondrial gene sequence with DNAman softwares to various animals
It is compared, selects detection gene of the CytB genes as duck derived component.
In above-mentioned design method, in step 3, the software is Primer Explorer V3；Each bar primer
Parameter is as follows：F1c/B1c, 64~66 DEG C；F2/B2/F3/B3 LoopF/LoopB, 59~61 DEG C；The primers F 1c and B1c
Than high 5 DEG C or so of the Tm values of remaining several primers.
In above-mentioned design method, in step 3, the stability of the prime end：5 ' the ends of primers F 1c/B1c
△ G values≤- 4Kcal/mol, primers F 2/B2/F3/B3 LoopF/LoopB 3 ' end △ G values≤- 4Kcal/mol, primer
End cannot contain complementary series, such as cccggg or gaattc；Identical nucleotide can not be contained, such as ccgggg or
aatttt。
In above-mentioned design method, in step 3, the setting range of the G/C content is between 40%~65%.
In above-mentioned design method, in step 3, the distance between described primer：Hold to B2 5 and ' hold from F2 5 '
Between 120~180bp, from the 5 ' of F2 ends to F1c 3 ' hold 40-60bp, from the 5 ' of F2 hold to F3 3 ' hold 0~
Between 20bp.
On secondary structure, primer itself cannot form secondary structure.
Detection time of the present invention, which is not added, accelerates primer LoopF and LoopB, and the reaction time needs 30min or so；Addition one
Accelerate primer LoopF or LoopB, the reaction time needs 20-25min；Addition two accelerates primer LoopF and LoopB, reaction time
Only need 15-20min.And experiment midway is observable result, judges result it is not necessary to configure the processes such as gel, electrophoresis, dyeing,
Greatly shorten detection time, and have the curve similar with quantitative fluorescent PCR, decision principle and standard, have it is quick, special,
Sensitivity, save the advantages that expense, is adapted to the needs that port is quickly detected, and is a kind of accurate, reliable, molecular biology of science
Method.This is for strengthening the quick inspection and quarantine of product duck derived component, adulterated product is made and sold in rectification, safeguards consumers' rights and interests, beats
Illegal all tools of seeking exorbitant profit etc. are hit to be of great significance.
Compared with prior art, beneficial effects of the present invention are as follows：
1. the technology of the present invention is most crucial to be primer difference, although primer is designed with by software, software is one kind
Supplementary means, and do not have decisive role, to obtain group-specific height, the primer of high sensitivity has contingency.Not
It can just screen to obtain by " limited number of time experiment ".The present invention just obtains the primer sequence by many experiments, and every is drawn
The difference of base or the difference of sequence on thing, the result is that it is widely different, from the perspective of permutation and combination, there can be number
Different Results in terms of ten thousand.And this some can not possibly depend merely on software to solve, for example change second base, its inspection result
Just there is larger difference.
2. the LAMP method for the detection duck derived component established using the present invention, has easy to operate, quick, specificity
By force, most soon only need to be less than 10 minutes, so that it may detect duck derived component in real time the advantages that high sensitivity.The success of the present invention is ground
System, greatly accelerates the detection of duck derived component.
3. it is using the present invention detection duck derived component LAMP technology, have the advantages that it is simple, sensitive, quick, special,
The clearance speed of port cargoes imported and exported can be significantly facilitated.This is for preventing and controlling China's animal derived materials are adulterated to have weight
The realistic meaning wanted.The primer of the present invention is applied on Genie II operating platforms.
Brief description of the drawings
Fig. 1 is that the interior outer primer working concentration of LAMP technology detection duck derived component compares optimum results.In Fig. 1,1：
The concentration ratio 1 of FIP/BIP and F3/B3:1；2：The concentration ratio 2 of FIP/BIP and F3/B3:1；3：The concentration of FIP/BIP and F3/B3
Than 3:1；4：The concentration ratio 4 of FIP/BIP and F3/B3:1；5：The concentration ratio 5 of FIP/BIP and F3/B3:1；6：FIP/BIP and F3/
The concentration ratio 6 of B3:1；7：The concentration ratio 7 of FIP/BIP and F3/B3:1；8：Blank control.
Fig. 2 is the primer working concentration optimum results that LAMP technology detects duck derived component.In fig. 2,1：FIP、BIP、
The working concentration of F3 and B3 is respectively 0.4,0.4,0.1 and 0.1 μM；2：The working concentration of FIP, BIP, F3 and B3 is respectively 0.8,
0.8th, 0.2 and 0.2 μM；3：The working concentration of FIP, BIP, F3 and B3 are respectively 1.6,1.6,0.4 and 0.4 μM； 4：FIP、BIP、
The working concentration of F3 and B3 is respectively 3.2,3.2,0.8 and 0.8 μM；5：The working concentration of FIP, BIP, F3 and B3 is respectively 6.4,
6.4th, 1.6 and 1.6 μM；6：The working concentration of FIP, BIP, F3 and B3 are respectively 12.8,12.8,3.2 and 3.2 μM；7、8：Blank
Control.
Fig. 3 is the acceleration result for LoopF, LoopB acceleration primer that LAMP technology detects duck derived component.In figure 3,1,
2：Without LoopF, LoopB； 3、4：0.4 μM of LoopF working concentrations； 5、6：0.4 μM of LoopB working concentrations；7、8： LoopF
Working concentration with LoopB is 0.4 μM；2、4、6、8：Blank control.
Fig. 4 is the amplification temperature optimization result that LAMP technology detects duck derived component.In Fig. 4,1：Expand 61 DEG C of temperature；
2：To expand 62 DEG C of temperature；3:Expand 63 DEG C of temperature；4:Expand 64 DEG C of temperature；5:Expand 65 DEG C of temperature；6:Expand temperature
66℃；7:Expand 67 DEG C of temperature；8:Expand 68 DEG C of temperature.
Fig. 5 is the solubility curve result that LAMP technology detects duck derived component.In Figure 5,1,2：Chicken derived component detects
LAMP method；3rd, the LAMP method of 4 duck derived components detection；
Fig. 6 is the sensitivity test result that LAMP technology detects duck derived component.In figure 6, duck derived component nucleic acid concentration point
Wei 1：3.32 µg/mL；2：3.32×10-1µg/mL；3：3.32×10-2µg/mL；4：3.32×10-3µg/mL；5：
3.32×10-4µg/mL；6：3.32×10-5µg/mL.A, B is respectively the LAMP method and PCR method of duck derived component detection
(Santosh Haunshi,Rantu Basumatary,P.S. Girish P.S. Girish,etc. Identification
of chicken,duck,pigeon and pig meat by species-specific markers of
mitochondrial origin[J]. Meat Science, 2009,83 :454–459.)。
Fig. 7 is the specific test result that LAMP technology detects duck derived component.In the figure 7,1：Chicken nucleic acid；2：Duck core
Acid；3：Pig nucleic acid；4：Sheep nucleic acid；5：Mouse nucleic acid；6：Fox nucleic acid；7：TaKaRa horse nucleic acid；8：Tilapia mossambica nucleic acid.9：Squid core
Acid；10：Dove nucleic acid；11：Dog nucleic acid；12：Goat nucleic acid；13：Ox nucleic acid；14：TaKaRa rabbit nucleic acid；15：Blank control.
Embodiment
The present invention is described in further detail with reference to the accompanying drawings and detailed description, but attached drawing and specific implementation
Mode should not be understood as the restriction carried out to the present invention.
The materials, reagents and the like used in the following examples, is commercially available unless otherwise specified.
Tissue DNA extracts kit：LabServ companies, product identification KFR-802096.
Isothermal duplication fluorescence detecting system：OptiGene companies, Genie II systems.
2×TaqPCR MasterMix：Tiangeng biochemical technology Co., Ltd product.
DL2,000 DNA Marker：TaKaRa Products.
IMM reagents：Beijing Sheng Taibo Science and Technology Ltd.s.
LAMP test reaction conditions are the anti-of Genie II isothermal duplications fluorescence detecting system acquiescence unless otherwise specified
Answer condition：65 DEG C of amplification, 30min；Annealing is from 98 DEG C to 80 DEG C, 0.05 DEG C/s.
LAMP primer sequence for detecting duck derived component is as follows：（Such as sequence table）
Duck F3：5′-GAGTAATCCTACTGCTCACTC-3′
Duck B3：5′-GCCTGATTCGTGTAGGAAG-3′
Duck FIP：5′-TTACGGTAGCTCCTCAGAACGATTATAGCAACTGCCTTCGTAG-3′
Duck BIP：5′-ACCCTGGTAGAATGAGCCTGATGAATGGCGAAGAATCGG-3′
Duck LoopF：5′- TCCTCATGGCAGGACATAAC-3′
Duck LoopB：5′-GGAGGATTCTCAGTGGATAACC-3′.
Duck F3, duck B3, duck LoopF and duck LoopB concentration are 10 μM.
Duck FIP and duck BIP concentration are 20 μM.
Duck nucleic acid concentration：8.3×102 µg/mL。
Ox nucleic acid, pig nucleic acid, goat nucleic acid, sheep nucleic acid, mouse nucleic acid, fox nucleic acid, dog nucleic acid, duck nucleic acid, chicken nucleic acid, rabbit
Nucleic acid, dove nucleic acid, Tilapia mossambica nucleic acid, squid nucleic acid are the nucleic acid of respective animal tissue's extraction.
TaKaRa horses nucleic acid, TaKaRa rabbit nucleic acid：TaKaRa Products.
Amplified fragments sequence is as follows：Duck LAMP primer extension increasing sequence (GenBank:EU585609.1)：Such as sequence table institute
Show.
GAGTAATCCTACTGCTCACTCTTATAGCAACTGCCTTCGTAGGTTATGTCCTGCCATGAGGACAAATAT
CGTTCTGAGGAGCTACCGTAATTACCAACTTATTTTCAGCCCTCCCATACATCGGACAGACCCTGGTAGAATGAGCC
TGAGGAGGATTCTCAGTGGATAACCCAACCCTAACCCGATTCTTCGCCATTCACTTCCTACTACCCTTTTTAATCGC
AGGAATCACCCTAGTCCACTTAACCTTCCTACACGAATCAGGCTC
Embodiment 1 be used for detect duck derived component LAMP method inside and outside primer concentration than optimization
（1）Take in 8 reaction tubes, per 25 μ L of tube reaction system.Each pipe is separately added into 15 μ L of IMM, F3 1 μ L, B3 1 μ L, 1 μ L
Duck nucleic acid, 0.5 μ L of FIP, BIP 0.5 μ L are added in the 1st reaction tube；1 μ L of FIP, BIP 1 μ L are added in 2nd reaction tube；
1.5 μ L of FIP, BIP 1.5 μ L are added in 3rd reaction tube；2 μ L of FIP, BIP 2 μ L are added in 4th reaction tube；5th anti-
Ying Guanzhong adds 2.5 μ L of FIP, BIP 2.5 μ L；3 μ L of FIP, BIP 3 μ L are added in 6th reaction tube；In 7th reaction tube
Add 3.5 μ L of FIP, BIP 3.5 μ L；8th reaction tube is blank control.Each pipe is mended and is filled with water to 25 μ L.
（2）65 DEG C of amplification, 30min；Annealing is from 98 DEG C to 80 DEG C, 0.05 DEG C/s.
（3）For result of the test as shown in Figure 1, S type amplification curves can occur, the analysis of amplification curve combination CT values is optimal anti-
Should be the 4th, optimal interior outer primer（FIP, BIP are inner primer, and F3, B3 are outer primer）Working concentration ratio is 4:1 or, follow-up
4 are used in reaction:1 ratio.
Embodiment 2 is used for the optimization for detecting the LAMP method primer working concentration of duck derived component
（1）Take in 8 reaction tubes, per 25 μ L of tube reaction system.Each pipe is separately added into 15 μ L of IMM, 1 μ L duck nucleic acid, and the 1st anti-
Ying Guanzhong adds 0.5 μ L of FIP, BIP 0.5 μ L, F3 0.25 μ L, B3 0.25 μ L；Added in 2nd reaction tube FIP 1 μ L,
BIP 1µL、F3 0.5µL、B3 0.5µL；1.5 μ L of FIP, BIP 1.5 μ L, F3 0.75 μ L, B3 are added in 3rd reaction tube
0.75µL；2 μ L of FIP, BIP 2 μ L, F3 1 μ L, B3 1 μ L are added in 4th reaction tube；FIP is added in 5th reaction tube
2.5µL、BIP 2.5µL、F3 1.25µL、B3 1.25µL；3 μ L of FIP, BIP 3 μ L, F3 1.5 μ are added in 6th reaction tube
L、B3 1.5；7th, 8 reaction tube is blank control.Reaction system is supplied less than 25 μ L's with water.
（2）65 DEG C of amplification, 30min；Annealing is from 98 DEG C to 80 DEG C, 0.05 DEG C/s.
（3）Result of the test is as shown in Fig. 2, S type amplification curves can occur, amplification curve combination CT values, duck derived component
The pipes of LAMP the 2nd, 3 are preferable, and according to many experiments experience for many years, the optimum response for detecting the LAMP method of duck derived component is
3rd pipe.The working concentration of FIP, BIP, F3, B3 are respectively 1.2,1.2,0.3 and 0.3 μM.
Embodiment 3 is used for the acceleration result for detecting LoopF, LoopB of the LAMP method of duck derived component
（1）Respectively take in 8 reaction tubes, per 25 μ L of tube reaction system.1st, 2 pipes are separately added into 15 μ L of IMM, FIP 1.5 μ L, BIP
1.5µL、F3 0.75µL、B3 0.75µL；3rd, 4 pipes are separately added into 15 μ L of IMM, FIP 1.5 μ L, BIP 1.5 μ L, F3 0.75
µL、B3 0.75µL、LoopF 1µL；5th, 15 μ L of IMM, FIP 1.5 μ L, BIP 1.5 μ L, F3 0.75 μ are separately added into 6 pipes
L、B3 0.75µL、LoopB 1µL；7th, 15 μ L of IMM, FIP 1.5 μ L, BIP 1.5 μ L, F3 0.75 μ are separately added into 8 pipes
L、B3 0.75µL、LoopB 1µL 、LoopF 1µL；1st, 3,5,7 pipes be separately added into 1 μ L duck nucleic acid.Reaction system is less than 25 μ
L's is supplied with water.
（2）65 DEG C of amplification, 30min；Annealing is from 98 DEG C to 80 DEG C, 0.05 DEG C/s.
（3）Result of the test is as shown in figure 3, S type amplification curves can occur.After LoopF, LoopB is added, greatly speed up
LAMP reaction speeds.This experiment proves to accelerate the acceleration of decoding for DTMF LoopF and LoopB to be better than the single primer LoopF of acceleration
Or LoopB；Two accelerate list primer LoopF similar with the acceleration of LoopB；Reaction time needed for reaction without acceleration primer
At most.Accelerate the acceleration of primer to be only limitted to accelerate reaction speed, shorten the reaction time, the general of false positive can't be increased
Rate.
Embodiment 4 is used for the amplification temperature optimization result for detecting the LAMP method of duck derived component
（1）Take in 8 reaction tubes, per 25 μ L of tube reaction system.Each pipe be separately added into 15 μ L of IMM, 1 μ L ducks nucleic acid,
1.5 μ L of FIP, BIP 1.5 μ L, F3 0.75 μ L, B3 0.75 μ L, benefit are filled with water to 25 μ L.
（2）1st to the 8th pipe amplification temperature is respectively 61,62,63,64,65,66,67 and 68 DEG C, time 30min；Annealing
From 98 DEG C to 80 DEG C, 0.05 DEG C/s.
（3）Result of the test is as shown in Figure 4.Amplification curve combination CT value integrated judgments, are detected for duck derived component LAMP
Method, optimal reaction temperature scope are 62~65 DEG C.The common reaction temperatures of LAMP are 65 DEG C, therefore detect duck derived component
LAMP method selects 65 DEG C to expand temperature.
5 LAMP technology of embodiment detection chicken, the solubility curve analysis of duck derived component
（1）Take in 2 reaction tubes, per 25 μ L of tube reaction system.Be separately added into 15 μ L of IMM, 1 μ L ducks nucleic acid, 1.5 μ L of FIP,
1.5 μ L of BIP, F3 0.75 μ L, B3 0.75 μ L, benefit are filled with water to 25 μ L
（2）It is 65 DEG C to expand temperature, time 30min；Annealing is from 98 DEG C to 80 DEG C, 0.05 DEG C/s.
（3）Result of the test is as shown in Figure 5.Solubility curve in LAMP method is the annealing derivative in report（Anneal
Derivative）.The peak value for detecting the solubility curve of duck derived component LAMP method is 85.2 DEG C of (detection chicken derived component LAMP
The peak value of the solubility curve of method is 87.1 DEG C), only peak, and repeatability is good, has further proved duck LAMP side
The confidence level of method.
6 LAMP technology of embodiment detection chicken, the sensitivity test of duck derived component
（1）Take in 8 reaction tubes, per 25 μ L of tube reaction system.Each pipe is separately added into 15 μ L of IMM, FIP 1.5 μ L, BIP 1.5 μ
L, 0.75 μ L of F3, B3 0.75 μ L, the 1st to the 6th pipe are sequentially added into the 10 of 1 μ L-1、10-2、10-3、10-4、10-5、10-6Times
Diluted duck nucleic acid, the 7th, 8 pipes as blank control, each pipe is mended and is filled with water to 25 μ L.
（2）65 DEG C of amplification, 30min；Annealing is from 98 DEG C to 80 DEG C, 0.05 DEG C/s.
（3）Result of the test is as shown in Fig. 6 A, Fig. 6 B.There is amplification curve in 1st to the 4th tube reaction.LAMP method is examined
It is respectively 3.32 × 10 to survey the minimum limitation of duck derived component-3 mg/mL.10 times sensitiveer than PCR method.
7 LAMP technology of embodiment detects the specific test of duck derived component
（1）Take in 15 reaction tubes, per 25 μ L of tube reaction system.Each pipe is separately added into 15 μ L of IMM, FIP 1.5 μ L, BIP 1.5
μ L, F3 0.75 μ L, B3 0.75 μ L, the 1st to 15 pipe are separately added into the chicken nucleic acid of 1 μ L, duck nucleic acid, pig nucleic acid, sheep nucleic acid, mouse
Nucleic acid, fox nucleic acid, TaKaRa horses nucleic acid, Tilapia mossambica nucleic acid, squid nucleic acid, dove nucleic acid, dog nucleic acid, goat nucleic acid, ox nucleic acid,
TaKaRa rabbits nucleic acid, water.Each pipe is mended and is filled with water to 25 μ L.
（2）65 DEG C of amplification, 30min；Annealing is from 98 DEG C to 80 DEG C, 0.05 DEG C/s.
（3）Result of the test as shown in fig. 7, there are S type amplification curves in only corresponding duck nucleic acid, remaining animal component
Nucleic acid is without amplification curve.Show that this experiment has specificity.
Claims (7)
1. a kind of LAMP primer for being used to detect duck derived component, it is characterised in that primer sequence is as follows：
Duck F3：5′-GAGTAATCCTACTGCTCACTC-3′
Duck B3：5′-GCCTGATTCGTGTAGGAAG-3′
Duck FIP：5′-TTACGGTAGCTCCTCAGAACGATTATAGCAACTGCCTTCGTAG-3′
Duck BIP：5′-ACCCTGGTAGAATGAGCCTGATGAATGGCGAAGAATCGG-3′
Duck LoopF：5′- TCCTCATGGCAGGACATAAC-3′
Duck LoopB：5′-GGAGGATTCTCAGTGGATAACC-3′.
2. it is used for the design method for detecting the LAMP primer of duck derived component described in claim 1, it is characterised in that including following
Step：
Step 1, NCBI websites are logged in, search the Mitochondrial gene sequence of duck；
Step 2, the Mitochondrial gene sequence of duck is compared with DNAman softwares, finds out the specific sequence of duck；
Step 3, design of primers is carried out as auxiliary using software, the design principle of primer includes Tm values, prime end is stabilized
The distance between property, G/C content, primer, secondary structure；
Step 4, LAMP detection method, optimizational primer working concentration, inside and outside primer concentration ratio and reaction temperature are established.
3. design method as claimed in claim 2, it is characterised in that described to use DNAman softwares to various animals in step 2
Mitochondrial gene sequence be compared, select detection gene of the CytB genes as duck derived component.
4. design method as claimed in claim 2, it is characterised in that in step 3, the software is Primer
Explorer V3；The parameter of each bar primer is as follows：F1c/B1c, 64~66 DEG C；F2/B2/F3/B3 LoopF/LoopB, 59~
61℃；Tm values high 5 DEG C or so of the primers F 1c and B1c than remaining several primers.
5. design method as claimed in claim 2, it is characterised in that in step 3,5 ' the △ G at end of primers F 1c/B1c
The △ G values≤- 4Kcal/mol at the 3 ' ends of value≤- 4Kcal/mol, primers F 2/B2/F3/B3 LoopF/LoopB, prime end
Complementary series cannot be contained, identical nucleotide can not be contained.
6. design method as claimed in claim 2, it is characterised in that in step 3, the setting range of the G/C content exists
Between 40%~65%.
7. design method as claimed in claim 2, it is characterised in that in step 3, the distance between described primer：From F2
5 ' end is held between 120~180bp to B2 5 ', from the 5 ' of F2 ends to F1c 3 ' are held 40-60bp, from the 5 ' of F2 hold to
' hold between 0~20bp the 3 of F3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711263549.XA CN107937562A (en) | 2017-12-05 | 2017-12-05 | Detect the primer and its design method of the LAMP method of duck derived component |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711263549.XA CN107937562A (en) | 2017-12-05 | 2017-12-05 | Detect the primer and its design method of the LAMP method of duck derived component |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107937562A true CN107937562A (en) | 2018-04-20 |
Family
ID=61944726
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711263549.XA Pending CN107937562A (en) | 2017-12-05 | 2017-12-05 | Detect the primer and its design method of the LAMP method of duck derived component |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107937562A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109517907A (en) * | 2018-12-29 | 2019-03-26 | 博奥生物集团有限公司 | Primer combines the application in Species estimation and/or the duck identification of duck |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104404145A (en) * | 2014-11-18 | 2015-03-11 | 广州绿洲生化科技股份有限公司 | Kit for quickly detecting meat adulteration based on LAMP method |
| CN105296643A (en) * | 2015-11-20 | 2016-02-03 | 浙江省疾病预防控制中心 | Isothermal amplification detection kit and detection method for duck meat derived component nucleic acid |
| CN106544413A (en) * | 2016-10-09 | 2017-03-29 | 杭州天迈生物科技有限公司 | A kind of constant-temperature amplification primer sets and its test kit that can detect Carnis Sus domestica and duck meat derived component simultaneously |
-
2017
- 2017-12-05 CN CN201711263549.XA patent/CN107937562A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104404145A (en) * | 2014-11-18 | 2015-03-11 | 广州绿洲生化科技股份有限公司 | Kit for quickly detecting meat adulteration based on LAMP method |
| CN105296643A (en) * | 2015-11-20 | 2016-02-03 | 浙江省疾病预防控制中心 | Isothermal amplification detection kit and detection method for duck meat derived component nucleic acid |
| CN106544413A (en) * | 2016-10-09 | 2017-03-29 | 杭州天迈生物科技有限公司 | A kind of constant-temperature amplification primer sets and its test kit that can detect Carnis Sus domestica and duck meat derived component simultaneously |
Non-Patent Citations (3)
| Title |
|---|
| YA SHI等: "Loop-mediated isothermal amplification assays for the rapid identification of duck-derived ingredients in adulterated meat", 《FOOD ANAL.METHODS》 * |
| 李向丽等: "基于LAMP法快速检测羊肉及其制品中的猪、鸭和羊源性成分", 《中国食品卫生杂志》 * |
| 谭贵良等: "《现代分子生物学及组学技术在食品安全检测中的应用》", 30 June 2014, 中山大学出版社 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109517907A (en) * | 2018-12-29 | 2019-03-26 | 博奥生物集团有限公司 | Primer combines the application in Species estimation and/or the duck identification of duck |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200239947A1 (en) | Compositions and methods for quantifying a nucleic acid sequence in a sample | |
| CN106434883B (en) | Method, primer and kit for rapidly detecting vibrio vulnificus at constant temperature and application of primer and kit | |
| CN105087825B (en) | Room temperature isothermal quickly detects method, reagent and the primer and probe of Ebola virus | |
| CN107828864A (en) | Detect the primer and its design method of the LAMP method of chicken derived component | |
| US20150191778A1 (en) | Compositions and methods for detecting and identifying salmonella enterica strains | |
| CN102382879B (en) | Pseudomonas fluorescens LAMP (loop-mediated isothermal amplification) detection agent and kit | |
| CA2810856C (en) | Compositions and methods for quantifying a nucleic acid sequence in a sample | |
| CN111763768A (en) | COVID-19 rapid detection color development indication kit | |
| CN107937562A (en) | Detect the primer and its design method of the LAMP method of duck derived component | |
| CN110042176A (en) | A kind of primer sets, kit and its detection method and application detecting 4 type of aviadenovirus serum | |
| US10920285B2 (en) | Highly specific and sensitive methods for detecting enterohemorrhagic Escherichia coli serotypes O157:H7 and/or O145:H28 | |
| CN111378727A (en) | Triple fluorescent quantitative PCR kit for detecting staphylococcus aureus enterotoxin sea, seb and sec genes | |
| CN106367493A (en) | Method for rapidly detecting salmonella at constant temperature, primer and applications of primer | |
| CN106520937A (en) | Shellfish vibrio parahemolyticus LAMP detection kit and application thereof | |
| CN101871016A (en) | Duck enteritis virus detection kit and method based on loop-mediated isothermal amplification technology | |
| CN106434900A (en) | Method for conducting rapid constant-temperature detection on vibrio vulnificus and vibrio cholerae simultaneously, primer and kit | |
| CN111676305A (en) | Specific LAMP primer, kit and method for detecting escherichia coli | |
| CN106434887A (en) | Method, primers and kit for rapid constant-temperature detection of staphylococcus aureus | |
| CN101871015B (en) | Goose parvovirus detection kit and method based on loop-mediated isothermal amplification technology | |
| CN111378769A (en) | Kit for detecting chlamydia pneumoniae | |
| CN106011304A (en) | LAMP primer used for detecting sheep derived material and design method thereof | |
| CN111187814B (en) | Buffer solution for nucleic acid amplification colorimetric reaction and application thereof | |
| CN107419031A (en) | Primer sets, kit and method based on intelligent constant-temperature amplification technique detection salmonella | |
| CN106048062A (en) | LAMP primer used for detecting bovine-derived material, and designing method thereof | |
| CN106282315A (en) | The LAMP detection primer combination of a kind of Trichothecenes toxin and LAMP detection kit and LAMP method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180420 |