CN109504786A - Primer combines the application in Species estimation and/or the meat of a sheep identification of sheep - Google Patents
Primer combines the application in Species estimation and/or the meat of a sheep identification of sheep Download PDFInfo
- Publication number
- CN109504786A CN109504786A CN201811631731.0A CN201811631731A CN109504786A CN 109504786 A CN109504786 A CN 109504786A CN 201811631731 A CN201811631731 A CN 201811631731A CN 109504786 A CN109504786 A CN 109504786A
- Authority
- CN
- China
- Prior art keywords
- primer
- nucleotide sequence
- sheep
- seq
- meat
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
The present invention relates to field of biotechnology, in particular to application of the primer combination in Species estimation and/or the meat of a sheep identification of sheep.Primer high sensitivity that the present invention screens, high specificity, the detection method of foundation have the advantages that accuracy rate is high, detection time is short, result can be observed in real time, and can only pass through the difference of short sequence, the differentiation of completion sheep and goat.1h is only needed from sample treatment to report result, it is easy to operate, there is higher specificity than other PCR methods.Meanwhile head+secondary design of the present invention, the LAMP primer of meat of a sheep in test sample is screened, and establish the LAMP detection method of meat of a sheep, fill up the blank both at home and abroad in this detection field.
Description
Technical field
The present invention relates to field of biotechnology, in particular to primer combination is reflected in the Species estimation and/or meat of a sheep of sheep
Application in fixed.
Background technique
Mutton is the main source of our mankind's good proteins and various nutrients, and wherein meat of a sheep is because of its delicious mouth
Sense and temperature compensation act on and like by the majority of consumers.Because of the continuous improvement of internal people's standard of living, to the demand of mutton
Become larger, so that some illegal retailers use duck, rat meat, fox meat etc. to serve as mutton and sell, make to the majority of consumers as adulterated
At many unnecessary losses.In addition to this, it also occurs and serves as the case where meat of a sheep is sold using chevon, chevon contains
There is a kind of special fatty acid, special smell of mutton can be generated, be inferior to meat of a sheep in mouthfeel.Therefore, special, quick, precise Identification
Nucleic acid DNA in sample with the presence or absence of meat of a sheep is of great significance.,
For society now, traditional meat form discrimination method by sense organ and experience is no longer satisfied city
Field carries out the needs of control supervision to meat products adulteration.At present to the identification method of meat products mainly in protein and core
Sour water is flat to carry out.In protein level, the common technologies such as ELISA and high performance liquid chromatography are detected, and are limited in that pair
Instrument, reagent and sample treatment require height, and specificity and accuracy are poor when detection processed sample, time-consuming and laborious.Come relatively
It says, the mode for detecting nucleic acid is more convenient accurate.In nucleic acid level, common nucleic acid level detection technique has PCR and real-time fluorescence
PCR.Round pcr is the method for most common detection meat derived component because its sensitivity with higher, specificity and
Operability.But general PCR reacts at least 1.5h, and late detection is needed using gene sequencing and gel electrophoresis, and gel
EB in electrophoresis has strong carcinogenicity, has some potential safety problems.And real-time fluorescence PCR needs expensive instrument and reagent,
And reaction time at least 1.5h, and have higher requirements to operator, it is difficult to it is promoted in base.
Currently, the domestic LAMP primer group and detection method for having no effective detection meat of a sheep at this stage, there are no effective districts
Divide the LAMP primer composition of sheep and goat.Therefore it provides the LAMP primer group and detection method of meat of a sheep can be detected effectively
It has important practical significance.
Summary of the invention
In view of this, the present invention provides a kind of primer combination answering in Species estimation and/or the meat of a sheep identification of sheep
With.The present invention, which provides one kind, can distinguish short sequence difference in gene, and the LAMP that precise Identification goes out meat of a sheep from a variety of meat draws
Object combination and application.
In order to achieve the above-mentioned object of the invention, the present invention the following technical schemes are provided:
The present invention provides application of the mitochondrial cytochrome b gene in Species estimation and/or the meat of a sheep identification of sheep.
In addition, there is the nucleotide sequence as shown in SEQ ID NO:7 the present invention also provides a kind of marker.
On this basis, the present invention also provides the nucleotide with the sequence as shown in SEQ ID NO:7 as marker
Application in Species estimation and/or the meat of a sheep identification of sheep.
On the basis of the studies above, the present invention also provides primer combinations, comprising: primer-F3, primer-B3, primer-
FIP, primer-BIP, primer-LF and primer-LB；
Primer-the F3 has any one in nucleotide sequence as follows:
(I), there is nucleotide sequence shown in SEQ ID NO:1；
(II), have nucleotide sequence shown in SEQ ID NO:1 through modification, substitution, deletion and/or addition one or more
The nucleotide sequence that a base obtains；
(III), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:1；
(IV), the complementary series of the sequence as shown in (I), (II) or (III)；
Primer-the B3 has any one in nucleotide sequence as follows:
(V), there is nucleotide sequence shown in SEQ ID NO:2；
(VI), have nucleotide sequence shown in SEQ ID NO:2 through modification, substitution, deletion and/or addition one or more
The nucleotide sequence that a base obtains；
(VII), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:2；
(VIII), the complementary series of the sequence as shown in (V), (VI) or (VII)；
Primer-the FIP has any one in nucleotide sequence as follows:
(IX), there is nucleotide sequence shown in SEQ ID NO:3；
(X), have nucleotide sequence shown in SEQ ID NO:3 through modification, substitution, deletion and/or addition one or more
The nucleotide sequence that a base obtains；
(XI), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:3；
(XII), the complementary series of the sequence as shown in (IX), (X) or (XI)；
Primer-the BIP has any one in nucleotide sequence as follows:
(XIII), there is nucleotide sequence shown in SEQ ID NO:4；
(XIV), have SEQ ID NO:4 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or
The nucleotide sequence that multiple bases obtain；
(XV), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:4；
(XVI), the complementary series of the sequence as shown in (XIII), (XIV) or (XV)；
Primer-the LF has any one in nucleotide sequence as follows:
(XVII), there is nucleotide sequence shown in SEQ ID NO:5；
(XVIII), have nucleotide sequence shown in SEQ ID NO:5 through modification, substitution, deletion and/or addition one
Or the nucleotide sequence that multiple bases obtain；
(XIX), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:5；
(XX), the complementary series of the sequence as shown in (XVII), (XVIII) or (XIX)；
Primer-the LB has any one in nucleotide sequence as follows:
(XXI), there is nucleotide sequence shown in SEQ ID NO:6；
(XXII), have SEQ ID NO:6 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or
The nucleotide sequence that multiple bases obtain；
(XXIII), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:6；
(XXIV), the complementary series of the sequence as shown in (XXI), (XXII) or (XXIII).
In some specific embodiments of the invention, primer-F3, the primer-B3, institute described in the primer combination
The molar ratio for stating primer-FIP, the primer-BIP, the primer-LF and the primer-LB is 0.3:0.3:2.4:2.4:1:
1。
The present invention also provides a kind of kits, combine including the primer.
The present invention also provides the primer combination or the kit sheep Species estimation and/or meat of a sheep
Application in identification.
On the basis of the studies above, the present invention also provides the methods of the Species estimation of sheep, include the following steps:
(1) nucleic acid of sample to be tested is obtained；
(2) nucleic acid extracted using step (1) is respectively adopted in primer combination as described in claim 4 or 5 as template
Primer carries out ring mediated isothermal amplification, obtains amplification；
(3) obtain qualification result according to the amplification: if specific amplification may be implemented, sample to be tested is silk floss
Sheep；If can not achieve specific amplification, sample to be tested is not sheep.
In addition, including the following steps: the present invention also provides the method for the identification of meat of a sheep
(1) nucleic acid of sample to be tested is obtained；
(2) nucleic acid extracted using step (1) is respectively adopted in primer combination as described in claim 4 or 5 as template
Primer carries out ring mediated isothermal amplification, obtains amplification；
(3) obtain qualification result according to the amplification: if specific amplification may be implemented, sample to be tested is silk floss
Mutton；If can not achieve specific amplification, sample to be tested is not meat of a sheep.
In some specific embodiments of the invention, the reaction system of the ring mediated isothermal amplification are as follows: 0.3mM's is outer
Primers F 3 and each 0.12 μ L of B3；Each 0.96 μ L of inner primer FIP and BIP of 2.4mM；Each 0.4 μ L of ring primer LF and LB of 1mM；2×
10 μ L of reaction buffer；The sample to be tested nucleic acid of 1 μ L adds water to 20 μ L systems.
In some specific embodiments of the invention, the reaction temperature of the ring mediated isothermal amplification is 60 DEG C~65
DEG C, reaction time 50min.
The present invention provides a kind of from a variety of meat detects the LAMP primer and detection method of meat of a sheep, can be by similar
Small short sequence difference is completed accurately to distinguish detection between species.The fluorescence method LAMP that the present invention uses is detected, can be with
Observation in real time is as a result, avoid the risk polluted, and can detect the core of 20pg in total reaction time 50min
Acid.Blank for the country in this field supplements effective detection primer and method.
Primer high sensitivity that the present invention screens, high specificity, when the detection method of foundation has high accuracy rate, detection
Between short, result the advantages of can observing in real time, and can only pass through the difference of short sequence, the differentiation of completion sheep and goat.From
Sample treatment only needs 1h to report result, easy to operate, has higher specificity than other PCR methods.Meanwhile the present invention is first
Secondary design, the LAMP primer for screening meat of a sheep in test sample, and the LAMP detection method of meat of a sheep is established, fill up state
The inside and outside blank in this detection field.
Detailed description of the invention
In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below
There is attached drawing needed in technical description to be briefly described.
Fig. 1 show the meat of a sheep nucleic acid DNA of 20ng/ μ L using primer of the invention carry out the real-time fluorescence value of LAMP reaction with
Reaction time figure；
Fig. 2 shows the positive plasmid containing sheep CytB gene, meat of a sheep nucleic acid DNA, chicken nucleic acid DNA, Huang of 20ng/ μ L
Beef nucleic acid DNA, duck nucleic acid DNA, pork nucleic acid DNA using primer of the invention carry out the real-time fluorescence value of LAMP reaction with
Reaction time figure, investigates the specificity of primer, as a result the positive plasmid and meat of a sheep nucleic acid DNA only containing sheep CytB gene
There is positive amplification；
Fig. 3 (A)~Fig. 3 (D) shows the positive control sample Plasmid DNA of 20ng/ μ l with 10-1、10-2、10-3、10-4Dilution
After degree carries out gradient dilution, the real-time fluorescence value of LAMP reaction is carried out using primer of the invention and the reaction time schemes；
Fig. 4 show the meat of a sheep nucleic acid DNA of 20pg/ μ L using primer of the invention carry out the real-time fluorescence value of LAMP reaction with
Reaction time figure, result are that the repeatability (20/20) under sensitivity investigates result.
Specific embodiment
The invention discloses a kind of application of primer combination in Species estimation and/or the meat of a sheep identification of sheep, abilities
Field technique personnel can use for reference present disclosure, be suitably modified realization of process parameters.In particular, it should be pointed out that all similar replaces
Change and change apparent to those skilled in the art, they are considered as being included in the present invention.Side of the invention
Method and application be described by preferred embodiment, related personnel obviously can not depart from the content of present invention, spirit and
To method described herein and application is modified or appropriate changes and combinations in range, carry out implementation and application the technology of the present invention.
The present invention provides a kind of LAMP detection primer of meat of a sheep nucleic acid DNA in test sample, LAMP detection primers
Are as follows:
Outer primer MY-F3-1:5 '-ACGAAACAGGATCCAACAAC-3 ' (as shown in SEQ ID NO:1)；
Outer primer MY-B3-1:5 '-AGGTTTGATGTGAGGGGG-3 ' (as shown in SEQ ID NO:2)；
Inner primer MY-FIP-1:5 '-TGAGGATTAGTAGGATAGCACCTAGGGAATTCCATCGGACACAGAT-3 '
(as shown in SEQ ID NO:3)；
Inner primer MY-BIP-1:5 '-CATGCTACTAGTACTATTCACGCCTGAGTGTTAAGTGGGTTTGCTGG-3 '
(as shown in SEQ ID NO:4)；
Ring primer MY-LF-1:5 '-ATGGTGTAATAAGGGTGGAAGGG-3 ' (as shown in SEQ IDNO:5)；
Ring primer MY-LB-1:5 '-CTCGGAGACCCAGACAACTACAC-3 ' (as shown in SEQ IDNO:6).
The primer is designed for the compressed sequence of the Cytb gene of the sheep provided in ncbi database；For
The sensitivity for improving primer determines by literature survey and selects chondriogen Cytb as test object.In the nt of NCBI
The Cytb sequence of 549 sheep is collected into database altogether, the sequence being collected into is compared using BioEdit software, and
It carries out compression and generates Consensus Sequence sequence, this sequence is compressed sequence.In order to improve the specificity of primer, this
Primer is compared in design using the compressed sequence of the compressed sequence and other species, and (other species include: pig, yak
The common species such as ox, ox, buffalo, goat, donkey, horse, duck, goose, chicken, mouse, cat, dog, fox, rabbit and people).Pass through sequence point
Analysis, it is determined that the sequence difference very little of sheep and goat, the difference of only fragmentary several or a bit of sequence, and also to guarantee with
Other species can be distinguished, the LAMP primer designed by regular software, be unable to reach the purpose for distinguishing the two or more persons.Institute
It is for the fragmentary or a bit of sequence between sheep, goat and other species with the primer sequence of protection involved in the present invention
The artificial design of primers that difference carries out.Finally having determined can guarantee that one section of sequence of the primer specificity no problem has carried out LAMP
Design of primers.Because the design of the primer LAMP primer needs artificial specificity to distinguish other species, the present invention is from each object
The sequence alignment of kind compresses, to the comparison of interspecies differences, obtains the representative gene order area obtained for above-mentioned analysis
Section (as shown in SEQ ID NO:7), then more set primers combinations have been obtained by the method for engineer, then carry out primer combination
Screening and modification optimization etc. a series of activities, sensitivity, repeatability and specificity all reach best level primer combination,
To in test sample whether containing sheep ingredient have high specificity and sensitivity.
SEQ ID NO:7
ACCCGATTTTTCGCCTTTCACTTTATTTTCCCATTCATCATCGCAGCCCTCGCCATAGTTCACCTACT
CTTCCTCCACGAAACAGGATCCAACAACCCCACAGGAATTCCATCGGACACAGATAAAATTCCCTTCCACCCTTAT
TACACCATTAAAGACATCCTAGGTGCYATCCTACTAATCCTCAYYCTCATGCTACTAGTACTATTYACGCCTGACT
TACTCGGAGACCCAGACAACTACACCCCAGCAAACCCACTTAACACHCCCCCTCACATCAAACCTGARTGATACTT
CCTATTTGCGTACGCAATCTTACGATCAATCCCTAATAAACTAGGAGGAGTCCTCGCCCTAATCCTCTCAATCCTA
GTC。
Wherein, Y, H, R are degeneracy base, y=C/T, H=A/T/C, R=A/G.
Another aspect of the present invention is to provide a kind of LAMP detection method of meat of a sheep in test sample, which is characterized in that
LAMP amplification is carried out with primer using above-mentioned LAMP detection.
In order to advanced optimize above-mentioned detection method, technical solution provided by the invention further include:
Each 0.12 μ L of outer primer F3 and B3 of 0.3mM；Each 0.96 μ L of inner primer FIP and BIP of 2.4mM；The ring primer of 1mM
Each 0.4 μ L of LF and LB；2 × reaction buffer, 10 μ L；The sample DNA of 1 μ L adds sterilizing purified water to 20 μ L systems.
Above-mentioned LAMP detects reaction condition are as follows: 60 DEG C of -65 DEG C of constant temperature 50min.
Preferably, above-mentioned LAMP detects reaction condition are as follows: 65 DEG C of constant temperature 50min.
In above-mentioned LAMP detection method, testing result passes through observation real-time fluorescence PCR instrument appearance time.
Another aspect of the present invention additionally provides the LAMP detection method that the precise Identification from a variety of meat goes out meat of a sheep, in sample
It include above-mentioned LAMP detection primer in meat of a sheep detection method.
The present invention, which provides one kind, can distinguish short sequence difference in gene, and precise Identification goes out meat of a sheep from a variety of meat
LAMP primer composition and application.Using LAMP technology in real-time fluorescence PCR instrument real-time detection raw meat, processed meat food etc. with
Meat of a sheep nucleic acid DNA in sample based on meat.Primer high sensitivity that the present invention screens, high specificity, the detection of foundation
Method has the advantages that accuracy rate is high, detection time is short, result can be observed in real time, only needs 1h from sample treatment to report result,
It is easy to operate, there is higher specificity than other PCR methods.Meanwhile the present invention designs for the first time, screens silk floss in test sample
The LAMP primer of mutton nucleic acid DNA, and the LAMP detection method of meat of a sheep nucleic acid DNA in sample is established, fill up domestic and international
In the blank of this detection field.
Involved in application of the primer combination provided by the invention in the Species estimation and/or meat of a sheep of sheep are identified
Raw material and reagent are available on the market.
Below with reference to embodiment, the present invention is further explained:
The preparation of 1 primer of embodiment
The primer sequence is synthesized by Sheng Gong company.Design 6 primers for target sequence, including two inner primers (FIP and
BIP) and two outer primers (F3 and B3) and two ring primers (LF and LB), nucleotide sequence is listed in table 1.
The concrete configuration of LAMP detection architecture is each 0.12 μ L of outer primer F3 and B3 of 0.3mM；The inner primer FIP of 2.4mM
With each 0.96 μ L of BIP；Each 0.4 μ L of ring primer LF and LB of 1mM；2 × reaction buffer, 10 μ L；The sample DNA of 1 μ L, adds sterilizing
Purified water is to 20 μ L systems.
The LAMP detects reaction condition are as follows: 65 DEG C of constant temperature 50min.
1. loop-mediated isothermal amplification technique the primer information of table
The preparation of 2 nucleic acid DNA template of embodiment
Rigorous aseptic acquires fresh musculature 50mg of sheep, duck, ox, chicken, pig or so and is used as sample, then uses
Tiangeng animal tissue genome DNA extracting reagent kit (paramagnetic particle method) extracts the DNA in each tissue respectively.
3 specific test of embodiment
The positive plasmid (positive control) containing sheep CytB gene saved respectively with this laboratory, contains goat CytB
The plasmid (negative control) of gene sterilizes purified water (negative control), duck DNA, meat of a sheep DNA, Carnis Bovis seu Bubali DNA, chicken DNA
It is that template establishes LAMP reaction system with pork DNA, carries out LAMP augmentation detection；It is divided using NanoDrop 2000C ultramicron
Each genomic DNA concentration of photometric determination and purity, and the genomic DNA of all samples is diluted to 20ng/uL.
The genomic nucleic acids DNA of above-mentioned 5 kinds of control samples, which is extracted, uses Tiangeng animal tissue extracting genome DNA reagent
Box (paramagnetic particle method) is completed；Containing sheep/goat CytB gene positive plasmid be health be century extraction of plasmid DNA kit it is complete
At.
LAMP reaction result is determined by such as following principle.
As a result the phenomenon that being judged as positive reaction are as follows: expanded using real-time fluorescence PCR instrument, observation real-time fluorescence is bent
Line, reaction time 50min observe the appearance time of real-time fluorescence curves.Negative control experiment is done with the purified water that sterilizes, it is negative
Control experiment results should be negative.(see Fig. 2)
If 1) Ct≤40, determine that LAMP test result is the positive；
If 2) Ct > 45, do not occur 1) described in phenomenon, determine LAMP test result be feminine gender；
If 3) 40 Ct≤45 <, occur 1) described in phenomenon, determine LAMP test result be it is suspicious, need to test again；
4) after testing again to suspect results, if Ct≤45, phenomenon described in appearance 1) determines that LAMP test result is sun
Property, otherwise it is judged as negative.
(no real-time fluorescence is not detected within the 50min time of reaction containing meat of a sheep genome in sample to other
Curve), it is shown as negative reaction.
Table 2. experiment meat and LAMP testing result
Repetitive test under 4 sensitivity of embodiment and sensitivity
The positive control sample of embodiment 1 is measured into genome using NanoDrop 2000C ultramicrospectrophotometer
DNA concentration and purity, and positive control sample Plasmid DNA is diluted to 20ng/ μ L, then by the positive control sample of 20ng/ μ l
Plasmid DNA is with 10-1、10-2、10-3、10-4Dilution be diluted, finally using LAMP test method of the invention to above-mentioned
DNA sample is measured.
(the dilution 10 when the concentration of chicken nucleic acid DNA in sample is 20pg/ μ L-3), when reacting positive result interpretation
Between be less than 30min (actual measurement Ct value=19.6min) (Fig. 3).
The positive control sample of embodiment 1 is measured into genome using NanoDrop 2000C ultramicrospectrophotometer
DNA concentration and purity, and positive control sample Plasmid DNA is diluted to 20pg/ μ L and (is diluted to what the primer can be detected
Minimum concentration), repeated measurement finally is carried out to above-mentioned DNA sample using LAMP test method of the invention.Number of repetition is
20 times.(Fig. 4)
Therefore, the detection sensitivity of LAMP detection method qualitative test of the present invention at least can reach 20pg/ μ L
(dilution 10-3)。
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered
It is considered as protection scope of the present invention.
Sequence table
<110>Capitalbio Corporation Co., Ltd.
<120>application of the primer combination in Species estimation and/or the meat of a sheep identification of sheep
<130> MP1832065
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
acgaaacagg atccaacaac 20
<210> 2
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
aggtttgatg tgaggggg 18
<210> 3
<211> 46
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
tgaggattag taggatagca cctagggaat tccatcggac acagat 46
<210> 4
<211> 47
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
catgctacta gtactattca cgcctgagtg ttaagtgggt ttgctgg 47
<210> 5
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
atggtgtaat aagggtggaa ggg 23
<210> 6
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
ctcggagacc cagacaacta cac 23
<210> 7
<211> 375
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> unsure
<222> (171)..(171)
<223> y=C/T
<220>
<221> unsure
<222> (188)..(188)
<223> y=C/T
<220>
<221> unsure
<222> (189)..(189)
<223> y=C/T
<220>
<221> unsure
<222> (210)..(210)
<223> y=C/T
<220>
<221> unsure
<222> (267)..(267)
<223> h=A/T/C
<220>
<221> unsure
<222> (288)..(288)
<223> r=A/G
<400> 7
acccgatttt tcgcctttca ctttattttc ccattcatca tcgcagccct cgccatagtt 60
cacctactct tcctccacga aacaggatcc aacaacccca caggaattcc atcggacaca 120
gataaaattc ccttccaccc ttattacacc attaaagaca tcctaggtgc yatcctacta 180
atcctcayyc tcatgctact agtactatty acgcctgact tactcggaga cccagacaac 240
tacaccccag caaacccact taacachccc cctcacatca aacctgartg atacttccta 300
tttgcgtacg caatcttacg atcaatccct aataaactag gaggagtcct cgccctaatc 360
ctctcaatcc tagtc 375
Claims (10)
1. application of the mitochondrial cytochrome b gene in Species estimation and/or the meat of a sheep identification of sheep.
2. marker, which is characterized in that have the nucleotide sequence as shown in SEQ ID NO:7.
3. with the sequence as shown in SEQ ID NO:7 nucleotide as marker sheep Species estimation and/or meat of a sheep
Application in identification.
4. primer combines characterized by comprising primer-F3, primer-B3, primer-FIP, primer-BIP, primer-LF and draw
Object-LB；
Primer-the F3 has any one in nucleotide sequence as follows:
(I), there is nucleotide sequence shown in SEQ ID NO:1；
(II), have nucleotide sequence shown in SEQ ID NO:1 through modification, substitution, one or more alkali are deleted and/or added
The nucleotide sequence that base obtains；
(III), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:1；
(IV), the complementary series of the sequence as shown in (I), (II) or (III)；
Primer-the B3 has any one in nucleotide sequence as follows:
(V), there is nucleotide sequence shown in SEQ ID NO:2；
(VI), have nucleotide sequence shown in SEQ ID NO:2 through modification, substitution, one or more alkali are deleted and/or added
The nucleotide sequence that base obtains；
(VII), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:2；
(VIII), the complementary series of the sequence as shown in (V), (VI) or (VII)；
Primer-the FIP has any one in nucleotide sequence as follows:
(IX), there is nucleotide sequence shown in SEQ ID NO:3；
(X), have nucleotide sequence shown in SEQ ID NO:3 through modification, substitution, one or more alkali are deleted and/or added
The nucleotide sequence that base obtains；
(XI), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:3；
(XII), the complementary series of the sequence as shown in (IX), (X) or (XI)；
Primer-the BIP has any one in nucleotide sequence as follows:
(XIII), there is nucleotide sequence shown in SEQ ID NO:4；
(XIV), have nucleotide sequence shown in SEQ ID NO:4 one or more through modification, substitution, deletion and/or addition
The nucleotide sequence that base obtains；
(XV), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:4；
(XVI), the complementary series of the sequence as shown in (XIII), (XIV) or (XV)；
Primer-the LF has any one in nucleotide sequence as follows:
(XVII), there is nucleotide sequence shown in SEQ ID NO:5；
(XVIII), have nucleotide sequence shown in SEQ ID NO:5 through modification, substitution, deletion and/or addition one or more
The nucleotide sequence that a base obtains；
(XIX), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:5；
(XX), the complementary series of the sequence as shown in (XVII), (XVIII) or (XIX)；
Primer-the LB has any one in nucleotide sequence as follows:
(XXI), there is nucleotide sequence shown in SEQ ID NO:6；
(XXII), have nucleotide sequence shown in SEQ ID NO:6 one or more through modification, substitution, deletion and/or addition
The nucleotide sequence that base obtains；
(XXIII), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:6；
(XXIV), the complementary series of the sequence as shown in (XXI), (XXII) or (XXIII).
5. primer as claimed in claim 4 combination, which is characterized in that primer-F3 described in the primer combination, described draw
Object-B3, the primer-FIP, the primer-BIP, the primer-LF and the primer-LB molar ratio be 0.3:0.3:
2.4:2.4:1:1.
6. kit, which is characterized in that combined including primer as described in claim 4 or 5.
7. primer combination as described in claim 4 or 5 or as claimed in claim 6 Species estimation of the kit in sheep
And/or the application in meat of a sheep identification.
8. the method for the Species estimation of sheep, which comprises the steps of:
(1) nucleic acid of sample to be tested is obtained；
(2) primer in primer combination as described in claim 4 or 5 is respectively adopted as template in the nucleic acid extracted using step (1)
Ring mediated isothermal amplification is carried out, amplification is obtained；
(3) obtain qualification result according to the amplification: if specific amplification may be implemented, sample to be tested is sheep；
If can not achieve specific amplification, sample to be tested is not sheep.
9. the method for the identification of meat of a sheep, which comprises the steps of:
(1) nucleic acid of sample to be tested is obtained；
(2) primer in primer combination as described in claim 4 or 5 is respectively adopted as template in the nucleic acid extracted using step (1)
Ring mediated isothermal amplification is carried out, amplification is obtained；
(3) obtain qualification result according to the amplification: if specific amplification may be implemented, sample to be tested is sheep
Meat；If can not achieve specific amplification, sample to be tested is not meat of a sheep.
10. method as claimed in claim 8 or 9, which is characterized in that the reaction system of the ring mediated isothermal amplification are as follows:
Each 0.12 μ L of outer primer F3 and B3 of 0.3mM；Each 0.96 μ L of inner primer FIP and BIP of 2.4mM；Ring the primer LF and LB of 1mM is each
0.4μL；2 × reaction buffer, 10 μ L；The sample to be tested nucleic acid of 1 μ L adds water to 20 μ L systems；
The reaction temperature of the ring mediated isothermal amplification is 60 DEG C~65 DEG C, reaction time 50min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811631731.0A CN109504786A (en) | 2018-12-29 | 2018-12-29 | Primer combines the application in Species estimation and/or the meat of a sheep identification of sheep |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811631731.0A CN109504786A (en) | 2018-12-29 | 2018-12-29 | Primer combines the application in Species estimation and/or the meat of a sheep identification of sheep |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109504786A true CN109504786A (en) | 2019-03-22 |
Family
ID=65756824
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811631731.0A Pending CN109504786A (en) | 2018-12-29 | 2018-12-29 | Primer combines the application in Species estimation and/or the meat of a sheep identification of sheep |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109504786A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109811066A (en) * | 2019-04-11 | 2019-05-28 | 中国农业大学 | Sheep derived components rapid detection method and kit in a kind of food |
| CN109988849A (en) * | 2019-04-21 | 2019-07-09 | 北华大学 | Rat meat and chevon, meat of a sheep multiple PCR detection kit and identification method |
| CN111413436A (en) * | 2020-04-23 | 2020-07-14 | 中国农业科学院农业质量标准与检测技术研究所 | Method for identifying lamb mutton and adult mutton |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103243165A (en) * | 2013-05-13 | 2013-08-14 | 长沙市食品质量安全监督检测中心 | Method for rapidly detecting pig source components in red meat through real-time fluorescence loop-mediated isothermal amplification (LAMP) method |
| KR101437385B1 (en) * | 2012-08-13 | 2014-09-04 | 대한민국 | Primer set for Brucella abortus strain-specific identification using loop-mediated isothermal amplification and method for detecting Brucella abortus using the same |
| US20160076083A1 (en) * | 2014-09-17 | 2016-03-17 | Board Of Regents, The University Of Texas System | Methods and devices related to toehold-based strand displacement with loop-mediated isothermal amplification |
| CN106755381A (en) * | 2016-12-13 | 2017-05-31 | 苏州百源基因技术有限公司 | One group of specific primer and probe of the real-time PCR detection for being used for sheep source property |
-
2018
- 2018-12-29 CN CN201811631731.0A patent/CN109504786A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101437385B1 (en) * | 2012-08-13 | 2014-09-04 | 대한민국 | Primer set for Brucella abortus strain-specific identification using loop-mediated isothermal amplification and method for detecting Brucella abortus using the same |
| CN103243165A (en) * | 2013-05-13 | 2013-08-14 | 长沙市食品质量安全监督检测中心 | Method for rapidly detecting pig source components in red meat through real-time fluorescence loop-mediated isothermal amplification (LAMP) method |
| US20160076083A1 (en) * | 2014-09-17 | 2016-03-17 | Board Of Regents, The University Of Texas System | Methods and devices related to toehold-based strand displacement with loop-mediated isothermal amplification |
| CN106755381A (en) * | 2016-12-13 | 2017-05-31 | 苏州百源基因技术有限公司 | One group of specific primer and probe of the real-time PCR detection for being used for sheep source property |
Non-Patent Citations (2)
| Title |
|---|
| AE-RI CHO 等: "Meat Species Identification using Loop-mediated Isothermal Amplification Assay", 《KOREAN J FOOD SCI ANIM RESOUR》 * |
| L YANG 等: "Identification of pork in meat products using real-time loop-mediated isothermal amplification", 《BIOTECHNOLOGY & BIOTECHNOLOGICAL EQUIPMENT》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109811066A (en) * | 2019-04-11 | 2019-05-28 | 中国农业大学 | Sheep derived components rapid detection method and kit in a kind of food |
| CN109811066B (en) * | 2019-04-11 | 2020-11-24 | 中国农业大学 | Method and kit for rapidly detecting sheep-derived components in food |
| CN109988849A (en) * | 2019-04-21 | 2019-07-09 | 北华大学 | Rat meat and chevon, meat of a sheep multiple PCR detection kit and identification method |
| CN111413436A (en) * | 2020-04-23 | 2020-07-14 | 中国农业科学院农业质量标准与检测技术研究所 | Method for identifying lamb mutton and adult mutton |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110551846B (en) | Cpf1 kit for quickly detecting African swine fever virus nucleic acid and detection method thereof | |
| CN109504786A (en) | Primer combines the application in Species estimation and/or the meat of a sheep identification of sheep | |
| Owen et al. | Numerical analysis of electrophoretic protein patterns of Campylobacter laridis and allied thermophilic campylobacters from the natural environment | |
| CN106520977B (en) | The primer and method of ring mediated isothermal amplification method detection causing root rot disease of Medicago sativa bacterium | |
| CN101892300A (en) | Klebsiella pneumoniae detection kit and use method thereof | |
| CN106282416B (en) | A kind of the multi-fluorescence immunoassay primer, kit and method of 5 kinds of fowl immunosupress cause of diseases of quick differentiation | |
| CN106048034B (en) | Animal-derived component forms in based on PCR-RLFP-DHPLC technology scanning analysis food | |
| CN110358866A (en) | Novel goose astrovirus SYBR Green dye method fluorescent quantificationally PCR detecting kit | |
| Fuhrman et al. | Prokaryotic and viral diversity patterns in marine plankton | |
| CN105603123A (en) | Real-time fluorescence RPA reagent kit and test strip RPA reagent kit for rapidly detecting porcine parvovirus and application of reagent kits | |
| CN114908176A (en) | Molecular marker related to chicken carcass and growth traits and application thereof | |
| CN111876502A (en) | Method for identifying Brucella S2 vaccine strain by dual real-time fluorescent quantitative PCR and kit used by same | |
| CN106282417B (en) | A kind of quick multi-fluorescence immunoassay primer, kit and method for distinguishing CAV, MDV, REV, IBDV | |
| CN109457015A (en) | Primer combines the application in Species estimation and/or the beef identification of ox | |
| CN103276103A (en) | Kit with RT-LAMP nucleic acid test strips for detecting porcine epidemic diarrhea virus and applications of kit | |
| CN110218806A (en) | The quick detection primer group of detection of Salmonella fimW gene novel visual LAMP and kit | |
| CN109504785A (en) | Primer combination and its application in Species estimation and/or the chicken identification of chicken | |
| CN109517907A (en) | Primer combines the application in Species estimation and/or the duck identification of duck | |
| CN101892299A (en) | Clostridium perfringen detection kit and user method thereof | |
| CN112852980B (en) | Detection method for detecting nucleic acid of Atlantic salmon based on CRISPR fluorescence method and detection kit thereof | |
| CN111996274B (en) | Large-scale quantitative detection method for plant pathogenic fungi by high-throughput sequencing | |
| CN109706250A (en) | Primer combination and its application in Species estimation and/or the pork identification of pig | |
| CN114752690A (en) | Method for rapidly identifying duck-origin components in meat products based on MIRA technology | |
| CN103592167B (en) | Based on the Detection Methods of Fluoroquinolones Residue of luciferase mark engineering bacteria | |
| Sperner et al. | Use of the RAPID ID 32 A® system for rapid identification of Clostridium species important in food hygiene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190322 |
|
| RJ01 | Rejection of invention patent application after publication |