CN109423500A - A kind of method and application of the dual-gene knockout of Mdr1a/1b - Google Patents

A kind of method and application of the dual-gene knockout of Mdr1a/1b Download PDF

Info

Publication number
CN109423500A
CN109423500A CN201710771262.1A CN201710771262A CN109423500A CN 109423500 A CN109423500 A CN 109423500A CN 201710771262 A CN201710771262 A CN 201710771262A CN 109423500 A CN109423500 A CN 109423500A
Authority
CN
China
Prior art keywords
mdr1a
mdr1b
sgrna
gene
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710771262.1A
Other languages
Chinese (zh)
Other versions
CN109423500B (en
Inventor
王昕�
赵军芳
鲁健
刘明耀
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
East China Normal University
Original Assignee
East China Normal University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by East China Normal University filed Critical East China Normal University
Priority to CN201710771262.1A priority Critical patent/CN109423500B/en
Publication of CN109423500A publication Critical patent/CN109423500A/en
Application granted granted Critical
Publication of CN109423500B publication Critical patent/CN109423500B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/89—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microinjection
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276—Knock-out vertebrates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety
    • C12N2810/10—Vectors comprising a non-peptidic targeting moiety

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Environmental Sciences (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of methods of the dual-gene knockout of Mdr1a/1b, and successfully construct Mdr1a/1b knockout rat model, new animal model is provided to study the transhipment of the function such as mediate drug of P- glycoprotein (P-glycoprotein, P-gp).The present invention carries out the gene knockout of P of Rats-gp using CRISPR/Cas9 technology for the first time, it is synthesized in vitro by Mdr1a and Mdr1b shot design, sgRNA and has obtained F0 for Chi-meric mice with processes such as transcription, the preparation of false pregnancy mouse, the external microinjection of fertilized eggs and embryo transfers, it breeds and screens using two generations, finally obtained the homozygote rat of the dual-gene knockout of Mdr1a/1b.It is verified through T7EI endonuclease, miss target phenomenon does not occur in obtained knockout rat.

Description

A kind of method and application of the dual-gene knockout of Mdr1a/1b
Technical field
The invention belongs to biomedicine technical fields, and in particular to a kind of method of the dual-gene knockout of Mdr1a/1b and its Application in Mdr1a/1b knockout rat model construction.
Background technique
1976, Juliano RL and LingV et al. were when screening the Chinese hamster ovary cell of resistance to colchicin, discovery The phenomenon that a kind of glycoprotein on cell membrane can make cell generate crossing drug resistant, because of the albumen and cell permeability of the membrane (Permeability) related, therefore it is named as P- glycoprotein (P-glycoprotein, P-gp).
P-gp is that earliest discovery is also the abc transport body that research is most thorough at present, the ABCB1 that is otherwise known as (or MDR1).P- Gp is single chain protein, about contains 1280 amino acid, and molecular weight is about 170kD, is 12 cross-film eggs on cell membrane It is white, it is made of the subunit that two similitudes are 43%, each subunit includes that 1 transmembrane domain (TMD) and 1 nucleic acid combine knot Structure domain (NBD).Wherein, TMD is made of 6 alpha-helixes, is extreme hydrophobic region, constitutes the channel of substance transmembrane transport；NBD is then Extremely conservative hydrophilic area is the site that ATP is combined and hydrolyzed.P-gp is found in tumour cell, subsequent Research finds that it is widely distributed in vivo, especially has in small intestine, liver, kidney, blood-brain barrier, blood-testis barrier, placenta etc. and divides It is higher to secrete expression quantity in the tissue and organ of effect.The major physiological effect of P-gp is that hydrolysising ATP generates energy, then utilizes this A little energy are by endogenous material (cholesterol, cholic acid, amino acid, carbohydrate, fat, hormone and electrolyte etc.), exogenous material Cell is discharged in (drug and its metabolite etc.) and some toxin, to play the role of protecting cell and histoorgan.So And P-gp can undoubtedly reduce the bioavilability of drug to drug efflux, influence the performance of curative effect of medication.To early stage medicament research and development The case of failure carries out analysis and finds, although about 40% failure is due to compound there are many reason of failure Absorption, distribution, metabolism, excretion (ADME) property are bad, and a major reason for causing ADME property bad is exactly P-gp pairs The outlet of drug causes the bioavilability of drug low.In addition, studies have shown that being unsuccessfully due to machine there are about 90% chemotherapy of tumors There is multidrug resistance in body, and the main reason for leading to multidrug resistance is the overexpression of P-gp.It is mediated based on the above two o'clock, P-gp Drug transport research is extremely important.
Mouse and rat in rodent are most common animal models in pharmacokinetics experiment, having property The advantage that feelings are docile, breeding is fast.When studying the drug transport that P-gp is mediated includes screening the inhibitor of P-gp, many researchs are all It is the direct mouse and rat for selecting wild type, however, due to the specificity of inhibitor or antibody is not high etc., in an experiment It often will appear some data for being difficult to explain.The appearance of gene Knockout provides possibility to solve this problem.
Earliest gene Knockout is the principle based on homologous recombination, but inefficiency, and the period is very long.With The development of biotechnology, ZFN and TALEN technology successively occur, and substantially increase the efficiency of gene knockout, but the disadvantage is that experiment Design complexity, higher cost.CRISPR/Cas9 is the third generation gene editing technology occurred after ZFN and TALEN, with ZFN With three big sharp weapon of TALEN technology and referred to as gene editing, have the advantages that at low cost, easy to operate, targeting is with high accuracy, it can be with Realize that polygenes knocks out simultaneously, and almost without species limitation.Based on said gene knock out technology, researchers also succeed structure The animal model of some P-gp gene knockouts is built.The encoding gene of P-gp have in rodent 3 kinds (Mdr1a, Mdr1b, Mdr2), the P-gp of different genes coding plays different physiology roles: the P-gp of Mdr1a, Mdr1b coding and drug across Film transhipment and drug resistance are related, study in pharmacokinetics more；The P-gp of Mdr2 coding is mainly responsible for phosphatide Transhipment, while the transhipment and regulation of hormone may be participated in.1994, utilize homologous recombination technique, Schinkel AH et al. success The Mdr1a gene in mouse is knocked out.1997, on the basis of having work, Schinkel AH et al. was constructed again Mdr1b and Mdr1a/1b gene knock-out mice model.2012, it is based on ZFN technology, Chu X et al. completes rat Mdr1a Gene knockout.However, knockout rat model occurs compared with mouse evening, up to the present, not yet due to technical restriction Mdr1a/1b knockout rat model occurs.
CRISPR/Cas9 gene editing technology may be implemented multidigit point while knock out, this is knocked out entirely for building P-gp gene Rat model bring dawn.Compared with mouse, rat volume is big, blood volume is big, more convenient carry out experimental study.It is more important , the data in ncbi database are shown, either on genomic level, mRNA level in-site or protein level, with mouse It compares, the P-gp of rat and the similitude of people are higher, and the drug transport of P-gp mediation is studied using rat model, can be trueer The case where reflecting drug transport in human body on the spot.Therefore, when carrying out the research in relation to P-gp, rat model has mouse model Incomparable advantage and application value.
Summary of the invention
The present invention is directed to overcome the deficiencies of the prior art and provide a kind of method of the dual-gene knockout of Mdr1a/1b and answered For the building of Mdr1a/1b knockout rat model, CRISPR/Cas9 technology is used for the clpp gene of P of Rats-gp for the first time It removes, has successfully obtained the rat of the dual-gene knockout of Mdr1a/1b.
The present invention provides a kind of methods of the dual-gene knockout of Mdr1a/1b, the described method comprises the following steps:
(1) selection of Mdr1a and Mdr1b target spot；
It is selected using online target spot prediction website http://zifit.partners.org/ZiFiT/ChoiceMenu.aspx It selects Mdr1a and Mdr1b and knocks out target spot；
Wherein, Mdr1a gene knockout target sequence is 5 '-AGATAGCTTTGCAAATGT-3 ' (SEQ ID NO.1)； Mdr1b gene knockout target sequence is 5 '-CCTCCTGATGCTGGTGTT-3 ' (SEQ ID NO.2).
(2) synthesis and extraction of sgRNA；
The Oligo segment that a segment length is 60bp is synthesized first, including the sequence for knocking out target spot and T7 promoter；So Afterwards, using Oligo segment as template, complete sgRNA double-stranded template, length 130bp are synthesized by over-lap PCR reaction, and pass through SgRNA double-stranded template is extracted and is separated by the method for phenol chloroform extraction；Finally, with T7 in-vitro transcription kit by sgRNA double-strand mould Plate is transcribed in vitro, and is extracted transcription product using the method for phenol chloroform extraction and is separated, obtains Mdr1a and Mdr1b gene sgRNA。
Wherein, the Oligo fragment sequence comprising Mdr1a gene knockout target spot is 5 '-GATCACTAATACGACTCACTATA GGAGATAGCTTTGCAAATGTGTTTTAGAGCTAGAAAT-3'(SEQ ID NO.3)；Include Mdr1b gene knockout target spot Oligo fragment sequence is 5 '-GATCACTAATACGACTCACTATAGGCCTCCTGATGCTGGTGTTGTTTTAGAGCTAGAAA T-3'(SEQ ID NO.4).Underscore area is target sequence.
(3) sgRNA and Cas9 mRNA co-injection and embryo transfer；
Two kinds of sgRNA and the micro- co-injection of Cas9 mRNA are entered in rat fertilized eggs endochylema；Wherein, the sgRNA is The sgRNA of Mdr1a and Mdr1b gene, the concentration of sgRNA, Cas9mRNA of sgRNA, Mdr1b gene of the Mdr1a gene Than for 1-2:1-2:1-2；It preferably, is 1:1:2；If the sgRNA concentration of Mdr1a and Mdr1b gene is 25ng/mL, Cas9 MRNA concentration is 50ng/mL.
Wherein, two kinds of sgRNA after being mixed with Cas9mRNA three each fertilized eggs inject 0.1 μ L-0.2 μ L.
Wherein, the sequence of shown Cas9 mRNA is as shown in SEQ ID NO.44, are as follows:
AUGGACUAUAAGGACCACGACGGAGACUACAAGGAUCAUGAUAUUGAUUACAAAGACGAUGACGAUAAGAUGGCCCC AAAGAAGAAGCGGAAGGUCGGUAUCCACGGAGUCCCAGCAGCCGACAAGAAGUACAGCAUCGGCCUGGACAUCGGCA CCAACUCUGUGGGCUGGGCCGUGAUCACCGACGAGUACAAGGUGCCCAGCAAGAAAUUCAAGGUGCUGGGCAACACC GACCGGCACAGCAUCAAGAAGAACCUGAUCGGAGCCCUGCUGUUCGACAGCGGCGAAACAGCCGAGGCCACCCGGCU GAAGAGAACCGCCAGAAGAAGAUACACCAGACGGAAGAACCGGAUCUGCUAUCUGCAAGAGAUCUUCAGCAACGAGA UGGCCAAGGUGGACGACAGCUUCUUCCACAGACUGGAAGAGUCCUUCCUGGUGGAAGAGGAUAAGAAGCACGAGCGG CACCCCAUCUUCGGCAACAUCGUGGACGAGGUGGCCUACCACGAGAAGUACCCCACCAUCUACCACCUGAGAAAGAA ACUGGUGGACAGCACCGACAAGGCCGACCUGCGGCUGAUCUAUCUGGCCCUGGCCCACAUGAUCAAGUUCCGGGGCC ACUUCCUGAUCGAGGGCGACCUGAACCCCGACAACAGCGACGUGGACAAGCUGUUCAUCCAGCUGGUGCAGACCUAC AACCAGCUGUUCGAGGAAAACCCCAUCAACGCCAGCGGCGUGGACGCCAAGGCCAUCCUGUCUGCCAGACUGAGCAA GAGCAGACGGCUGGAAAAUCUGAUCGCCCAGCUGCCCGGCGAGAAGAAGAAUGGCCUGUUCGGAAACCUGAUUGCCC UGAGCCUGGGCCUGACCCCCAACUUCAAGAGCAACUUCGACCUGGCCGAGGAUGCCAAACUGCAGCUGAGCAAGGAC ACCUACGACGACGACCUGGACAACCUGCUGGCCCAGAUCGGCGACCAGUACGCCGACCUGUUUCUGGCCGCCAAGAA CCUGUCCGACGCCAUCCUGCUGAGCGACAUCCUGAGAGUGAACACCGAGAUCACCAAGGCCCCCCUGAGCGCCUCUA UGAUCAAGAGAUACGACGAGCACCACCAGGACCUGACCCUGCUGAAAGCUCUCGUGCGGCAGCAGCUGCCUGAGAAG UACAAAGAGAUUUUCUUCGACCAGAGCAAGAACGGCUACGCCGGCUACAUUGACGGCGGAGCCAGCCAGGAAGAGUU CUACAAGUUCAUCAAGCCCAUCCUGGAAAAGAUGGACGGCACCGAGGAACUGCUCGUGAAGCUGAACAGAGAGGACC UGCUGCGGAAGCAGCGGACCUUCGACAACGGCAGCAUCCCCCACCAGAUCCACCUGGGAGAGCUGCACGCCAUUCUG CGGCGGCAGGAAGAUUUUUACCCAUUCCUGAAGGACAACCGGGAAAAGAUCGAGAAGAUCCUGACCUUCCGCAUCCC CUACUACGUGGGCCCUCUGGCCAGGGGAAACAGCAGAUUCGCCUGGAUGACCAGAAAGAGCGAGGAAACCAUCACCC CCUGGAACUUCGAGGAAGUGGUGGACAAGGGCGCUUCCGCCCAGAGCUUCAUCGAGCGGAUGACCAACUUCGAUAAG AACCUGCCCAACGAGAAGGUGCUGCCCAAGCACAGCCUGCUGUACGAGUACUUCACCGUGUAUAACGAGCUGACCAA AGUGAAAUACGUGACCGAGGGAAUGAGAAAGCCCGCCUUCCUGAGCGGCGAGCAGAAAAAGGCCAUCGUGGACCUGC UGUUCAAGACCAACCGGAAAGUGACCGUGAAGCAGCUGAAAGAGGACUACUUCAAGAAAAUCGAGUGCUUCGACUCC GUGGAAAUCUCCGGCGUGGAAGAUCGGUUCAACGCCUCCCUGGGCACAUACCACGAUCUGCUGAAAAUUAUCAAGGA CAAGGACUUCCUGGACAAUGAGGAAAACGAGGACAUUCUGGAAGAUAUCGUGCUGACCCUGACACUGUUUGAGGACA GAGAGAUGAUCGAGGAACGGCUGAAAACCUAUGCCCACCUGUUCGACGACAAAGUGAUGAAGCAGCUGAAGCGGCGG AGAUACACCGGCUGGGGCAGGCUGAGCCGGAAGCUGAUCAACGGCAUCCGGGACAAGCAGUCCGGCAAGACAAUCCU GGAUUUCCUGAAGUCCGACGGCUUCGCCAACAGAAACUUCAUGCAGCUGAUCCACGACGACAGCCUGACCUUUAAAG AGGACAUCCAGAAAGCCCAGGUGUCCGGCCAGGGCGAUAGCCUGCACGAGCACAUUGCCAAUCUGGCCGGCAGCCCC GCCAUUAAGAAGGGCAUCCUGCAGACAGUGAAGGUGGUGGACGAGCUCGUGAAAGUGAUGGGCCGGCACAAGCCCGA GAACAUCGUGAUCGAAAUGGCCAGAGAGAACCAGACCACCCAGAAGGGACAGAAGAACAGCCGCGAGAGAAUGAAGC GGAUCGAAGAGGGCAUCAAAGAGCUGGGCAGCCAGAUCCUGAAAGAACACCCCGUGGAAAACACCCAGCUGCAGAAC GAGAAGCUGUACCUGUACUACCUGCAGAAUGGGCGGGAUAUGUACGUGGACCAGGAACUGGACAUCAACCGGCUGUC CGACUACGAUGUGGACCAUAUCGUGCCUCAGAGCUUUCUGAAGGACGACUCCAUCGACAACAAGGUGCUGACCAGAA GCGACAAGAACCGGGGCAAGAGCGACAACGUGCCCUCCGAAGAGGUCGUGAAGAAGAUGAAGAACUACUGGCGGCAG CUGCUGAACGCCAAGCUGAUUACCCAGAGAAAGUUCGACAAUCUGACCAAGGCCGAGAGAGGCGGCCUGAGCGAACU GGAUAAGGCCGGCUUCAUCAAGAGACAGCUGGUGGAAACCCGGCAGAUCACAAAGCACGUGGCACAGAUCCUGGACU CCCGGAUGAACACUAAGUACGACGAGAAUGACAAGCUGAUCCGGGAAGUGAAAGUGAUCACCCUGAAGUCCAAGCUG GUGUCCGAUUUCCGGAAGGAUUUCCAGUUUUACAAAGUGCGCGAGAUCAACAACUACCACCACGCCCACGACGCCUA CCUGAACGCCGUCGUGGGAACCGCCCUGAUCAAAAAGUACCCUAAGCUGGAAAGCGAGUUCGUGUACGGCGACUACA AGGUGUACGACGUGCGGAAGAUGAUCGCCAAGAGCGAGCAGGAAAUCGGCAAGGCUACCGCCAAGUACUUCUUCUAC AGCAACAUCAUGAACUUUUUCAAGACCGAGAUUACCCUGGCCAACGGCGAGAUCCGGAAGCGGCCUCUGAUCGAGAC AAACGGCGAAACCGGGGAGAUCGUGUGGGAUAAGGGCCGGGAUUUUGCCACCGUGCGGAAAGUGCUGAGCAUGCCCC AAGUGAAUAUCGUGAAAAAGACCGAGGUGCAGACAGGCGGCUUCAGCAAAGAGUCUAUCCUGCCCAAGAGGAACAGC GAUAAGCUGAUCGCCAGAAAGAAGGACUGGGACCCUAAGAAGUACGGCGGCUUCGACAGCCCCACCGUGGCCUAUUC UGUGCUGGUGGUGGCCAAAGUGGAAAAGGGCAAGUCCAAGAAACUGAAGAGUGUGAAAGAGCUGCUGGGGAUCACCA UCAUGGAAAGAAGCAGCUUCGAGAAGAAUCCCAUCGACUUUCUGGAAGCCAAGGGCUACAAAGAAGUGAAAAAGGAC CUGAUCAUCAAGCUGCCUAAGUACUCCCUGUUCGAGCUGGAAAACGGCCGGAAGAGAAUGCUGGCCUCUGCCGGCGA ACUGCAGAAGGGAAACGAACUGGCCCUGCCCUCCAAAUAUGUGAACUUCCUGUACCUGGCCAGCCACUAUGAGAAGC UGAAGGGCUCCCCCGAGGAUAAUGAGCAGAAACAGCUGUUUGUGGAACAGCACAAGCACUACCUGGACGAGAUCAUC GAGCAGAUCAGCGAGUUCUCCAAGAGAGUGAUCCUGGCCGACGCUAAUCUGGACAAAGUGCUGUCCGCCUACAACAA GCACCGGGAUAAGCCCAUCAGAGAGCAGGCCGAGAAUAUCAUCCACCUGUUUACCCUGACCAAUCUGGGAGCCCCUG CCGCCUUCAAGUACUUUGACACCACCAUCGACCGGAAGAGGUACACCAGCACCAAAGAGGUGCUGGACGCCACCCUG AUCCACCAGAGCAUCACCGGCCUGUACGAGACACGGAUCGACCUGUCUCAGCUGGGAGGCGACAAAAGGCCGGCGGC CACGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAG。
(4) F0 is for genotype identification；
F0 is extracted for rat genomic dna using the method for phenol chloroform extraction, and design primer expand respectively Mdr1a and Nearby sequence, connection carrier are sequenced Mdr1b gene target, identify gene mutation situation；
(5) breeding of F0 generation and F1 generation genotype identification；
Mdr1a/1b will be carried simultaneously to be mated with the F0 of mutation generation with wild type, and PCR expands after F1 generation genome is extracted Increase target gene fragment (that is, sequence near Mdr1a and Mdr1b gene target), send company to be sequenced amplified production；
(6) F1 generation breeding and F2 are for genotype identification；
Mdr1a/1b, which will be carried, to be mated with the F1 generation male and female individual of mutation, obtain F2 generation, F2 is mentioned for genome Rear PCR amplification target gene fragment (that is, sequence near Mdr1a and Mdr1b gene target) is taken, send company to survey amplified production Sequence obtains the individual of Mdr1a/1b gene knockout；
(7) undershooting-effect detects；
Website http://cas9.wicp.net/ is predicted according to undershooting-effect, finds the sgRNA for Mdr1a or Mdr1b The caused biggish site of possibility of missing the target, design primer verify whether these sites are mutated.
Wherein, when detecting the miss target phenomenon as caused by the sgRNA for Mdr1a, selected potential miss the target and used is drawn at site Object specifying information is as follows:
Wherein, when detecting the miss target phenomenon as caused by the sgRNA for Mdr1b, selected potential miss the target and used is drawn at site Object specifying information is as follows:
The present invention also provides be used to construct Mdr1a/1b gene knockout for the method for the dual-gene knockout of the Mdr1a/1b Application in rat model.
The present invention also provides a kind of target sequences, wherein Mdr1a gene target sequence is 5 '-AGATAGCTTTGCAAA TGT-3'(SEQ ID NO.1)；Mdr1b gene target sequence is 5 '-CCTCCTGATGCTGGTGTT-3 ' (SEQ ID NO.2).
The present invention also provides the synthetic methods of sgRNA a kind of, synthesize the Oligo segment that a segment length is 60bp first, Including the sequence for knocking out target spot and T7 promoter；Then, it using Oligo segment as template, has been synthesized by over-lap PCR reaction SgRNA double-stranded template is extracted and is separated by whole sgRNA double-stranded template, length 130bp, and the method through phenol chloroform extraction；Most Afterwards, sgRNA double-stranded template is transcribed in vitro with T7 in-vitro transcription kit, is produced transcription using the method for phenol chloroform extraction Object extracts separation, obtains sgRNA.Wherein, the Oligo fragment sequence comprising Mdr1a gene knockout target spot is 5 '- GATCACTAATACGACTCACTATAGGAGATAGCTTTGCAAATGTGTTTTAGAGCTAGAAAT-3'(SEQ ID NO.3)； Oligo fragment sequence comprising Mdr1b gene knockout target spot is 5 '-GATCACTAATACGACTCACTATAGGCCTCCTGATGC TGGTGTTGTTTTAGAGCTAGAAAT-3'(SEQ ID NO.4).Underscore area is target sequence.
The present invention also provides a kind of methods of micro- co-injection of sgRNA and Cas9 mRNA, wherein the sgRNA is The sgRNA of Mdr1a and Mdr1b gene, the concentration of sgRNA, Cas9mRNA of sgRNA, Mdr1b gene of the Mdr1a gene Than for 1-2:1-2:1-2；It preferably, is 1:1:2；If the sgRNA concentration of Mdr1a and Mdr1b gene is 25ng/mL, Cas9 MRNA concentration is 50ng/mL.
Wherein, two kinds of sgRNA after being mixed with Cas9 mRNA three each fertilized eggs inject 0.1 μ L-0.2 μ L.
The present invention also provides a kind of primer sequence of sequence near amplification Mdr1a gene target, upstream primer sequence is 5 '-GGGAAATACTCACCATCCAA-3 ' (SEQ ID NO.5), downstream primer sequence 5 '- AGCCTCCACTACATAGACCACT-3 ' (SEQ ID NO.6), PCR product length are 795bp.
The present invention also provides a kind of primer sequence of sequence near amplification Mdr1b gene target, upstream primer sequence is 5 '-TGTTTCTCCTCAGTGGTTGTAG-3 ' (SEQ ID NO.7), downstream primer sequence 5 '- CACCGCCTTTCACAGCACAA-3 ' (SEQ ID NO.8), PCR product length are 969bp.
The present invention also provides a kind of PCR amplification method of sequence near Mdr1a gene target, upstream primer sequence is SEQ ID NO.5, downstream primer sequence are SEQ ID NO.6, and PCR product length is 795bp, and annealing temperature is 56-64 DEG C, are followed Number of rings is 25-35；Preferably, annealing temperature is 62 DEG C, recurring number 30.
The present invention also provides a kind of PCR amplification method of sequence near Mdr1b gene target, upstream primer sequence is SEQ ID NO.7, downstream primer sequence are SEQ ID NO.8, and PCR product length is 969bp, and annealing temperature is 56-64 DEG C, are followed Number of rings is 25-35；Preferably, annealing temperature is 58 DEG C, recurring number 30.
It is selected potential the present invention also provides a kind of method of detection miss target phenomenon as caused by the sgRNA for Mdr1a Miss the target site and the primer specifying information it is as follows:
It is selected potential the present invention also provides a kind of method of detection miss target phenomenon as caused by the sgRNA for Mdr1b Miss the target site and the primer specifying information it is as follows:
The present invention provides a kind of method of dual-gene knockout of Mdr1a/1b based on CRISPR/Cas9 technology for the first time, and will Its building for being applied to knockout rat model, the advantage is that:
(1) CRISPR/Cas9 technology is as third generation gene editing technology, compared with ZFN and TALEN technology, have at This low, easy to operate, targeting advantage with high accuracy, may be implemented polygenes while knocking out, and almost without species limitation.
(2) compared with mouse, rat volume is big, blood volume is big, more convenient carry out experimental study；In addition, ncbi database In data show that, either in genomic level, mRNA level in-site or protein level, the similitude of the P-gp of rat and people are more It is high.Therefore, in carrying out the experimental study in relation to P-gp, rat model more has application value than mouse model.
(3) method of the dual-gene knockout of Mdr1a/1b proposed by the present invention, can be used for constructing Mdr1a/1b gene knockout Rat model provides new animal model to study the transhipment of function such as mediate drug of P-g.
(4) present invention for the first time using CRISPR/Cas9 technology carry out P of Rats-gp gene knockout, by Mdr1a with Mdr1b shot design, sgRNA are synthesized in vitro with transcription, the preparation of false pregnancy mouse, the external microinjection of fertilized eggs and embryo transfer etc. Process has obtained F0 for Chi-meric mice, breeds and screens using two generations, has finally obtained the homozygote of the dual-gene knockout of Mdr1a/1b Rat.It is verified through T7EI endonuclease, miss target phenomenon does not occur in obtained knockout rat.
Detailed description of the invention
Fig. 1 F0 is identified for rat gene type.(A) 1-15# rat Mdr1a gene amplification product agarose gel electrophoresis knot Fruit.The leftmost side is DNA Marker, and arrow meaning is the band for having mutation.Wherein, there are double bands in 7#, 10#, and 11# only has One small band, remaining 12 are normal single slice.(B) 1-15# rat Mdr1a gene amplification product is after T7EI enzymatic treatment Agarose gel electrophoresis results.The leftmost side is DNA Marker, and arrow indicates the band of mutation.Wherein, 1#, 2#, 3#, 5#, There are double bands in 6#, 7#, 9#, 10#, 13#, and 11# only has a small band, and 4#, 8#, 12#, 14#, 15# are normal single slice.
Fig. 2 F2 is for rat Mdr1a genotype identification.(A) F2 is for WT, HZ, KO rat Mdr1a gene sequencing peak figure.Each It is unimodal to represent a base.The peak figure of WT and KO rat be it is single, the peak figure of HZ rat is all from after base deletion site Cover peak.(B) F2 is for HZ and KO rat Mdr1a gene base deletion situation.Underscore area is target sequence.
Fig. 3 F2 is for rat Mdr1b genotype identification.(A) F2 is for WT, HZ, KO rat Mdr1b gene sequencing peak figure.Each It is unimodal to represent a base.The peak figure of WT and KO rat be it is single, the peak figure of HZ rat is all from after base deletion site Cover peak.(B) F2 is for HZ and KO rat Mdr1b gene base deletion situation.Underscore area is target sequence.
The detection of Fig. 4 Mdr1a/1b KO rat undershooting-effect.PCR amplification, amplified production are carried out by template of genomic DNA It is single through T7EI enzymatic treatment rear electrophoresis band.
Specific embodiment
In conjunction with following specific embodiments and attached drawing, the present invention is described in further detail.Implement process of the invention, Condition, experimental method etc. are among the general principles and common general knowledge in the art, this hair in addition to what is specifically mentioned below It is bright that there are no special restrictions to content.
The selection of embodiment 1Mdr1a and Mdr1b target spot
Found respectively in ncbi database rat (Rattus norvegicus (Norway rat)) Mdr1a and Mdr1b gene order, then finds the initiation codon and terminator codon of gene, and marks exon region.Due to The first two exon sequence of Mdr1a and Mdr1b gene is shorter (base number is less than 70bp), therefore target spot is selected in third On exon.The successive Input Online target spot of the third exon sequence of two genes is predicted into website, obtaining two length is The target spot of 18bp.
Wherein, online target spot prediction website is http://zifit.partners.org/ZiFiT/ ChoiceMenu.aspx；Mdr1a gene target sequence is 5 '-AGATAGCTTTGCAAATGT-3 ' (SEQ ID NO.1)； Mdr1b gene target sequence is 5 '-CCTCCTGATGCTGGTGTT-3 ' (SEQ ID NO.2).
The synthesis and extraction of embodiment 2sgRNA
Firstly, the Oligo segment that one segment length of synthesis is 60bp, including the sequence for knocking out target spot and T7 promoter； Then, it using Oligo segment as template, is reacted by over-lap PCR and synthesizes complete sgRNA double-stranded template, length 130bp, and SgRNA double-stranded template is extracted and is separated by the method through phenol chloroform extraction；Finally, with T7 in-vitro transcription kit by sgRNA double-strand Template is transcribed in vitro, and is extracted transcription product using the method for phenol chloroform extraction and is separated, obtains sgRNA.
Wherein, the Oligo fragment sequence comprising Mdr1a gene knockout target spot is 5 '-GATCACTAATACGACTCACTATA GGAGATAGCTTTGCAAATGTGTTTTAGAGCTAGAAAT-3'(SEQ ID NO.3)；Include Mdr1b gene knockout target spot Oligo fragment sequence is 5 '-GATCACTAATACGACTCACTATAGGCCTCCTGATGCTGGTGTTGTTTTAGAGCTAGAAA T-3'(SEQ ID NO.4).Underscore area is target sequence.
Embodiment 3sgRNA and Cas9 mRNA co-injection and embryo transfer
(1) preparation of false pregnancy mouse.The male SD rat for choosing stalwartness, 8 week old or more carries out sterilization operation, then chooses Healthy and strong, 7-8 week old female sd inbred rats mate with above-mentioned sterilization hero mouse.The female mice of post-coitum can show the sign of gestation, As required false pregnancy mouse.
(2) collection and microinjection of fertilized eggs.Healthy and strong, 6-7 week old female sd inbred rats are chosen to carry out at super ovulation Then reason mates it with healthy and strong, normal reproduction male rat.It mates next day, female mice is put to death, takes fertilized eggs standby With.Before microinjection, first by the fertilized eggs of collection in embryo culture medium in 37 DEG C of CO23-4h is cultivated in incubator, then will SgRNA and the Cas9 mRNA of Mdr1a, Mdr1b mix latter with being injected into the endochylema of fertilized eggs.Wherein, two kinds of sgRNA are dense Degree is 25ng/mL, and Cas9 mRNA concentration is 50ng/mL.
(3) embryo transfer.Fertilized eggs after microinjection are placed on overnight incubation in cell incubator, it then will be slender Blastula tire is transplanted to the fallopian tubal of false pregnancy mouse, finally puts into cage false pregnancy mouse and normally raises.
Embodiment 4F0 is identified for rat gene type
(1) F0 is extracted for rat gene group.The latter all left and right toes of rat birth separate, at this time by F0 for rat carry out with Machine number and then the corresponding toe of clip, and toe is collected into the 1.5mL centrifuge tube marked, phenol chloroform extraction gene Group is spare.
(2) design and verifying of primer.It is about 1000bp in the target spot of Mdr1a and Mdr1b gene length selected around The sequence inputting Primer Premier software of (target spot upstream and downstream respectively about 500bp) selects software prediction to go out preferable Primer is synthesized.Primer synthesis after first with its expand wild-type rats genome, and 54 DEG C of simultaneous selection, 56 DEG C, 58 DEG C, 60 DEG C, 62 DEG C, 64 DEG C of several annealing temperatures.Product after amplification is subjected to agarose gel electrophoresis, different primers are compared in analysis And the band brightness of different annealing temperature, final choice band become clear single primer for subsequent experimental.Wherein, Mdr1a Upstream region of gene primer sequence is 5 '-GGGAAATACTCACCATCCAA-3 ' (SEQ ID NO.5), downstream primer sequence 5 '- AGCCTCCACTACATAGACCACT-3 ' (SEQ ID NO.6), PCR product length are 795bp, and optimum annealing temperature is 62 DEG C； Mdr1b upstream region of gene primer sequence is 5 '-TGTTTCTCCTCAGTGGTTGTAG-3 ' (SEQ ID NO.7), downstream primer sequence For 5 '-CACCGCCTTTCACAGCACAA-3 ' (SEQ ID NO.8), PCR product length is 969bp, optimum annealing temperature 58 ℃。
(3) amplification F0 is for rat gene group and agarose gel electrophoresis.With the above-mentioned primer amplification F0 verified for rat Mdr1a gene in genome, reaction system are 20 μ L, and recurring number 30, annealing temperature is 62 DEG C.Prepare 1.5% (w/v's) Ago-Gel is taken 10 μ L PCR products to carry out agarose gel electrophoresis, and is taken pictures using full automatic gel Image analysis system, As a result as shown in Fig. 1 (A).Since target spot is between upstream and downstream primer, when large fragment insertion nearby occurs in target spot or lacks prominent When change, correspondingly, it will appear the big or small new band of band than expected after agarose gel electrophoresis.Wherein 7#, 10#, 11# All there is the band that length (795bp) is short than expected in the electrophoresis result of F0, illustrates the alkali of large fragment occur in this 3 rats Base missing, causes PCR product short than expected.The PCR product length of remaining 12 rat is substantially consistent with expected product length, There may be two kinds of situations, a kind of situation is rat gene group there is no any variation, another situation is that base insertion or The number of missing is very little, can not be detected by way of agarose gel electrophoresis.
(4) PCR product digestion and agarose gel electrophoresis.10 μ L PCR product remaining in (3) is subjected to Gradient annealing, Then, T7EI endonuclease, and the digestion 30min in 37 DEG C of constant incubators is added.Prepare the agarose of 1.5% (w/v) Digestion products are carried out agarose gel electrophoresis by gel, taken pictures using full automatic gel Image analysis system and with before digestion Agarose gel electrophoresis results compare, as a result as shown in Fig. 1 (B).T7EI endonuclease can identify and mismatch cleavag Heteroduplex handled after PCR product annealing by T7EI digestion, if F0 occurs being inserted into for rat or deletion mutation in fine jade It will appear multi-ribbon when sepharose electrophoresis.There are double bands in 1#, 2#, 3#, 5#, 6#, 7#, 9#, 10#, 13#, illustrate to send out The insertion or missing of base are given birth to.11# only has the short band of length (795bp) than expected, it may be possible to long segment have occurred Base deletion, but PCR amplification is based on the product of this deletion form, cannot form heteroduplex in annealing, thus through T7EI enzymatic treatment rear electrophoresis still only has a band.4#, 8#, 12#, 14#, 15# electrophoresis result only have a band, illustrate that it is WT。
(5) PCR product recovery purifying.10 F0 for being likely to occur the insertion of Mdr1a gene or deletion mutation are chosen for rat (1#, 2#, 3#, 5#, 6#, 7#, 9#, 10#, 11#, 13#) expands Mdr1a and Mdr1b gene target sequence nearby, then prepares The Ago-Gel of 1.5% (w/v), by PCR product under 120V voltage electrophoresis about 30min, until band between boundary it is clear Chu.Gel is placed in uv analyzer, bright band is cut with blade, is put into 1.5mL centrifuge tube, with Ago-Gel DNA QIAquick Gel Extraction Kit extracts DNA therein.DNA solution after purification is subjected to concentration mensuration, it is standby to be then stored in -20 DEG C of refrigerators With.
(6) PCR product connection carrier expands culture.PCR product after purification is connected to pMD18-T carrier, is then passed through It crosses and is transferred to Trans5 α competent cell, then competent cell is coated onto ammonia benzyl resistance LB solid medium tablets and is carried out 37 DEG C of overnight incubations.
Ammonia benzyl resistance LB liquid medium is prepared, then needs for culture medium to be dispensed into according to experiment in superclean bench In a certain number of test tubes (every pipe about 5mL culture medium).The selection single colonie that size is suitable, shape is mellow and full, with pipette tips picking After squeeze into test tube, the lid of test tube is outstanding tight, then test tube is put into constant-temperature table (37 DEG C, 220rpm) overnight.Wherein, 5 monoclonal colonies of each plate picking.
(7) plasmid is extracted and is sequenced.According to the requirement of the small extraction reagent kit of plasmid, the plasmid in bacterium solution is extracted, into Sequencing company is sent to be sequenced after row concentration mensuration.By sequencing company return sequencing result and ncbi database in Mdr1a and The sequence of Mdr1b gene compares, and determines the gene mutation situation of every rat.And if only if alkali of the generation on exon The available mutation of the integral multiple that base insertion or missing number are non-3 sported in gene knockout, for Mdr1a gene, institute Surveying 10 F0 rats, all carrying can use mutation；For Mdr1b gene, only 2#, 5#, 6#, 7#, 9#, 10#F0 take for rat Band can use mutation.Remaining rat can be eliminated with the F0 of mutation for rat by leaving while carrying Mdr1a/1b.
Embodiment 5F0 is identified for rat breeding with F1 generation rat gene type
(1) breeding of the F0 for rat.When F0 for Growth in Rats to 8 week old when, will carry Mdr1a/1b simultaneously can use mutation F0 mated for rat and the wild-type rats of 8 week old or so.(below by taking 2#F0 and WT rat are mated as an example)
(2) F1 generation rat gene type is identified.Theoretically, at most there is a kind of mutation class in each gene of every F1 generation rat Type, therefore its genomic DNA can be directly sequenced after PCR amplification.PCR amplification purpose after F1 generation rat gene group is extracted Amplified production is sent company to be sequenced by genetic fragment.The gene sequence in sequencing result and ncbi database that sequencing company is returned Column compare, and determine the gene mutation situation of every rat.Generally speaking, F1 generation will appear four kinds of different genotype, i.e., Wild type, the Mdr1a (+/-) for only carrying Mdr1a gene mutation, the Mdr1b (+/-) for only carrying Mdr1b gene mutation and same When carry Mdr1a and Mdr1b gene mutation Mdr1a (+/-)/1b (+/-).Leaving behind carrying Mdr1a/1b can be big with what is be mutated Mouse eliminates remaining rat.
Embodiment 6F1 is bred for rat and F2 is identified for rat gene type
(1) F1 generation rat breeds.After F1 generation Growth in Rats to 8 week old, it is identical female great and mighty or powerful to select gene mutation situation Mouse is mated.
(2) F2 is identified for rat gene type.According to the law of independent assortment of gene, F2 will appear three kinds of genes for rat Type, i.e. wild type (Wild type, WT), heterozygous (Heterozygous type, HZ), homozygous mutant (Homozygous type).Wherein, homozygous mutant is gene knockout type (Knock out, KO).PCR expands after F2 is extracted for rat gene group Increase target gene fragment, send company to be sequenced amplified production.Sequencing result is analyzed, Fig. 2 is the qualification result of Mdr1a gene, Fig. 3 For the qualification result of Mdr1b gene.In figure 2 and figure 3, (A) figure is sequencing peak figure, and (B) figure is specific base deletion situation.? (A) in figure, WT and KO P of Rats CR product only has one kind, and available single peak figure is sequenced；There are two types of HZ P of Rats CR products, Set peak is all shown as when sequencing after the position of mutation.
The detection of embodiment 7KO rat undershooting-effect
(1) selection in potential site of missing the target is synthesized with primer.Find (Off-target) effect forecast website of missing the target (http://cas9.wicp.net/) inputs the knockout target sequence of Mdr1a and Mdr1b, can obtain simultaneously it is multiple have it is latent In the site for missing the target possibility.Selection misses the target the biggish several sites of possibility using Primer Premier primer-design software Design corresponding primer, then 50 DEG C of simultaneous selection, 53 DEG C, 56 DEG C, 59 DEG C, 62 DEG C, 65 DEG C of several annealing temperatures expand WT The genome of rat selects suitable primer and its optimum annealing temperature according to the result of PCR product agarose gel electrophoresis, And it is used for the verifying of KO rat.
Wherein, Mdr1a target spot and selected potential site of missing the target are as follows:
It is as follows according to primer specifying information designed by the sequence in above-mentioned potential site of missing the target:
Wherein, Mdr1b target spot and selected potential site of missing the target are as follows:
It is as follows according to primer specifying information designed by the sequence in above-mentioned potential site of missing the target:
(2) PCR amplification target gene and T7EI digestion verification.3 KO rats are selected at random, potential are missed the target with designed The primer amplification target fragment in site, reaction system are 20 μ L, recurring number 30.Amplified production is taken out into 10 μ L, Gradient annealing After carry out endonuclease reaction.The Ago-Gel for preparing 1.5% is added on 6 × DNA into the PCR product before and after T7EI enzymatic treatment Sample buffer takes 8 μ L point samples after mixing, then 120V electrophoresis 30min is taken pictures using full automatic gel Image analysis system, knot Fruit is as shown in Figure 4.The agarose gel electrophoresis results before and after digestion are compared, occur illustrating if double bands after T7EI enzymatic treatment de- The presence of target phenomenon.It can be seen from the figure that by T7EI enzymatic treatment, the electrophoretic band of all PCR products is single and size one It causes, illustrating Mdr1a/1b KO rat, all there is no miss target phenomenons in all of above site.
Protection content of the invention is not limited to above embodiments.Without departing from the spirit and scope of the invention, originally Field technical staff it is conceivable that variation and advantage be all included in the present invention, and with appended claims be protect Protect range.
SEQUENCE LISTING
<110>East China Normal University
<120>method and application of a kind of dual-gene knockout of Mdr1a/1b
<160> 44
<170> PatentIn version 3.3
<210> 1
<211> 18
<212> DNA
<213>artificial sequence
<400> 1
agatagcttt gcaaatgt 18
<210> 2
<211> 18
<212> DNA
<213>artificial sequence
<400> 2
cctcctgatg ctggtgtt 18
<210> 3
<211> 60
<212> DNA
<213>artificial sequence
<400> 3
gatcactaat acgactcact ataggagata gctttgcaaa tgtgttttag agctagaaat 60
<210> 4
<211> 60
<212> DNA
<213>artificial sequence
<400> 4
gatcactaat acgactcact ataggcctcc tgatgctggt gttgttttag agctagaaat 60
<210> 5
<211> 20
<212> DNA
<213>artificial sequence
<400> 5
gggaaatact caccatccaa 20
<210> 6
<211> 22
<212> DNA
<213>artificial sequence
<400> 6
agcctccact acatagacca ct 22
<210> 7
<211> 22
<212> DNA
<213>artificial sequence
<400> 7
tgtttctcct cagtggttgt ag 22
<210> 8
<211> 20
<212> DNA
<213>artificial sequence
<400> 8
caccgccttt cacagcacaa 20
<210> 9
<211> 21
<212> DNA
<213>artificial sequence
<400> 9
agatagcttt gcaaatgtag g 21
<210> 10
<211> 19
<212> DNA
<213>artificial sequence
<400> 10
atagctatgc aaatgtagg 19
<210> 11
<211> 21
<212> DNA
<213>artificial sequence
<400> 11
agatatattt gcaaatgttg g 21
<210> 12
<211> 21
<212> DNA
<213>artificial sequence
<400> 12
agatagatct gcaaatgtag g 21
<210> 13
<211> 21
<212> DNA
<213>artificial sequence
<400> 13
agaatgcttt gcaaatgttg g 21
<210> 14
<211> 20
<212> DNA
<213>artificial sequence
<400> 14
ggtcaaggct ttactcatat 20
<210> 15
<211> 20
<212> DNA
<213>artificial sequence
<400> 15
tgtaggacta taagtggtgc 20
<210> 16
<211> 20
<212> DNA
<213>artificial sequence
<400> 16
aaacaagaac ttagccacag 20
<210> 17
<211> 20
<212> DNA
<213>artificial sequence
<400> 17
gtatccctta caaagcaaca 20
<210> 18
<211> 20
<212> DNA
<213>artificial sequence
<400> 18
cttgggaagc atagcagaca 20
<210> 19
<211> 20
<212> DNA
<213>artificial sequence
<400> 19
ccatattcta aggcccatct 20
<210> 20
<211> 20
<212> DNA
<213>artificial sequence
<400> 20
ggcgtacaaa gtgacaagat 20
<210> 21
<211> 22
<212> DNA
<213>artificial sequence
<400> 21
tcaaaggaat gaagactgaa at 22
<210> 22
<211> 21
<212> DNA
<213>artificial sequence
<400> 22
cctcctgatg ctggtgttcg g 21
<210> 23
<211> 21
<212> DNA
<213>artificial sequence
<400> 23
cctcctgacg ctggtgttag g 21
<210> 24
<211> 20
<212> DNA
<213>artificial sequence
<400> 24
ctcctgctgc tggtgttggg 20
<210> 25
<211> 21
<212> DNA
<213>artificial sequence
<400> 25
ccccctgaag ctggtgttgg g 21
<210> 26
<211> 19
<212> DNA
<213>artificial sequence
<400> 26
tcctgttgct ggtgtttgg 19
<210> 27
<211> 19
<212> DNA
<213>artificial sequence
<400> 27
tcctggtgct ggtgtttgg 19
<210> 28
<211> 19
<212> DNA
<213>artificial sequence
<400> 28
tcctgaagct ggtgttggg 19
<210> 29
<211> 19
<212> DNA
<213>artificial sequence
<400> 29
tcctgaggct ggtgttagg 19
<210> 30
<211> 24
<212> DNA
<213>artificial sequence
<400> 30
tcaaatccac agtgatctgc ctac 24
<210> 31
<211> 20
<212> DNA
<213>artificial sequence
<400> 31
aaacgcttcc gactggtgct 20
<210> 32
<211> 21
<212> DNA
<213>artificial sequence
<400> 32
ttctgcctgg tcaaagagtg g 21
<210> 33
<211> 22
<212> DNA
<213>artificial sequence
<400> 33
aactgccttc ttgtgcttgc tt 22
<210> 34
<211> 20
<212> DNA
<213>artificial sequence
<400> 34
aagggaagat accgttctgg 20
<210> 35
<211> 20
<212> DNA
<213>artificial sequence
<400> 35
ctgagccatt gatccccact 20
<210> 36
<211> 20
<212> DNA
<213>artificial sequence
<400> 36
ggggctgtcc ctgtttatcc 20
<210> 37
<211> 21
<212> DNA
<213>artificial sequence
<400> 37
ccctcctgtg agtgccttta c 21
<210> 38
<211> 20
<212> DNA
<213>artificial sequence
<400> 38
tttgcccatt gcagcaactt 20
<210> 39
<211> 24
<212> DNA
<213>artificial sequence
<400> 39
ccccaggaag gaacgtaata agag 24
<210> 40
<211> 21
<212> DNA
<213>artificial sequence
<400> 40
agtggtcttt ggctagagtg g 21
<210> 41
<211> 20
<212> DNA
<213>artificial sequence
<400> 41
tgtggtcctg gctatgatgc 20
<210> 42
<211> 21
<212> DNA
<213>artificial sequence
<400> 42
gggagcatgt gcccactatc c 21
<210> 43
<211> 20
<212> DNA
<213>artificial sequence
<400> 43
agaaccaccg aaggcagaca 20
<210> 44
<211> 4269
<212> RNA
<213>artificial sequence
<400> 44
auggacuaua aggaccacga cggagacuac aaggaucaug auauugauua caaagacgau 60
gacgauaaga uggccccaaa gaagaagcgg aaggucggua uccacggagu cccagcagcc 120
gacaagaagu acagcaucgg ccuggacauc ggcaccaacu cugugggcug ggccgugauc 180
accgacgagu acaaggugcc cagcaagaaa uucaaggugc ugggcaacac cgaccggcac 240
agcaucaaga agaaccugau cggagcccug cuguucgaca gcggcgaaac agccgaggcc 300
acccggcuga agagaaccgc cagaagaaga uacaccagac ggaagaaccg gaucugcuau 360
cugcaagaga ucuucagcaa cgagauggcc aagguggacg acagcuucuu ccacagacug 420
gaagaguccu uccuggugga agaggauaag aagcacgagc ggcaccccau cuucggcaac 480
aucguggacg agguggccua ccacgagaag uaccccacca ucuaccaccu gagaaagaaa 540
cugguggaca gcaccgacaa ggccgaccug cggcugaucu aucuggcccu ggcccacaug 600
aucaaguucc ggggccacuu ccugaucgag ggcgaccuga accccgacaa cagcgacgug 660
gacaagcugu ucauccagcu ggugcagacc uacaaccagc uguucgagga aaaccccauc 720
aacgccagcg gcguggacgc caaggccauc cugucugcca gacugagcaa gagcagacgg 780
cuggaaaauc ugaucgccca gcugcccggc gagaagaaga auggccuguu cggaaaccug 840
auugcccuga gccugggccu gacccccaac uucaagagca acuucgaccu ggccgaggau 900
gccaaacugc agcugagcaa ggacaccuac gacgacgacc uggacaaccu gcuggcccag 960
aucggcgacc aguacgccga ccuguuucug gccgccaaga accuguccga cgccauccug 1020
cugagcgaca uccugagagu gaacaccgag aucaccaagg ccccccugag cgccucuaug 1080
aucaagagau acgacgagca ccaccaggac cugacccugc ugaaagcucu cgugcggcag 1140
cagcugccug agaaguacaa agagauuuuc uucgaccaga gcaagaacgg cuacgccggc 1200
uacauugacg gcggagccag ccaggaagag uucuacaagu ucaucaagcc cauccuggaa 1260
aagauggacg gcaccgagga acugcucgug aagcugaaca gagaggaccu gcugcggaag 1320
cagcggaccu ucgacaacgg cagcaucccc caccagaucc accugggaga gcugcacgcc 1380
auucugcggc ggcaggaaga uuuuuaccca uuccugaagg acaaccggga aaagaucgag 1440
aagauccuga ccuuccgcau ccccuacuac gugggcccuc uggccagggg aaacagcaga 1500
uucgccugga ugaccagaaa gagcgaggaa accaucaccc ccuggaacuu cgaggaagug 1560
guggacaagg gcgcuuccgc ccagagcuuc aucgagcgga ugaccaacuu cgauaagaac 1620
cugcccaacg agaaggugcu gcccaagcac agccugcugu acgaguacuu caccguguau 1680
aacgagcuga ccaaagugaa auacgugacc gagggaauga gaaagcccgc cuuccugagc 1740
ggcgagcaga aaaaggccau cguggaccug cuguucaaga ccaaccggaa agugaccgug 1800
aagcagcuga aagaggacua cuucaagaaa aucgagugcu ucgacuccgu ggaaaucucc 1860
ggcguggaag aucgguucaa cgccucccug ggcacauacc acgaucugcu gaaaauuauc 1920
aaggacaagg acuuccugga caaugaggaa aacgaggaca uucuggaaga uaucgugcug 1980
acccugacac uguuugagga cagagagaug aucgaggaac ggcugaaaac cuaugcccac 2040
cuguucgacg acaaagugau gaagcagcug aagcggcgga gauacaccgg cuggggcagg 2100
cugagccgga agcugaucaa cggcauccgg gacaagcagu ccggcaagac aauccuggau 2160
uuccugaagu ccgacggcuu cgccaacaga aacuucaugc agcugaucca cgacgacagc 2220
cugaccuuua aagaggacau ccagaaagcc cagguguccg gccagggcga uagccugcac 2280
gagcacauug ccaaucuggc cggcagcccc gccauuaaga agggcauccu gcagacagug 2340
aagguggugg acgagcucgu gaaagugaug ggccggcaca agcccgagaa caucgugauc 2400
gaaauggcca gagagaacca gaccacccag aagggacaga agaacagccg cgagagaaug 2460
aagcggaucg aagagggcau caaagagcug ggcagccaga uccugaaaga acaccccgug 2520
gaaaacaccc agcugcagaa cgagaagcug uaccuguacu accugcagaa ugggcgggau 2580
auguacgugg accaggaacu ggacaucaac cggcuguccg acuacgaugu ggaccauauc 2640
gugccucaga gcuuucugaa ggacgacucc aucgacaaca aggugcugac cagaagcgac 2700
aagaaccggg gcaagagcga caacgugccc uccgaagagg ucgugaagaa gaugaagaac 2760
uacuggcggc agcugcugaa cgccaagcug auuacccaga gaaaguucga caaucugacc 2820
aaggccgaga gaggcggccu gagcgaacug gauaaggccg gcuucaucaa gagacagcug 2880
guggaaaccc ggcagaucac aaagcacgug gcacagaucc uggacucccg gaugaacacu 2940
aaguacgacg agaaugacaa gcugauccgg gaagugaaag ugaucacccu gaaguccaag 3000
cugguguccg auuuccggaa ggauuuccag uuuuacaaag ugcgcgagau caacaacuac 3060
caccacgccc acgacgccua ccugaacgcc gucgugggaa ccgcccugau caaaaaguac 3120
ccuaagcugg aaagcgaguu cguguacggc gacuacaagg uguacgacgu gcggaagaug 3180
aucgccaaga gcgagcagga aaucggcaag gcuaccgcca aguacuucuu cuacagcaac 3240
aucaugaacu uuuucaagac cgagauuacc cuggccaacg gcgagauccg gaagcggccu 3300
cugaucgaga caaacggcga aaccggggag aucguguggg auaagggccg ggauuuugcc 3360
accgugcgga aagugcugag caugccccaa gugaauaucg ugaaaaagac cgaggugcag 3420
acaggcggcu ucagcaaaga gucuauccug cccaagagga acagcgauaa gcugaucgcc 3480
agaaagaagg acugggaccc uaagaaguac ggcggcuucg acagccccac cguggccuau 3540
ucugugcugg ugguggccaa aguggaaaag ggcaagucca agaaacugaa gagugugaaa 3600
gagcugcugg ggaucaccau cauggaaaga agcagcuucg agaagaaucc caucgacuuu 3660
cuggaagcca agggcuacaa agaagugaaa aaggaccuga ucaucaagcu gccuaaguac 3720
ucccuguucg agcuggaaaa cggccggaag agaaugcugg ccucugccgg cgaacugcag 3780
aagggaaacg aacuggcccu gcccuccaaa uaugugaacu uccuguaccu ggccagccac 3840
uaugagaagc ugaagggcuc ccccgaggau aaugagcaga aacagcuguu uguggaacag 3900
cacaagcacu accuggacga gaucaucgag cagaucagcg aguucuccaa gagagugauc 3960
cuggccgacg cuaaucugga caaagugcug uccgccuaca acaagcaccg ggauaagccc 4020
aucagagagc aggccgagaa uaucauccac cuguuuaccc ugaccaaucu gggagccccu 4080
gccgccuuca aguacuuuga caccaccauc gaccggaaga gguacaccag caccaaagag 4140
gugcuggacg ccacccugau ccaccagagc aucaccggcc uguacgagac acggaucgac 4200
cugucucagc ugggaggcga caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa 4260
aagaaaaag 4269

Claims (16)

1. a kind of method of the dual-gene knockout of Mdr1a/1b, which is characterized in that the described method comprises the following steps:
(1) selection of Mdr1a and Mdr1b target spot；
Target spot is knocked out using online target spot prediction website selection Mdr1a and Mdr1b；
(2) synthesis and extraction of sgRNA；
The Oligo segment that a segment length is 60bp is synthesized first, including the sequence for knocking out target spot and T7 promoter；Then, Using Oligo segment as template, is reacted by over-lap PCR and synthesize complete sgRNA double-stranded template, length 130bp, and through phenol chlorine The imitative method extracted, which extracts sgRNA double-stranded template, to be separated；Finally, with T7 in-vitro transcription kit by sgRNA double-stranded template into Row is transcribed in vitro, and transcription product is extracted and is separated, the sgRNA of Mdr1a and Mdr1b gene is obtained；
(3) sgRNA and Cas9mRNA co-injection and embryo transfer；
Two kinds of sgRNA and the micro- co-injection of Cas9mRNA are entered in rat fertilized eggs endochylema；Wherein, the sgRNA be Mdr1a and The sgRNA of Mdr1b gene；
(4) F0 is for genotype identification；
F0 is extracted for rat genomic dna, and design primer expands Mdr1a and Mdr1b gene target sequence nearby, connection respectively Carrier is sequenced, and identifies gene mutation situation；
(5) breeding of F0 generation and F1 generation genotype identification；
Mdr1a/1b will be carried simultaneously to be mated with the F0 of mutation generation with wild type, PCR amplification after F1 generation genome is extracted Sequence near Mdr1a and Mdr1b gene target, is sequenced；
(6) F1 generation breeding and F2 are for genotype identification；
Mdr1a/1b, which will be carried, to be mated with the F1 generation male and female individual of mutation, F2 generation be obtained, after F2 is extracted for genome Sequence near PCR amplification Mdr1a and Mdr1b gene target, obtains the individual of Mdr1a/1b gene knockout；
(7) undershooting-effect detects；
Website is predicted according to undershooting-effect, finds the biggish position of possibility of missing the target caused by the sgRNA for Mdr1a or Mdr1b Point, design primer verify whether these sites mutate.
2. the method as described in claim 1, which is characterized in that in step (1), wherein Mdr1a gene knockout target sequence is The 5 '-AGATAGCTTTGCAAATGT-3 ' as shown in SEQ ID NO.1；Mdr1b gene knockout target sequence is such as SEQ ID 5 '-CCTCCTGATGCTGGTGTT-3 ' shown in NO.2.
3. the method as described in claim 1, which is characterized in that comprising Mdr1a gene knockout target spot in step (1) Oligo fragment sequence is as shown in SEQ ID NO.3
5’-GATCACTAATACGACTCACTATAGGAGATAGCTTTGCAAATGTGTTTTAGAGCTAGAAAT-3'；Include The Oligo fragment sequence of Mdr1b gene knockout target spot is the 5 '-GATCACTAATACGACTCACTA as shown in SEQ ID NO.4 TAGGCCTCCTGATGCTGGTGTTGTTTTAGAGCTAGAAAT-3’。
4. the method as described in claim 1, which is characterized in that in step (3), sgRNA, Mdr1b base of the Mdr1a gene The concentration ratio of sgRNA, Cas9mRNA of cause are 1-2:1-2:1-2；Each fertilization after two kinds of sgRNA are mixed with Cas9mRNA three Ovum injects 0.1 μ L-0.2 μ L.
5. the method as described in claim 1, which is characterized in that in step (7), detect as caused by the sgRNA for Mdr1a When miss target phenomenon, selected potential site and the primer specifying information of missing the target are as follows: Mdr1a_off_1: upstream primer GGTCAAGGCTTTACTCATAT, downstream primer TGTAGGACTATAAGTGGTGC, product length=519bp, best annealing temperature =56 DEG C of degree；Mdr1a_off_2: upstream primer AAACAAGAACTTAGCCACAG, downstream primer GTATCCCTTACAAAGCAAC A, product length=472bp, optimum annealing temperature=56 DEG C；Mdr1a_off_3: upstream primer CTTGGGAAGCATAGCAGACA, downstream primer CCATATTCTAAGGCCCATCT, product length=501bp, best annealing temperature =56 DEG C of degree；Mdr1a_off_4: upstream primer GGCGTACAAAGTGACAAGAT, downstream primer TCAAAGGAATGAAGACTGAAAT, product length=503bp, optimum annealing temperature=53 DEG C.
6. the method as described in claim 1, which is characterized in that detect the miss target phenomenon as caused by the sgRNA for Mdr1b When, selected potential site and the primer specifying information of missing the target are as follows: Mdr1b_off_1: upstream primer TCAAATCCACAGTGATCTGCCTAC, downstream primer AAACGCTTCCGACTGGTGCT, product length=472bp most preferably move back Fiery temperature=59 DEG C；Mdr1b_off_2: upstream primer TTCTGCCTGGTCAAAGAGTGG, downstream primer AACTGCCTTCTTGTGCTTGCTT, product length=413bp, optimum annealing temperature=56 DEG C；
Mdr1b_off_3: upstream primer AAGGGAAGATACCGTTCTGG, downstream primer CTGAGCCATTGATCCCCACT are produced Object length=553bp, optimum annealing temperature=56 DEG C；Mdr1b_off_4: upstream primer GGGGCTGTCCCTGTTTATCC, under Swim primer CCCTCCTGTGAGTGCCTTTAC, product length=523bp, optimum annealing temperature=56 DEG C；Mdr1b_off_5: on Swim primer TTTGCCCATTGCAGCAACTT, downstream primer CCCCAGGAAGGAACGTAATAAGAG, product length=563bp, Optimum annealing temperature=56 DEG C；
Mdr1b_off_6: upstream primer AGTGGTCTTTGGCTAGAGTGG, downstream primer TGTGGTCCTGGCTATGATGC are produced Object length=495bp, optimum annealing temperature=56 DEG C；Mdr1b_off_7: upstream primer GGGAGCATGTGCCCACTATCC, under Swim primer AGAACCACCGAAGGCAGACA, product length=580bp, optimum annealing temperature=56 DEG C.
7. being used to construct Mdr1a/1b base for the method for the dual-gene knockout of described in any item Mdr1a/1b of claim 1~6 Because knocking out the application in rat model.
8. a kind of target sequence, which is characterized in that Mdr1a gene target sequence is 5 '-as shown in SEQ ID NO.1 AGATAGCTTTGCAAATGT-3'；Mdr1b gene target sequence is 5 '-as shown in SEQ ID NO.2 CCTCCTGATGCTGGTGTT-3’。
9. a kind of synthetic method of sgRNA, which is characterized in that the Oligo segment that a segment length is 60bp is synthesized first, wherein wrapping Include the sequence for knocking out target spot and T7 promoter；Then, complete by over-lap PCR reaction synthesis using Oligo segment as template SgRNA double-stranded template is extracted and is separated by sgRNA double-stranded template, length 130bp, and the method through phenol chloroform extraction；Finally, with SgRNA double-stranded template is transcribed in vitro T7 in-vitro transcription kit, is mentioned transcription product using the method for phenol chloroform extraction Separation is taken, sgRNA is obtained；Wherein, the Oligo fragment sequence comprising Mdr1a gene knockout target spot as shown in SEQ ID NO.3, For 5 '-GATCACTAATACGACTCACTATAGGAGATAGCTTTGCAAATGTGTTTTAGAGCTAGAAAT-3'；Include The Oligo fragment sequence of Mdr1b gene knockout target spot is 5 '-as shown in SEQ ID NO.4 GATCACTAATACGACTCACTATAGGCCTCCTGATGCTGGTGTTGTTTTAGAGCTAGAAAT-3’。
10. a kind of method of the micro- co-injection of sgRNA and Cas9mRNA, which is characterized in that the described method comprises the following steps:
(a) synthesis and extraction of sgRNA；
The Oligo segment that a segment length is 60bp is synthesized first, including the sequence for knocking out target spot and T7 promoter；Then, Using Oligo segment as template, is reacted by over-lap PCR and synthesize complete sgRNA double-stranded template, length 130bp, and through phenol chlorine The imitative method extracted, which extracts sgRNA double-stranded template, to be separated；Finally, with T7 in-vitro transcription kit by sgRNA double-stranded template into Row is transcribed in vitro, and transcription product is extracted and is separated, the sgRNA of Mdr1a and Mdr1b gene is obtained；
(b) sgRNA and Cas9mRNA co-injection and embryo transfer；
Two kinds of sgRNA and the micro- co-injection of Cas9mRNA are entered in rat fertilized eggs endochylema；Wherein, the sgRNA be Mdr1a and The sgRNA of Mdr1b gene；The sgRNA be Mdr1a and Mdr1b gene sgRNA, the sgRNA of the Mdr1a gene, The concentration ratio of sgRNA, Cas9mRNA of Mdr1b gene are 1-2:1-2:1-2；After two kinds of sgRNA are mixed with Cas9mRNA three Each fertilized eggs inject 0.1 μ L-0.2 μ L.
11. the primer sequence of sequence near a kind of amplification Mdr1a gene target, which is characterized in that upstream primer sequence is such as SEQ 5 '-GGGAAATACTCACCATCCAA-3 ' shown in ID NO.5, downstream primer sequence are 5 '-as shown in SEQ ID NO.6 AGCCTCCACTACATAGACCACT-3’。
12. the primer sequence of sequence near a kind of amplification Mdr1b gene target, which is characterized in that upstream primer sequence is such as SEQ 5 '-TGTTTCTCCTCAGTGGTTGTAG-3 ' shown in ID NO.7, downstream primer sequence are as shown in SEQ ID NO.8 5’-CACCGCCTTTCACAGCACAA-3’。
13. the PCR amplification method of sequence near a kind of Mdr1a gene target, which is characterized in that upstream primer sequence such as SEQ ID Shown in NO.5, downstream primer sequence is as shown in SEQ ID NO.6, and annealing temperature is 56-64 DEG C, recurring number 25-35.
14. the PCR amplification method of sequence near a kind of Mdr1b gene target, which is characterized in that upstream primer sequence such as SEQ ID Shown in NO.7, downstream primer sequence is as shown in SEQ ID NO.8, and annealing temperature is 56-64 DEG C, recurring number 25-35.
15. a kind of method of detection miss target phenomenon as caused by the sgRNA for Mdr1a, which is characterized in that selected potential to miss the target Site and the primer specifying information are as follows: Mdr1a_off_1: upstream primer GGTCAAGGCTTTACTCATAT, downstream primer TGTAGGACTATAAGTGGTGC, product length=519bp, optimum annealing temperature=56 DEG C；Mdr1a_off_2: upstream primer AAACAAGAACTTAGCCACAG, downstream primer GTATCCCTTACAAAGCAACA, product length=472bp, best annealing temperature =56 DEG C of degree；Mdr1a_off_3: upstream primer CTTGGGAAGCATAGCAGACA, downstream primer CCATATTCTAAGGCCCATC T, product length=501bp, optimum annealing temperature=56 DEG C；
Mdr1a_off_4: upstream primer GGCGTACAAAGTGACAAGAT, downstream primer TCAAAGGAATGAAGACTGAAAT, Product length=503bp, optimum annealing temperature=53 DEG C.
16. a kind of method of detection miss target phenomenon as caused by the sgRNA for Mdr1b, which is characterized in that selected potential to miss the target Site and the primer specifying information are as follows: Mdr1b_off_1: upstream primer TCAAATCCACAGTGATCTGCCTAC, downstream are drawn Object AAACGCTTCCGACTGGTGCT, product length=472bp, optimum annealing temperature=59 DEG C；
Mdr1b_off_2: upstream primer TTCTGCCTGGTCAAAGAGTGG, downstream primer AACTGCCTTCTTGTGCTTGCTT, Product length=413bp, optimum annealing temperature=56 DEG C；Mdr1b_off_3: upstream primer AAGGGAAGATACCGTTCTGG, Downstream primer CTGAGCCATTGATCCCCACT, product length=553bp, optimum annealing temperature=56 DEG C；Mdr1b_off_4: Upstream primer GGGGCTGTCCCTGTTTATCC, downstream primer CCCTCCTGTGAGTGCCTTTAC, product length=523bp, most Good annealing temperature=56 DEG C；
Mdr1b_off_5: upstream primer TTTGCCCATTGCAGCAACTT, downstream primer CCCCAGGAAGGAACGTAATAAGAG, Product length=563bp, optimum annealing temperature=56 DEG C；Mdr1b_off_6: upstream primer AGTGGTCTTTGGCTAGAGTGG, Downstream primer TGTGGTCCTGGCTATGATGC, product length=495bp, optimum annealing temperature=56 DEG C；Mdr1b_off_7: Upstream primer GGGAGCATGTGCCCACTATCC, downstream primer AGAACCACCGAAGGCAGACA, product length=580bp, most Good annealing temperature=56 DEG C.
CN201710771262.1A 2017-08-31 2017-08-31 Mdr1a/1b double-gene knockout method and application Active CN109423500B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710771262.1A CN109423500B (en) 2017-08-31 2017-08-31 Mdr1a/1b double-gene knockout method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710771262.1A CN109423500B (en) 2017-08-31 2017-08-31 Mdr1a/1b double-gene knockout method and application

Publications (2)

Publication Number Publication Date
CN109423500A true CN109423500A (en) 2019-03-05
CN109423500B CN109423500B (en) 2022-07-08

Family

ID=65505222

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710771262.1A Active CN109423500B (en) 2017-08-31 2017-08-31 Mdr1a/1b double-gene knockout method and application

Country Status (1)

Country Link
CN (1) CN109423500B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106148416A (en) * 2015-03-24 2016-11-23 华东师范大学 The breeding method of Cyp knockout rat and the preparation method of hepatomicrosome thereof
CN106755115A (en) * 2017-02-06 2017-05-31 南方医科大学 A kind of construction method of immunodeficient rats model

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106148416A (en) * 2015-03-24 2016-11-23 华东师范大学 The breeding method of Cyp knockout rat and the preparation method of hepatomicrosome thereof
CN106755115A (en) * 2017-02-06 2017-05-31 南方医科大学 A kind of construction method of immunodeficient rats model

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CHENMEIZI LIANG等: "Development and Characterization of MDR1 (Mdr1a/b) CRISPR/Cas9 Knockout Rat Model", 《DRUG METABOLISM AND DISPOSITION》 *
GEYER, J.等: "Brain penetration of ivermectin and selamectin in mdr1a,b P-glycoprotein and bcrp- deficient knockout mice", 《J. VET. PHARMACOL. THERAP.》 *
IVAILO SIMOFF等: "Complete Knockout of Endogenous Mdr1 (Abcb1) in MDCK Cells by CRISPR-Cas9", 《JOURNAL OF PHARMACEUTICAL SCIENCES》 *
赵军芳: "基于3D类器官和CRISPR/Cas9技术构建新颖P-糖蛋白模型的研究", 《中国优秀硕士学位论文全文数据库（基础科学辑）》 *

Also Published As

Publication number Publication date
CN109423500B (en) 2022-07-08

Similar Documents

Publication Publication Date Title
Lv et al. Whole-genome resequencing of worldwide wild and domestic sheep elucidates genetic diversity, introgression, and agronomically important loci
CN107446954A (en) A kind of preparation method of SD rat T cells deleting genetic model
CN109266656B (en) Construction method and application of PD1 humanized BALB/c mouse model
CN107815466A (en) The preparation method and application of humanization genetic modification animal model
CN102333891A (en) Single cell gene expression for diagnosis, prognosis and identification of drug targets
CN110055223A (en) A kind of preparation method and applications of the immunodeficient animals of B2m genetic modification
CN109943564A (en) The gene site-directed hybrid mice model building method for knocking in 2A-Cre of Amh and its application
AU1818600A (en) Generation of antibodies using polynucleotide vaccination in avian species
CN110438160A (en) A kind of construction method of Cd2ap Gene Knock-Out Animal Model and application
CN107267627A (en) The preparation and application of the Six1 gene molecule marker related to pig production character
CN109929875B (en) Construction method and application of LAG3 gene humanized animal model
CN109207524A (en) The foundation and application of human obesity&#39;s zebra fish model based on FTO gene
CN110106205A (en) A kind of construction method of GITR humanized animal model and its application
CN108300738A (en) A kind of preparation method of the humanized mouse model of the neutrophil leucocyte missing of NOD genetic backgrounds
CN112410341A (en) Inducible neutrophil specific knockout mouse model construction method
CN110115248A (en) A kind of immunodeficient mouse, the Its Preparation Method And Use of somatostatin gene defect
CN105671045B (en) A kind of method of sheep embryo fibroblast homologous recombination repair frequency after raising gene editing
CN110195057A (en) The preparation method and application of the genetically modified non-human animal of Hr gene or its filial generation
Krčmar et al.  DNA barcoding of the horsefly fauna (Diptera, Tabanidae) of Croatia with notes on the morphology and taxonomy of selected species from Chrysopsinae and Tabaninae
CN113973779B (en) Method for artificially inducing polyploid loaches
CN109423500A (en) A kind of method and application of the dual-gene knockout of Mdr1a/1b
CN108251456A (en) A kind of preparation method of the atherosclerosis mouse model of NOD genetic backgrounds
CN109536616A (en) Screen the SNP marker and copy number variation method of prolificacy Mauremys mutica female parent
CN111705063B (en) ASGR1 mutant gene and application thereof in preparation of mammal liver injury sensitive model
CN108300737A (en) A kind of method for building up and application thereof for the malignant lymphoma model that phenotype is highly consistent

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant