KR102191341B1 - Method of manufacturing breast cancer animal model and uses thereof - Google Patents

Abstract

The present invention relates to a method of manufacturing an animal model of breast cancer, including the step of knocking out the ARL6IP4 gene, an animal model of breast cancer prepared by the method, and a method of screening a drug candidate for treating breast cancer using the animal model of breast cancer. Since the breast cancer animal model manufactured by the method of the present invention progresses rapidly in the development of breast cancer and lung metastasis, based on the animal model, the breast cancer metastasis characteristics are established to conduct basic research for the development of breast cancer treatment and screening of candidate drugs for breast cancer treatment. It is expected to be useful in clinical studies such as.

Description

TECHNICAL FIELD [Method of manufacturing breast cancer animal model and uses thereof]

The present invention comprises the step of knocking out the ARL6IP4 (ADP Ribosylation Factor Like GTPase 6 Interacting Protein 4) gene, a method for producing a breast cancer animal model, a breast cancer animal model prepared by the method, and the breast cancer animal model It relates to a method for screening a candidate drug for treating breast cancer, and the like.

The development of technology for genetically modified animals, that is, transgenic animals and genetic knockout animals, is accelerating further research on disease model animals due to the establishment of biotechnology through the development of molecular biology. In addition to confirming the function of a specific gene by using genetic manipulation, it is now possible to use animals that have not been naturally acquired until now. For example, viruses that cause hepatitis B and C in humans are not susceptible to those other than chimpanzees, which are experimental animals, so it was very difficult to study hepatitis and develop treatments, but by introducing the genes of hepatitis B and C viruses, animal models And the above field is not limited to the development of animal models, but through efforts to create high value-added resources by directly producing physiologically active substances in vivo, transformed black goats with human leukocyte proliferation factor (G-CSF) Medi was born, and Saeromi was developed to produce anemia and renal failure drugs by transplanting the hematopoietic promotion gene (EPO) into pigs. In addition, the development of an animal that can replace artificial organs is also being studied.

On the other hand, breast cancer is one of the representative female cancers whose incidence rate is gradually increasing worldwide, and the incidence rate of Korean women is also gradually increasing due to Western-style eating habits. According to data from the Ministry of Health and Welfare's National Cancer Center released in December 2015, the number of breast cancer incidences as of 2013 accounted for 15.4% of all cancers, second only to thyroid cancer (30.5%), especially in the age group of 40-50. It is considered a representative female cancer that threatens middle-aged women, accounting for 64.5% (91,163) of all patients.

Accordingly, the need for effective diagnosis and treatment for breast cancer is required, and an appropriate animal model is essential for the development of biological samples for the study of the mechanism of breast cancer and the study of treatment, so the animal model that has recently caused breast cancer or breast cancer metastasis (MMTV- PyMT, etc.) are being actively researched, but the types of animal models reflecting the patient's genetic variation are very limited.

Republic of Korea Patent Publication 10-2014-0050689

As a result of intensive research on the mechanism and treatment method of breast cancer, the present inventors newly developed ARL6IP4 ^(+/-) mice that knocked out the ARL6IP4 gene, and this was developed as an existing breast cancer model, MMTV-PyMT mouse (002374, Jackson laboratory, USA. ), a new breast cancer model, MMTV-PyMT; ARL6IP4 ^(-/-) mice were completed. Furthermore, the present invention was completed based on the increase in tumor cells, nodules and lung metastases in the breast tissue in the mouse.

Accordingly, an object of the present invention is to provide a method for producing an animal model of breast cancer, comprising the step of producing an ARL6IP4 ^(+/-) mouse in which the ARL6IP4 gene is knocked out.

Another object of the present invention is to provide an animal model of breast cancer prepared by the above method.

Another object of the present invention is to provide a method for screening a candidate drug for treating breast cancer using the animal model.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems that are not mentioned will be clearly understood by those skilled in the art from the following description.

In order to achieve the object of the present invention, the present invention comprises the steps of: (a) producing an ARL6IP4 ^(+/-) mouse in which the ARL6IP4 (ADP Ribosylation Factor Like GTPase 6 Interacting Protein 4) gene is knocked out;

(b) MMTV-PyMT by crossing ARL6IP4 ^(+/-) mice and MMTV-PyMT mice produced in step (a); Obtaining ARL6IP4 ^(+/-) mice; And

(c) MMTV-PyMT obtained from the crossing of step (b); ARL6IP4 ^(+/-) by mating the mouse ^(a) ARL6IP4 ^(+/-) mice of step with reverse MMTV-PyMT; It provides a method for producing a breast cancer animal model comprising the step of obtaining an ARL6IP4 ^(-/-) mouse.

In one embodiment of the present invention, the gene knockout in step (a) may be performed through the CRISPR/cas9 (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR associated Protein 9) system.

In another embodiment of the present invention, the sgRNA used in the CRISPR/cas9 system may target the nucleic acid sequence represented by SEQ ID NO: 1.

In another embodiment of the present invention, the ARL6IP4 gene knockout in the step (a) may occur in exon 1 of the ARL6IP4 gene.

In addition, the present invention provides an animal model of breast cancer prepared by the above method.

In one embodiment of the present invention, the breast cancer animal model may be one in which lung metastasis of breast cancer proceeds rapidly.

In addition, the present invention comprises the steps of: (a) treating the candidate material in the animal model;

(b) observing changes in the tumor of the animal model; And

(c) It provides a method for screening a candidate drug for treating breast cancer, comprising the step of determining a candidate substance for inhibiting the growth or metastasis of the tumor as a candidate drug for treating breast cancer.

MMTV-PyMT produced by the method of the present invention; In the case of ARL6IP4 ^(-/-) mice, it was confirmed that breast cancer development and lung metastasis progressed rapidly.Based on the mouse, breast cancer metastasis was established to conduct basic research for breast cancer treatment development and screening of candidate drugs for breast cancer treatment. Etc., it is expected to be useful in clinical research.

1 schematically shows a strategy for making a knockout mouse using genetic scissors.
2 shows MMTV-PyMT; ARL6IP4 ^(-/-) breast cancer mouse model construction sequence is shown.
3 is a MMTV-PyMT manufactured by the method of the present invention; This is the result of observing an increase in the incidence of breast cancer in ARL6IP4 ^(-/-) mice compared to the control group.
Figures 4a and 4b are the lungs of a 16-week-old mouse were excised and observed with the naked eye, and Figure 4a is an MMTV-PyMT; ARL6IP4 ^(+/+) mice, FIG. 4B shows MMTV-PyMT; The lungs of ARL6IP4 ^(-/-) mice were observed.
Figures 5a and 5b are observed through hematoxylin-eogene staining by extracting the lungs of a 16-week-old mouse, Figure 5a is MMTV-PyMT; ARL6IP4 ^(+/+) mouse, FIG. 5B shows MMTV-PyMT; The lungs of ARL6IP4 ^(-/-) mice were observed.
6 is a 16 week old MMTV-PyMT; ARL6IP4 ^(+/+) and MMTV-PyMT; It is the result of measuring the area of cancer in the lung by extracting the lungs of ARL6IP4 ^(-/-) mice (* indicates a statistically significant difference (P <0.05) between groups).

The present inventors newly developed ARL6IP4 ^(+/-) mice that knocked out the ARL6IP4 gene, and through crossing them with MMTV-PyMT mice, which are existing breast cancer models, MMTV-PyMT, a new breast cancer model; ARL6IP4 ^(-/-) mice were completed, and the increase in tumor cells and nodules in breast tissue, and lung metastases in the mice were confirmed, and the present invention was completed based on this.

In one embodiment of the present invention, it was confirmed that ARL6IP4 ^(+/-) mice can be obtained by the manufacturing method of the present invention (see Example 1).

In another embodiment of the present invention, by the manufacturing method of the present invention, MMTV-PyMT; It was confirmed that ARL6IP4 ^(-/-) mice can be acquired (see Example 2).

In another embodiment of the present invention, MMTV-PyMT; MMTV-PyMT compared to ARL6IP ^(+/+) mice; It was confirmed that tumor proliferation was more active in ARL6IP ^(-/-) mice, and the area was remarkably wide (see Example 3).

In another embodiment of the present invention, MMTV-PyMT; MMTV-PyMT as a control for ARL6IP4 ^(-/-) mice; It was confirmed that lung metastasis of breast cancer was increased compared to ARL6IP4 ^(+/+) mice (see Example 4).

Hereinafter, the present invention will be described in detail.

The present invention (a) ARL6IP4 (ADP Ribosylation Factor Like GTPase 6 Interacting Protein 4) gene is knocked out (knockout) ARL6IP4 ^(+/-) to produce a mouse;

(b) MMTV-PyMT by crossing the ARL6IP4 ^(+/-) mice and MMTV-PyMT mice produced in step (a); Obtaining ARL6IP4 ^(+/-) mice; And

(c) MMTV-PyMT obtained from the crossing of step (b); ARL6IP4 ^(+/-) by mating the mouse ^(a) ARL6IP4 ^(+/-) mice of step with reverse MMTV-PyMT; It provides a method for producing a breast cancer animal model comprising the step of obtaining an ARL6IP4 ^(-/-) mouse.

The "animal model" of the present invention refers to an animal having a disease very similar to that of humans. The significance of animal models in the study of human diseases depends on the physiological or genetic similarities between humans and animals. In disease research, animal models provide materials for research on various causes, onset processes, and treatments of diseases, and basic data for judging the possibility of practical use can be obtained through actual efficacy investigations of the developed new drug candidates. The type of animal is mouse, rat

(rat), cows, horses, pigs, monkeys, ducks, dogs, cats, etc., it is preferable that the mouse, but is not limited thereto.

The term “ARL6IP4” is an abbreviation of ADP Ribosylation Factor Like GTPase 6 Interacting Protein 4, and the function of the protein is not clearly known. However, it is presumed to be involved in splicing regulation in light of sequence homology with a protein containing the SR splicing factor, and it is also presumed to be a regulator of the RAC1 signaling pathway.

In the present invention, the gene knockout in step (a) may use a CRISPR/cas9 (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR associated Protein 9) system, but is not limited thereto, and the ARL6IP4 ^(+/-) mouse of the present invention If it is a way to get it, it can be applicable without limitation.

The “CRISPR/cas9 system” is a simple and easy method that can induce mutations at a specific genomic locus. RNA (sgRNA) that specifically binds to a specific nucleotide sequence and Cas9 nuclea that serves to cut a specific nucleotide sequence It is composed of a nuclease, and a knock-out that can completely inhibit the function of a specific gene by introducing plasmid DNA into cells or animals is possible.

The “knockout” refers to partial, substantial, complete deletion, silencing, inactivation or down-regulation of a gene, and the mutant whose gene is knocked out by the method is a hetero mutant (+ /-) also includes.

The “Cas9 protein” refers to an essential protein element in the CRISPR/cas9 system, and when it forms a complex with two RNAs called CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA), active endonucleases Form an aze. Information on the Cas9 gene and protein can be obtained from GenBank of the National Center for Biotechnology Information (NCBI), but is not limited thereto.

In the present invention, the sgRNA used in the CRISPR/cas9 system may target the nucleic acid sequence represented by SEQ ID NO: 1, but is not limited thereto.

The “sgRNA (single guide RNA)” is an RNA specific to the target DNA. It is expressed through transcription of the linear double-stranded DNA delivered into the cell to recognize the target gene and form a complex with the Cas9 protein, and target the Cas9 protein. It is the RNA that brings to the DNA. In the present invention, sgRNA is capable of hybridizing with a target gene.

In the present invention, the knockout of the ARL6IP4 gene in the step (a) may occur in exon 1 of the ARL6IP4 gene, but is not limited thereto.

As another aspect of the present invention, the present invention provides an animal model of breast cancer prepared by the above method.

In the present invention, the breast cancer animal model may rapidly metastasize to lungs of breast cancer, but is not limited thereto.

The "metastatic" means that metastatic cancer cells fall from the initial tumor cells and invasion the extracellular matrix (ECM) such as the interstitial stroma and the basal membrane (BM) of normal tissues to invade blood vessels. It means that cancer cells proliferate through the process of proliferating in a new tissue by leaching from the capillary tube through the matrix and basement membrane of the cell after entering the or lymphatic vessel and then attached to the capillary wall of another target tissue.

As another aspect of the present invention, the present invention comprises the steps of: (a) treating a candidate substance in the animal model;

(b) observing changes in the tumor of the animal model; And

(c) It provides a method for screening a candidate drug for treating breast cancer, comprising the step of determining a candidate substance for inhibiting the growth or metastasis of the tumor as a candidate drug for treating breast cancer.

The "candidate" means a substance to be tested as an improvement or therapeutic agent for breast cancer or breast cancer metastasis, and may include arbitrary molecules such as extracts, proteins, oligopeptides, small organic molecules, polysaccharides, polynucleotides, and a wide range of compounds. . These candidates also include natural as well as synthetic materials.

Meanwhile, the sequence list related to the present invention is summarized in Table 1 below.

designation Base sequence Sequence number Arl6ip4_sgRNA target sequence GCGAAGTAAGAGGAGTAGCAAGG One ARL6IP4 CCTCCCGCGAAAGGCCTGCTGTGGGCTAATGGTGGATGTGGGGACCCAGCAGCCTCGGGACGCGTCTCCGGCGACCCACGCGGTCCTATTGCAGCTGAGGAAAGCTGCAGCGTTCCCTCCCTGGGCCACCAAGTCCAGTGCGCAGGCTTGAGGGCGGGGCGGGAGTCGGAGGAGGTGCTGGGATCGCTAAGCCCCGGGGCTCGCTCCGGCAGGAATGGGCACTGGGCGCCCCGAGGATCGGGTCCCGTTGGCGCTGCGTTTGGATTCGCCTCCGAGGACACGCTCACGAAGAGTCGCAGGCTAAGCGCTTTCCTTCCGGTCCCTAGCCCGCCTCGCTGATGGCTCACGTTGGCTCTCGAAAGCGCTCGAGAAGTCGCAGTCGGTCCCGTAGTGGTCGGCGAGGGTCAGAAAAGCGAAGTAAGAGGAGTAGCAAGGATGCCTCGAGGAACTGTTCAGCCTCCAGATCCCAGGGCCACAAGGCTGGCAGCGCCTCCGGGGTTGAGGGTGAGGACCACGGGGGACAGGGAAGAGAGATGTGTGGCGTCCGCACTGCGGGAGGCTGGCATCTGCCGCACCCCCCACCTCGGGAGCGAGGGTGTGAAGAGGTTCTGTTGAGTGGAGGGTGTGCCTTATACATGCCTTGAATGCTTTGGGTCTTCGAGGTTGAGCGTGGTCAGGATCCTGCCAGGCACATAGTGACTTCTAGAACCCAAAAGAAGGTTCCAGATGTTCTCTTGGAGAGCCCATTGGGAGGGTCCCTACCACTAGAGCAGGGCACAAAGGCCTTACCTTCTCCCTGCATCACAGAGAGAAGCAAGCACAAGGCCCAGAGGACATCGCGATCCAGTTCAACCTCCTCCTCTTCCAGTTCTTCTAGCTCCGCCTCGTCCTCATCCTCCAGTGATGGCCGGAAGAAGCGAGCGAAGCACAAGGAGAAGAAGAGGAAGAAGAAGAAGAAGAAACGGAAGAAGAAGTTGAAGAAGAGAGTCAAGGAGAAGGC AGTGGCGGTGCACCAGGCCGAGGCTCTGCCCGGCCCCTCACTGGATCAGTGGCACAGATCAGCTGGGGAGGACAATGATGGCCCAGGTACCATGGCGGGCCAGCATGCTGTGGGGAAAGGGTCCTCTCCCTGGGTCTGACACGTCCTCCACATTCCCTTCCAGTCCTGACAGATGAGCAGAAGTCTCGTATCCAGGCCATGAAACCCATGACAAAGGAGGAGTGGGATGCCCGACAGAGCGTTATTCGAAAGGTGGTGGACCCAGAGACAGGACGCACAAGGTGTGGTACAGAAGGCAGAGCCAGCTAGCCCCGCCCTCGGTCCAATTCAGAATATTGGCCCAGGATGTGCTCTGGTGGGGAGCTGTCACCATTTTTATAACAAAGTGTGGGGGAAATAGTCACTTGAGATGTGATATCCCAGCTGTTACCCCCTGTGCCTCTTGAGGAGTTACAGTACCAGGAGGGCCTTGATGCTTTTCAAATGGTTGTTGTTGGCTGGTCTGGGTTAATGGTGCAGGCTGACAAGGGAGAGCCTACCTGGCCCGTCTCCATTCTGTCCCAAAAGCGGTAACTGATTGGGAGGAGCGCCCAGGCACCCCCTTCTCAAGATAGCTGGGCTTGAGCCCCGAGATCCCTTTCCTTGGGTGGGTCTGCTTCTGTTGCTATGGCATGAGAGTCCCAGACTCTCTCGTGCTAAGCTGATGACCTCCAACCCCCCAGGCTCATCAAGGGAGACGGCGAGGTTTTAGAGGAAATCGTAACCAAAGAACGACACAGAGAGATCAACAAGGTTGGTGGTACCACTCTGCCTGTGCTCTGCCCGCATTGTATCTACACGTAAGTTTCTCACGCTTCCCACCTGTTTCCTTCCTCAGCAAGCCACCCGAGGGGATGGGCTGGCCTTCCAGATGCGAACAGGCCTACTTCCCTGAGGGCTCAGCCATCCCAGGTTTGTGAACTGCTGTTGGTGACTTGGAGACTAATAGGTCCAGGTGCCT TTCCTACAGCCCAGCATCCTCTTGGGTGCAGTGGATTGGACAGCAAATTGGACAGCAGAGTGTCACTATTAAATGATCTTGGTCACAG 2 ARL6IP4 exon 1 CCGCCGTTTCCTCCCGCGAAAGGCCTGCTGTGGGCTAATGGTGGATGTGGGGACCCAGCAGCCTCGGGACGCGTCTCCGGCGACCCACGCGGTCCTATTGCAGCTGAGGAAAGCTGCAGCGTTCCCTCCCTGGGCCACCAAGTCCAGTGCGCAGGCTTGAGGGCGGGGCGGGAGTCGGAGGAGGTGCTGGGATCGCTAAGCCCCGGGGCTCGCTCCGGCAGGAATGGGCACTGGGCGCCCCGAGGATCGGGTCCCGTTGGCGCTGCGTTTGGATTCGCCTCCGAGGACACGCTCACGAAGAGTCGCAGGCTAAGCGCTTTCCTTCCGGTCCCTAGCCCGCCTCGCTGATGGCTCACGTTGGCTCTCGAAAGCGCTCGAGAAGTCGCAGTCGGTCCCGTAGTGGTCGGCGAGGGTCAGAAAAGCGAAGTAAGAGGAGTAGCAAGGATGCCTCGAGGAACTGTTCAGCCTCCAGATCCCAGGGCCACAAGGCTGGCAGCGCCTCCGGGGTTGAGG 3 ARL6IP4 exon 2 AGAGAAGCAAGCACAAGGCCCAGAGGACATCGCGATCCAGTTCAACCTCCTCCTCTTCCAGTTCTTCTAGCTCCGCCTCGTCCTCATCCTCCAGTGATGGCCGGAAGAAGCGAGCGAAGCACAAGGAGAAGAAGAAGAGGAAGAGAAGAAGAAGAAGAGGACCAGCCGCGCGGAGGCAGGCAGGCGCGAGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCTCCTTCCAGT 4 ARL6IP4 exon 3 TCCTGACAGATGAGCAGAAGTCTCGTATCCAGGCCATGAAACCCATGACAAAGGAGGAGTGGGATGCCCGACAGAGCGTTATTCGAAAGGTGGTGGACCCAGAGACAGGACGCACAAG 5 ARL6IP4 exon 4 GCTCATCAAGGGAGACGGCGAGGTTTTAGAGGAAATCGTAACCAAAGAACGACACAGAGAGATCAACAAG 6 ARL6IP4 exon 5 CAAGCCACCCGAGGGGATGGGCTGGCCTTCCAGATGCGAACAGGCCTACTTCCCTGAGGGCTCAGCCATCCCAGGTTTGTGAACTGCTGTTGGTGACTTGGAGACTAATAGGTCCAGGTGCCTTTCCTACAGCCCAGCATCCTCTTTCGGGTGCAGTGGATTGGACAGCAAATTGGACGAATCAGAGTGTCACT 7

Hereinafter, a preferred embodiment is presented to aid the understanding of the present invention. However, the following examples are provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

[Example]

Example 1. Preparation ^of ARL6IP4 ^(+/-) mice

SgRNA was synthesized according to a conventional method using an in vitro transcription kit (74104, QIAGEN, Germany) using a DNA template (Cell Reports 2013 4:220-228. Highly efficient targeted mutagenesis of Drosophila with the CRIPSR/ see cas9 system). The synthesized sgRNA was purified using the RNeasy Mini kit (74104, QIAGEN, Germany), and the Cas9 protein was purchased from NEB (M0646T, NEB, USA).

A fertilized egg (pronuclei) was isolated from 57BL/6J mice, and an sgRNA/cas9 protein mixture was prepared (Cas9 protein, 100 ng/ul; sgRNA 50 ng/ul), and the Cas9 protein/sgRNA mixture was prepared using a microinjection microscope. It was injected into the cytoplasm of a fertilized egg. Next, the engineered fertilized egg was transplanted into the surrogate mother's oviduct, and mice born about 20 days later were genetically tested to identify mice with a 22 nucleotide deletion (22 del mouse) and a 10 nucleotide deletion (10 del mouse). In the following experiment, a 10 del mouse was used (see Table 2).

Example 2. MMTV-PyMT; Preparation ^of ARL6IP4 ^(-/-) mice

MMTV-PyMT; In order to prepare ARL6IP4 ^(-/-) mice, a genetic test was performed on pups obtained by crossing (step 1 ⁾ MMTV-PyMT mice and ARL6IP4 ^(+/-) mice, among which MMTV-PyMT; Mice with the ARL6IP4 ^(+/-) genotype were selected. Then, ARL6IP4 in step 1 ^(+/-) Mouse and the selected MMTV-PyMT; ARL6IP4 ^(+/-) mice were backcrossed to obtain pups, among them MMTV-PyMT; ARL6IP4 ^(+/+) and MMTV-PyMT; ARL6IP4 ^(-/-) mice were distinguished, and MMTV-PyMT; ARL6IP4 ^(+/+) mice were used as controls, MMTV-PyMT; ARL6IP4 ^(-/-) mice were used as the experimental group (see Fig. 2).

Example 3. MMTV-PyMT; Measurement of breast cancer formation in ARL6IP4 ^(-/-) mice

A 10-week-old mouse was used to measure breast cancer formation in the mouse prepared by the method of Example 2, and the degree of breast cancer formation was observed by IVIS images using FP635, a reporter gene of the mammary gland of the mouse.

As a result, as shown in Fig. 3, MMTV-PyMT; MMTV-PyMT compared to ARL6IP ^(+/+) mice; It was confirmed that the tumor area was remarkably large in ARL6IP ^(-/-) mice.

Example 4. MMTV-PyMT; Confirmation of breast cancer metastasis to lung in ARL6IP4 ^(-/-) mice

MMTV-PyMT produced by the method of Example 2 to confirm the lung metastasis of breast cancer; ARL6IP4 ^(-/-) mice and MMTV-PyMT; ARL6IP4 ^(+/+) mice were subjected to gross observation and histopathological examination of the lungs, and the distribution of lung tumor cells and the area of nodules due to metastasis were confirmed through an electron microscope.

Specifically, the breeding of mice was carried out in a facility set at a temperature of 22°C, a relative humidity of 50%, an illumination time of 12 hours (8 a.m. lighting-off at 8 p.m.) and an illuminance of 200-300 lux. Five animals were housed in a polycarbonate breeding box to freely consume solid feed for experimental animals and tap water equipped with a water purification device. Five mice were set as one experimental group, and all experimental animals were treated according to the'Guide for the Care and Use of Laboratory Animal' (1996, USA) of the Institute of Laboratory Animal Resources. After sacrificing a 12-week-old mouse with CO ₂ gas, the lungs were excised and fixed in 10% neutral buffered formalin (NBF) fixative for 24 hours, followed by constant rinsing and conventional methods. Following the alcohol dehydration process, it was embedded with paraffin. For the embedded lung tissue, a continuous section of 4 μm thickness was prepared using a thin sectioning machine, stained with hematoxylin-eosin (H&E), and then sealed with permount to create a permanent specimen. , Pathological histological analysis was performed.

As a result, in the case of visual observation, as shown in Figs. 4a and 4b, MMTV-PyMT; MMTV-PyMT as a control for ARL6IP4 ^(-/-) mice; Compared to the ARL6IP4 ^(+/+) mice, it was confirmed that the degree of lung metastasis of breast cancer was remarkably higher, and the same result was observed in the results of hematoxylin-eogene staining as shown in FIGS. 5A and 5B. Further, as shown in Fig. 6, MMTV-PyMT; MMTV-PyMT as a control for ARL6IP4 ^(-/-) mice; It was confirmed that the tumor area was remarkably wider than that of ARL6IP4 ^(+/+) mice.

The above results are MMTV-PyMT of the present invention; It means that ARL6IP4 ^(-/-) mice can be usefully used as animal models of breast cancer and lung metastasis of breast cancer.

The above-described description of the present invention is for illustration purposes only, and those of ordinary skill in the art to which the present invention pertains can understand that it is possible to easily transform it into other specific forms without changing the technical spirit or essential features of the present invention. There will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not limiting.

<110> National Cancer Center Dongguk University Industry-Academic Cooperation Foundation <120> Method of manufacturing breast cancer animal model and uses thereof <130> MP18-303 <160> 7 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> Arl6ip4_sgRNA target sequence <400> 1 gcgaagtaag aggagtagca agg 23 <210> 2 <211> 2088 <212> DNA <213> ARL6IP4 <400> 2 cctcccgcga aaggcctgct gtgggctaat ggtggatgtg gggacccagc agcctcggga 60 cgcgtctccg gcgacccacg cggtcctatt gcagctgagg aaagctgcag cgttccctcc 120 ctgggccacc aagtccagtg cgcaggcttg agggcggggc gggagtcgga ggaggtgctg 180 ggatcgctaa gccccggggc tcgctccggc aggaatgggc actgggcgcc ccgaggatcg 240 ggtcccgttg gcgctgcgtt tggattcgcc tccgaggaca cgctcacgaa gagtcgcagg 300 ctaagcgctt tccttccggt ccctagcccg cctcgctgat ggctcacgtt ggctctcgaa 360 agcgctcgag aagtcgcagt cggtcccgta gtggtcggcg agggtcagaa aagcgaagta 420 agaggagtag caaggatgcc tcgaggaact gttcagcctc cagatcccag ggccacaagg 480 ctggcagcgc ctccggggtt gagggtgagg accacggggg acagggaaga gagatgtgtg 540 gcgtccgcac tgcgggaggc tggcatctgc cgcacccccc acctcgggag cgagggtgtg 600 aagaggttct gttgagtgga gggtgtgcct tatacatgcc ttgaatgctt tgggtcttcg 660 aggttgagcg tggtcaggat cctgccaggc acatagtgac ttctagaacc caaaagaagg 720 ttccagatgt tctcttggag agcccattgg gagggtccct accactagag cagggcacaa 780 aggccttacc ttctccctgc atcacagaga gaagcaagca caaggcccag aggacatcgc 840 gatccagttc aacctcctcc tcttccagtt cttctagctc cgcctcgtcc tcatcctcca 900 gtgatggccg gaagaagcga gcgaagcaca aggagaagaa gaggaagaag aagaagaaga 960 aacggaagaa gaagttgaag aagagagtca aggagaaggc agtggcggtg caccaggccg 1020 aggctctgcc cggcccctca ctggatcagt ggcacagatc agctggggag gacaatgatg 1080 gcccaggtac catggcgggc cagcatgctg tggggaaagg gtcctctccc tgggtctgac 1140 acgtcctcca cattcccttc cagtcctgac agatgagcag aagtctcgta tccaggccat 1200 gaaacccatg acaaaggagg agtgggatgc ccgacagagc gttattcgaa aggtggtgga 1260 cccagagaca ggacgcacaa ggtgtggtac agaaggcaga gccagctagc cccgccctcg 1320 gtccaattca gaatattggc ccaggatgtg ctctggtggg gagctgtcac catttttata 1380 acaaagtgtg ggggaaatag tcacttgaga tgtgatatcc cagctgttac cccctgtgcc 1440 tcttgaggag ttacagtacc aggagggcct tgatgctttt caaatggttg ttgttggctg 1500 gtctgggtta atggtgcagg ctgacaaggg agagcctacc tggcccgtct ccattctgtc 1560 ccaaaagcgg taactgattg ggaggagcgc ccaggcaccc ccttctcaag atagctgggc 1620 ttgagccccg agatcccttt ccttgggtgg gtctgcttct gttgctatgg catgagagtc 1680 ccagactctc tcgtgctaag ctgatgacct ccaacccccc aggctcatca agggagacgg 1740 cgaggtttta gaggaaatcg taaccaaaga acgacacaga gagatcaaca aggttggtgg 1800 taccactctg cctgtgctct gcccgcattg tatctacacg taagtttctc acgcttccca 1860 cctgtttcct tcctcagcaa gccacccgag gggatgggct ggccttccag atgcgaacag 1920 gcctacttcc ctgagggctc agccatccca ggtttgtgaa ctgctgttgg tgacttggag 1980 actaataggt ccaggtgcct ttcctacagc ccagcatcct cttgggtgca gtggattgga 2040 cagcaaattg gacagcagag tgtcactatt aaatgatctt ggtcacag 2088 <210> 3 <211> 513 <212> DNA <213> ARL6IP4 exon 1 <400> 3 ccgccgtttc ctcccgcgaa aggcctgctg tgggctaatg gtggatgtgg ggacccagca 60 gcctcgggac gcgtctccgg cgacccacgc ggtcctattg cagctgagga aagctgcagc 120 gttccctccc tgggccacca agtccagtgc gcaggcttga gggcggggcg ggagtcggag 180 gaggtgctgg gatcgctaag ccccggggct cgctccggca ggaatgggca ctgggcgccc 240 cgaggatcgg gtcccgttgg cgctgcgttt ggattcgcct ccgaggacac gctcacgaag 300 agtcgcaggc taagcgcttt ccttccggtc cctagcccgc ctcgctgatg gctcacgttg 360 gctctcgaaa gcgctcgaga agtcgcagtc ggtcccgtag tggtcggcga gggtcagaaa 420 agcgaagtaa gaggagtagc aaggatgcct cgaggaactg ttcagcctcc agatcccagg 480 gccacaaggc tggcagcgcc tccggggttg agg 513 <210> 4 <211> 279 <212> DNA <213> ARL6IP4 exon 2 <400> 4 agagaagcaa gcacaaggcc cagaggacat cgcgatccag ttcaacctcc tcctcttcca 60 gttcttctag ctccgcctcg tcctcatcct ccagtgatgg ccggaagaag cgagcgaagc 120 acaaggagaa gaagaggaag aagaagaaga agaaacggaa gaagaagttg aagaagagag 180 tcaaggagaa ggcagtggcg gtgcaccagg ccgaggctct gcccggcccc tcactggatc 240 agtggcacag atcagctggg gaggacaatg atggcccag 279 <210> 5 <211> 118 <212> DNA <213> ARL6IP4 exon 3 <400> 5 tcctgacaga tgagcagaag tctcgtatcc aggccatgaa acccatgaca aaggaggagt 60 gggatgcccg acagagcgtt attcgaaagg tggtggaccc agagacagga cgcacaag 118 <210> 6 <211> 70 <212> DNA <213> ARL6IP4 exon 4 <400> 6 gctcatcaag ggagacggcg aggttttaga ggaaatcgta accaaagaac gacacagaga 60 gatcaacaag 70 <210> 7 <211> 212 <212> DNA <213> ARL6IP4 exon 5 <400> 7 caagccaccc gaggggatgg gctggccttc cagatgcgaa caggcctact tccctgaggg 60 ctcagccatc ccaggtttgt gaactgctgt tggtgacttg gagactaata ggtccaggtg 120 cctttcctac agcccagcat cctcttgggt gcagtggatt ggacagcaaa ttggacagca 180 gagtgtcact attaaatgat cttggtcaca ga 212

Claims (7)

(a) ARL6IP4 (ADP Ribosylation Factor Like GTPase 6 Interacting Protein 4) Gene is knocked out (knockout) ARL6IP4 ^(+/-) to produce a mouse;
(b) MMTV-PyMT by crossing the ARL6IP4 ^(+/-) mice and MMTV-PyMT mice produced in step (a); Obtaining ARL6IP4 ^(+/-) mice; And
(c) MMTV-PyMT obtained from the crossing of step (b); ARL6IP4 ^(+/-) by mating the mouse ^(a) ARL6IP4 ^(+/-) mice of step with reverse MMTV-PyMT; A method for producing an animal model of breast cancer comprising the step of obtaining an ARL6IP4 ^(-/-) mouse.
The method of claim 1,
Gene knockout in the step (a) is characterized in that using the CRISPR / cas9 (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR associated Protein 9) system, a method for producing a breast cancer animal model.
The method of claim 2,
The method for producing a breast cancer animal model, characterized in that the sgRNA (single guide RNA) used in the CRISPR/cas9 system targets the nucleic acid sequence represented by SEQ ID NO: 1.
The method of claim 1,
In the step (a), the ARL6IP4 gene knockout occurs in exon 1 of the ARL6IP4 gene.
An animal model of breast cancer prepared by the method of any one of claims 1 to 4.
The method of claim 5,
The breast cancer animal model is characterized in that the lung metastasis of breast cancer proceeds rapidly, breast cancer animal model.
(a) treating the candidate material in the animal model of claim 5;
(b) observing changes in the tumor of the animal model; And
(c) A method for screening a candidate drug for a breast cancer drug, comprising the step of determining a candidate substance for inhibiting the growth or metastasis of the tumor as a candidate drug for a breast cancer drug.

Images