CN109423500B

CN109423500B - Mdr1a/1b double-gene knockout method and application

Info

Publication number: CN109423500B
Application number: CN201710771262.1A
Authority: CN
Inventors: 王昕�; 赵军芳; 鲁健; 刘明耀
Original assignee: East China Normal University
Current assignee: East China Normal University
Priority date: 2017-08-31
Filing date: 2017-08-31
Publication date: 2022-07-08
Anticipated expiration: 2037-08-31
Also published as: CN109423500A

Abstract

The invention discloses a method for double gene knockout of Mdr1a/1b, successfully constructs a rat model of Mdr1a/1b gene knockout, and provides a new animal model for researching the functions of P-glycoprotein (P-glycoprotein, P-gp), such as mediated drug transfer. The invention firstly utilizes CRISPR/Cas9 technology to knock out the gene of rat P-gp, obtains F0 generation chimeric rat through Mdr1a and Mdr1b target point design, sgRNA in vitro synthesis and transcription, pseudopregnant rat preparation, fertilized egg in vitro microinjection, embryo transplantation and other processes, and finally obtains Mdr1a/1b double-gene knock-out homozygote rat through two generations of breeding and screening. No off-target phenomenon was observed in the resulting knockout rats as verified by the T7EI endonuclease.

Description

Mdr1a/1b double-gene knockout method and application

Technical Field

The invention belongs to the technical field of biomedicine, and particularly relates to an Mdr1a/1b double-gene knockout method and application thereof in constructing an Mdr1a/1b gene knockout rat model.

Background

In 1976, Juliano RL and LingV et al discovered that one glycoprotein on the cell membrane could cause cross-resistance in cells when screening for colchicine-resistant Chinese hamster ovary cells, and named P-glycoprotein (P-gp) because it is associated with cell membrane Permeability (Permeability).

P-gp is the first ABC transporter discovered and best studied to date, also known as ABCB1 (or MDR 1). P-gp is a single-chain protein, approximately 1280 amino acids, with a molecular weight of approximately 170kD, is a 12-transmembrane protein located on the cell membrane, and consists of two subunits with 43% similarity, each subunit comprising 1 transmembrane domain (TMD) and 1 nucleic acid binding domain (NBD). Wherein TMD consists of 6 alpha-helices, is an extremely hydrophobic region, and forms a channel for transmembrane transport of substances; NBD is an extremely conserved hydrophilic region, the site of ATP binding and hydrolysis. P-gp is originally found in tumor cells, and is found to be widely distributed in vivo through subsequent research, particularly, the P-gp is highly expressed in tissues and organs with secretion functions, such as small intestine, liver, kidney, blood brain barrier, blood testis barrier, placenta and the like. The main physiological role of P-gp is to hydrolyze ATP to generate energy, and then use the energy to expel endogenous substances (cholesterol, cholic acid, amino acids, saccharides, fats, hormones, electrolytes, etc.), exogenous substances (drugs and their metabolites, etc.), and some toxins out of cells, thereby protecting cells and tissues and organs. However, the discharge of P-gp to the drug will undoubtedly reduce the bioavailability of the drug, and influence the exertion of the therapeutic effect of the drug. Analysis of cases of early drug development failures revealed that, although there are many reasons for the failures, about 40% of failures are due to poor absorption, distribution, metabolism, and excretion (ADME) properties of the compound, and one important reason for poor ADME properties is the low bioavailability of the drug due to P-gp efflux of the drug. In addition, studies have shown that about 90% of tumor chemotherapy failures are due to multidrug resistance in the body, and the main cause of multidrug resistance is overexpression of P-gp. Based on the above two points, the research on P-gp mediated drug transport is very important.

Mice and rats in rodents are the most commonly used animal models in pharmacokinetic experiments and have the advantages of mild temperament and rapid propagation. In the study of P-gp mediated drug transport, including screening for inhibitors of P-gp, many studies have been conducted using wild-type mice and rats, however, some data which are difficult to interpret often appear in experiments due to the low specificity of the inhibitor or antibody. The advent of gene knockout technology has made it possible to solve this problem.

The earliest techniques for gene knock-out were based on the principle of homologous recombination, but the efficiency was low and the cycle was long. With the development of biotechnology, ZFN and TALEN technologies appear in sequence, so that the gene knockout efficiency is greatly improved, but the defects are that the experimental design is complex and the cost is high. The CRISPR/Cas9 is a third-generation gene editing technology which appears after ZFN and TALEN, is called three great advantages of gene editing together with the ZFN and TALEN technologies, has the advantages of low cost, simplicity in operation and high targeting precision, can realize simultaneous knockout of multiple genes, and almost has no species limitation. Based on the gene knockout technology, researchers also successfully construct animal models for P-gp gene knockout. There are 3 genes encoding P-gp in rodents (Mdr1a, Mdr1b, Mdr2), and P-gp encoded by different genes plays different physiological roles: the P-gp coded by Mdr1a and Mdr1b is related to transmembrane transport and drug resistance of the drug, and is more researched in pharmacokinetics; the P-gp encoded by Mdr2 is mainly responsible for phospholipid transport and may be involved in hormone transport and regulation. In 1994, Schinkel AH et al successfully knocked out the Mdr1a gene in mice using homologous recombination techniques. In 1997, based on the existing work, Schinkel AH et al constructed Mdr1b and Mdr1a/1b knockout mouse models. In 2012, Chu X et al completed rat Mdr1a gene knockout based on ZFN technology. However, due to technical limitations, knockout rat models appear late in the mouse, and to date, no Mdr1a/1b knockout rat model has appeared.

The CRISPR/Cas9 gene editing technology can realize multi-site simultaneous knockout, and brings eosin for constructing a rat model of P-gp gene full knockout. Compared with the mouse, the rat has large volume and blood volume, and is more convenient for experimental research. More importantly, the data in the NCBI database show that rat P-gp has greater similarity to humans than mice, whether at the genomic, mRNA or protein level, and that the study of P-gp mediated drug transport using the rat model more truly reflects drug transport in humans. Therefore, when the research on P-gp is carried out, the rat model has incomparable advantages and application values compared with the mouse model.

Disclosure of Invention

The invention aims to overcome the defects of the prior art, provides a method for double gene knockout of Mdr1a/1b, applies the method to the construction of an Mdr1a/1b gene knockout rat model, applies a CRISPR/Cas9 technology to the gene knockout of rat P-gp for the first time, and successfully obtains a rat with double gene knockout of Mdr1a/1 b.

The invention provides a method for double gene knockout of Mdr1a/1b, which comprises the following steps:

(1) selecting Mdr1a and Mdr1b targets;

using online target spots to predict http:// ZiFiT. paratners. org/ZiFiT/ChoiceMenu. aspx of the website to select Mdr1a and Mdr1b knockout targets;

wherein the Mdr1a gene knockout target sequence is 5'-AGATAGCTTTGCAAATGT-3' (SEQ ID NO. 1); the Mdr1b gene knockout target sequence is 5'-CCTCCTGATGCTGGTGTT-3' (SEQ ID NO. 2).

(2) synthesizing and extracting sgRNA;

firstly, synthesizing an Oligo fragment with the length of 60bp, wherein the Oligo fragment comprises a sequence of a knockout target and a T7 promoter; then, taking the Oligo fragment as a template, synthesizing a complete sgRNA double-chain template with the length of 130bp through an overlapping PCR reaction, and extracting and separating the sgRNA double-chain template by a phenol chloroform extraction method; and finally, carrying out in-vitro transcription on the sgRNA double-stranded template by using a T7 in-vitro transcription kit, and extracting and separating a transcription product by adopting a phenol chloroform extraction method to obtain the sgRNAs of the Mdr1a and Mdr1b genes.

Wherein the sequence of the Oligo fragment containing the Mdr1a gene knockout target is 5' -GATCACTAATACGACTCACTATAGGAGATAGCTTTGCAAATGTGTTTTAGAGCTAGAAAT-3' (SEQ ID NO. 3); the sequence of Oligo fragment containing Mdr1b gene knockout target is 5' -GATCACTAATACGACTCACTATAGGCCTCCTGATGCTGGTGTTGTTTTAGAGCTAGAAAT-3' (SEQ ID NO. 4). The underlined region is the target sequence.

(3) Co-injection of sgRNA and Cas9mRNA and embryo transfer;

microinjecting the two sgrnas and Cas9mRNA into fertilized egg plasma of a rat; wherein the sgRNA is the sgRNA of Mdr1a and Mdr1b genes, and the concentration ratio of the sgRNA of the Mdr1a gene, the sgRNA of the Mdr1b gene and the Cas9mRNA is 1-2: 1-2: 1-2; preferably, 1: 1: 2; for example, the sgRNA concentration of Mdr1a and Mdr1b genes is 25ng/mL, and the Cas9mRNA concentration is 50 ng/mL.

Wherein, after the two sgRNA and the Cas9mRNA are mixed, 0.1-0.2 muL of each fertilized egg is injected.

Wherein the sequence of the Cas9mRNA is shown as SEQ ID NO.44 and is:

AUGGACUAUAAGGACCACGACGGAGACUACAAGGAUCAUGAUAUUGAUUACAAAGACGAUGACGAUAAGAUGGCCCCAAAGAAGAAGCGGAAGGUCGGUAUCCACGGAGUCCCAGCAGCCGACAAGAAGUACAGCAUCGGCCUGGACAUCGGCACCAACUCUGUGGGCUGGGCCGUGAUCACCGACGAGUACAAGGUGCCCAGCAAGAAAUUCAAGGUGCUGGGCAACACCGACCGGCACAGCAUCAAGAAGAACCUGAUCGGAGCCCUGCUGUUCGACAGCGGCGAAACAGCCGAGGCCACCCGGCUGAAGAGAACCGCCAGAAGAAGAUACACCAGACGGAAGAACCGGAUCUGCUAUCUGCAAGAGAUCUUCAGCAACGAGAUGGCCAAGGUGGACGACAGCUUCUUCCACAGACUGGAAGAGUCCUUCCUGGUGGAAGAGGAUAAGAAGCACGAGCGGCACCCCAUCUUCGGCAACAUCGUGGACGAGGUGGCCUACCACGAGAAGUACCCCACCAUCUACCACCUGAGAAAGAAACUGGUGGACAGCACCGACAAGGCCGACCUGCGGCUGAUCUAUCUGGCCCUGGCCCACAUGAUCAAGUUCCGGGGCCACUUCCUGAUCGAGGGCGACCUGAACCCCGACAACAGCGACGUGGACAAGCUGUUCAUCCAGCUGGUGCAGACCUACAACCAGCUGUUCGAGGAAAACCCCAUCAACGCCAGCGGCGUGGACGCCAAGGCCAUCCUGUCUGCCAGACUGAGCAAGAGCAGACGGCUGGAAAAUCUGAUCGCCCAGCUGCCCGGCGAGAAGAAGAAUGGCCUGUUCGGAAACCUGAUUGCCCUGAGCCUGGGCCUGACCCCCAACUUCAAGAGCAACUUCGACCUGGCCGAGGAUGCCAAACUGCAGCUGAGCAAGGACACCUACGACGACGACCUGGACAACCUGCUGGCCCAGAUCGGCGACCAGUACGCCGACCUGUUUCUGGCCGCCAAGAACCUGUCCGACGCCAUCCUGCUGAGCGACAUCCUGAGAGUGAACACCGAGAUCACCAAGGCCCCCCUGAGCGCCUCUAUGAUCAAGAGAUACGACGAGCACCACCAGGACCUGACCCUGCUGAAAGCUCUCGUGCGGCAGCAGCUGCCUGAGAAGUACAAAGAGAUUUUCUUCGACCAGAGCAAGAACGGCUACGCCGGCUACAUUGACGGCGGAGCCAGCCAGGAAGAGUUCUACAAGUUCAUCAAGCCCAUCCUGGAAAAGAUGGACGGCACCGAGGAACUGCUCGUGAAGCUGAACAGAGAGGACCUGCUGCGGAAGCAGCGGACCUUCGACAACGGCAGCAUCCCCCACCAGAUCCACCUGGGAGAGCUGCACGCCAUUCUGCGGCGGCAGGAAGAUUUUUACCCAUUCCUGAAGGACAACCGGGAAAAGAUCGAGAAGAUCCUGACCUUCCGCAUCCCCUACUACGUGGGCCCUCUGGCCAGGGGAAACAGCAGAUUCGCCUGGAUGACCAGAAAGAGCGAGGAAACCAUCACCCCCUGGAACUUCGAGGAAGUGGUGGACAAGGGCGCUUCCGCCCAGAGCUUCAUCGAGCGGAUGACCAACUUCGAUAAGAACCUGCCCAACGAGAAGGUGCUGCCCAAGCACAGCCUGCUGUACGAGUACUUCACCGUGUAUAACGAGCUGACCAAAGUGAAAUACGUGACCGAGGGAAUGAGAAAGCCCGCCUUCCUGAGCGGCGAGCAGAAAAAGGCCAUCGUGGACCUGCUGUUCAAGACCAACCGGAAAGUGACCGUGAAGCAGCUGAAAGAGGACUACUUCAAGAAAAUCGAGUGCUUCGACUCCGUGGAAAUCUCCGGCGUGGAAGAUCGGUUCAACGCCUCCCUGGGCACAUACCACGAUCUGCUGAAAAUUAUCAAGGACAAGGACUUCCUGGACAAUGAGGAAAACGAGGACAUUCUGGAAGAUAUCGUGCUGACCCUGACACUGUUUGAGGACAGAGAGAUGAUCGAGGAACGGCUGAAAACCUAUGCCCACCUGUUCGACGACAAAGUGAUGAAGCAGCUGAAGCGGCGGAGAUACACCGGCUGGGGCAGGCUGAGCCGGAAGCUGAUCAACGGCAUCCGGGACAAGCAGUCCGGCAAGACAAUCCUGGAUUUCCUGAAGUCCGACGGCUUCGCCAACAGAAACUUCAUGCAGCUGAUCCACGACGACAGCCUGACCUUUAAAGAGGACAUCCAGAAAGCCCAGGUGUCCGGCCAGGGCGAUAGCCUGCACGAGCACAUUGCCAAUCUGGCCGGCAGCCCCGCCAUUAAGAAGGGCAUCCUGCAGACAGUGAAGGUGGUGGACGAGCUCGUGAAAGUGAUGGGCCGGCACAAGCCCGAGAACAUCGUGAUCGAAAUGGCCAGAGAGAACCAGACCACCCAGAAGGGACAGAAGAACAGCCGCGAGAGAAUGAAGCGGAUCGAAGAGGGCAUCAAAGAGCUGGGCAGCCAGAUCCUGAAAGAACACCCCGUGGAAAACACCCAGCUGCAGAACGAGAAGCUGUACCUGUACUACCUGCAGAAUGGGCGGGAUAUGUACGUGGACCAGGAACUGGACAUCAACCGGCUGUCCGACUACGAUGUGGACCAUAUCGUGCCUCAGAGCUUUCUGAAGGACGACUCCAUCGACAACAAGGUGCUGACCAGAAGCGACAAGAACCGGGGCAAGAGCGACAACGUGCCCUCCGAAGAGGUCGUGAAGAAGAUGAAGAACUACUGGCGGCAGCUGCUGAACGCCAAGCUGAUUACCCAGAGAAAGUUCGACAAUCUGACCAAGGCCGAGAGAGGCGGCCUGAGCGAACUGGAUAAGGCCGGCUUCAUCAAGAGACAGCUGGUGGAAACCCGGCAGAUCACAAAGCACGUGGCACAGAUCCUGGACUCCCGGAUGAACACUAAGUACGACGAGAAUGACAAGCUGAUCCGGGAAGUGAAAGUGAUCACCCUGAAGUCCAAGCUGGUGUCCGAUUUCCGGAAGGAUUUCCAGUUUUACAAAGUGCGCGAGAUCAACAACUACCACCACGCCCACGACGCCUACCUGAACGCCGUCGUGGGAACCGCCCUGAUCAAAAAGUACCCUAAGCUGGAAAGCGAGUUCGUGUACGGCGACUACAAGGUGUACGACGUGCGGAAGAUGAUCGCCAAGAGCGAGCAGGAAAUCGGCAAGGCUACCGCCAAGUACUUCUUCUACAGCAACAUCAUGAACUUUUUCAAGACCGAGAUUACCCUGGCCAACGGCGAGAUCCGGAAGCGGCCUCUGAUCGAGACAAACGGCGAAACCGGGGAGAUCGUGUGGGAUAAGGGCCGGGAUUUUGCCACCGUGCGGAAAGUGCUGAGCAUGCCCCAAGUGAAUAUCGUGAAAAAGACCGAGGUGCAGACAGGCGGCUUCAGCAAAGAGUCUAUCCUGCCCAAGAGGAACAGCGAUAAGCUGAUCGCCAGAAAGAAGGACUGGGACCCUAAGAAGUACGGCGGCUUCGACAGCCCCACCGUGGCCUAUUCUGUGCUGGUGGUGGCCAAAGUGGAAAAGGGCAAGUCCAAGAAACUGAAGAGUGUGAAAGAGCUGCUGGGGAUCACCAUCAUGGAAAGAAGCAGCUUCGAGAAGAAUCCCAUCGACUUUCUGGAAGCCAAGGGCUACAAAGAAGUGAAAAAGGACCUGAUCAUCAAGCUGCCUAAGUACUCCCUGUUCGAGCUGGAAAACGGCCGGAAGAGAAUGCUGGCCUCUGCCGGCGAACUGCAGAAGGGAAACGAACUGGCCCUGCCCUCCAAAUAUGUGAACUUCCUGUACCUGGCCAGCCACUAUGAGAAGCUGAAGGGCUCCCCCGAGGAUAAUGAGCAGAAACAGCUGUUUGUGGAACAGCACAAGCACUACCUGGACGAGAUCAUCGAGCAGAUCAGCGAGUUCUCCAAGAGAGUGAUCCUGGCCGACGCUAAUCUGGACAAAGUGCUGUCCGCCUACAACAAGCACCGGGAUAAGCCCAUCAGAGAGCAGGCCGAGAAUAUCAUCCACCUGUUUACCCUGACCAAUCUGGGAGCCCCUGCCGCCUUCAAGUACUUUGACACCACCAUCGACCGGAAGAGGUACACCAGCACCAAAGAGGUGCUGGACGCCACCCUGAUCCACCAGAGCAUCACCGGCCUGUACGAGACACGGAUCGACCUGUCUCAGCUGGGAGGCGACAAAAGGCCGGCGGCCACGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAG。

(4) genotype identification of the F0 generation;

extracting F0-generation rat genome DNA by a phenol chloroform extraction method, designing primers to respectively amplify sequences near Mdr1a and Mdr1b gene targets, connecting a vector for sequencing, and identifying the gene mutation condition;

(5) f0 generation breeding and F1 generation genotype identification;

combining the F0 generation carrying the available mutation of Mdr1a/1b with the wild type, extracting the F1 generation genome, performing PCR amplification on a target gene fragment (namely, sequences near Mdr1a and Mdr1b gene targets), and sequencing the amplified product by a company;

(6) f1 generation breeding and F2 generation genotype identification;

mating female and male individuals carrying Mdr1a/1b and capable of using F1 to obtain F2 generations, extracting a genome of F2 generations, carrying out PCR amplification on a target gene fragment (namely sequences near Mdr1a and Mdr1b gene targets), and sequencing amplified products by a company to obtain an individual subjected to Mdr1a/1b gene knockout;

(7) detecting off-target effect;

according to the predicted website http:// cas9. winp. net/, finding out the sites with higher probability of off-target caused by sgRNA of Mdr1a or Mdr1b, and designing primers to verify whether the sites are mutated.

When the phenomenon of off-target caused by sgRNA aiming at Mdr1a is detected, specific information of selected potential off-target sites and primers is as follows:

when the phenomenon of off-target caused by sgRNA aiming at Mdr1b is detected, specific information of selected potential off-target sites and primers is as follows:

the invention also provides application of the method for double gene knockout of Mdr1a/1b in constructing an Mdr1a/1b gene knockout rat model.

The invention also provides a target point sequence, wherein the Mdr1a gene target point sequence is 5'-AGATAGCTTTGCAAATGT-3' (SEQ ID NO. 1); the Mdr1b gene target sequence is 5'-CCTCCTGATGCTGGTGTT-3' (SEQ ID NO. 2).

The invention also provides a synthetic method of sgRNA, firstly synthesizing an Oligo fragment with the length of 60bp, wherein the Oligo fragment comprises a sequence of a knockout target and a T7 promoter; then, taking the Oligo fragment as a template, synthesizing a complete sgRNA double-chain template with the length of 130bp through an overlapping PCR reaction, and extracting and separating the sgRNA double-chain template by a phenol chloroform extraction method; and finally, carrying out in-vitro transcription on the sgRNA double-chain template by using a T7 in-vitro transcription kit, and extracting and separating a transcription product by adopting a phenol chloroform extraction method to obtain the sgRNA. Wherein the sequence of the Oligo fragment containing the Mdr1a gene knockout target is 5' -GATCACTAATACGACTCACTATAGGAGATAGCTTTGCAAATGTGTTTTAGAGCTAGAAAT-3' (SEQ ID NO. 3); the sequence of Oligo fragment containing Mdr1b gene knockout target is 5' -GATCACTAATACGACTCACTATAGGCCTCCTGATGCTGGTGTTGTTTTAGAGCTAGAAAT-3' (SEQ ID NO. 4). The underlined region is the target sequence.

The invention also provides a sgRNA and Cas9mRNA microscopic co-injection method, wherein the sgRNA is the sgRNA of Mdr1a and Mdr1b genes, and the concentration ratio of the sgRNA of the Mdr1a gene to the sgRNA of the Mdr1b gene to the Cas9mRNA is 1-2: 1-2: 1-2; preferably, 1: 1: 2; for example, the sgRNA concentration of Mdr1a and Mdr1b genes is 25ng/mL, and the Cas9mRNA concentration is 50 ng/mL.

The invention also provides a primer sequence for amplifying a sequence near the Mdr1a gene target, wherein the upstream primer sequence is 5'-GGGAAATACTCACCATCCAA-3' (SEQ ID NO.5), the downstream primer sequence is 5'-AGCCTCCACTACATAGACCACT-3' (SEQ ID NO.6), and the length of a PCR product is 795 bp.

The invention also provides a primer sequence for amplifying a sequence near the Mdr1b gene target, wherein the upstream primer sequence is 5'-TGTTTCTCCTCAGTGGTTGTAG-3' (SEQ ID NO.7), the downstream primer sequence is 5'-CACCGCCTTTCACAGCACAA-3' (SEQ ID NO.8), and the length of a PCR product is 969 bp.

The invention also provides a PCR amplification method of the sequence near the Mdr1a gene target spot, wherein the upstream primer sequence is SEQ ID NO.5, the downstream primer sequence is SEQ ID NO.6, the length of the PCR product is 795bp, the annealing temperature is 56-64 ℃, and the cycle number is 25-35; preferably, the annealing temperature is 62 ℃ and the number of cycles is 30.

The invention also provides a PCR amplification method of the sequence near the Mdr1b gene target spot, wherein the upstream primer sequence is SEQ ID NO.7, the downstream primer sequence is SEQ ID NO.8, the length of the PCR product is 969bp, the annealing temperature is 56-64 ℃, and the cycle number is 25-35; preferably, the annealing temperature is 58 ℃ and the number of cycles is 30.

The invention also provides a method for detecting the off-target phenomenon caused by sgRNA aiming at Mdr1a, and the specific information of the selected potential off-target sites and the used primers is as follows:

the invention also provides a method for detecting the off-target phenomenon caused by sgRNA aiming at Mdr1b, and the specific information of the selected potential off-target sites and the used primers is as follows:

the invention provides a method for double-gene knockout of Mdr1a/1b based on CRISPR/Cas9 technology for the first time, and the method is applied to the construction of a gene knockout rat model, and has the advantages that:

(1) compared with ZFN and TALEN technologies, the CRISPR/Cas9 technology has the advantages of low cost, simple operation and high targeting precision as a third-generation gene editing technology, can realize simultaneous knockout of multiple genes, and has almost no species limitation.

(2) Compared with a mouse, the rat has large volume and blood volume, and is more convenient for experimental study; in addition, data in the NCBI database show that rat P-gp is more similar to human, whether at the genomic, mRNA or protein level. Therefore, the rat model is more valuable than the mouse model in experimental studies on P-gp.

(3) The method for double gene knockout of Mdr1a/1b can be used for constructing an Mdr1a/1b gene knockout rat model and provides a new animal model for researching the functions of P-g, such as mediating the transportation of drugs.

(4) The invention firstly utilizes CRISPR/Cas9 technology to knock out the gene of rat P-gp, obtains F0 generation chimeric rat through Mdr1a and Mdr1b target point design, sgRNA in vitro synthesis and transcription, pseudopregnant rat preparation, fertilized egg in vitro microinjection, embryo transplantation and other processes, and finally obtains Mdr1a/1b double-gene knock-out homozygote rat through two generations of breeding and screening. No off-target phenomenon was observed in the resulting knockout rats as verified by the T7EI endonuclease.

Drawings

FIG. 1F0 generation rat genotyping. (A) Agarose gel electrophoresis results of the amplification products of rat Mdr1a gene # 1-15. The left-most side is a DNA Marker, and the arrow indicates a band with a mutation. Wherein, two bands appear in 7# and 10#, only one small band exists in 11#, and the rest 12 bands are normal single bands. (B) The result of agarose gel electrophoresis after treatment of the 1-15# rat Mdr1a gene amplification product with T7EI enzyme. The left-most side is a DNA Marker, and the arrow indicates the mutated band. Wherein, double stripes appear in 1#,2#,3#,5#,6#,7#,9#,10#, and 13#, 11# only has a small stripe, and 4#, 8#, 12#, 14#, and 15# are normal single stripes.

FIG. 2F2 generation rat Mdr1a genotype identification. (A) Sequencing peak images of WT, HZ and KO rat Mdr1a genes at the F2 generation. Each single peak represents one base. The peak patterns of WT and KO rats were single, and those of HZ rats were both nested peaks from the site of base deletion. (B) HZ at F2 generation and Mdr1a gene of KO rat. The underlined region is the target sequence.

FIG. 3F2 generation rat Mdr1b genotype identification. (A) Sequencing peak images of WT, HZ and KO rat Mdr1b genes at the F2 generation. Each single peak represents one base. The peak patterns of WT and KO rats were single, and those of HZ rats were both nested peaks from the site of base deletion. (B) HZ at F2 generation and Mdr1b gene of KO rat. The underlined region is the target sequence.

FIG. 4Mdr1a/1b KO rat off-target effect assay. PCR amplification is carried out by taking genome DNA as a template, and an electrophoresis band of an amplification product is single after the amplification product is treated by T7EI enzyme.

Detailed Description

The present invention will be described in further detail with reference to the following specific examples and the accompanying drawings. The procedures, conditions, experimental methods and the like for carrying out the present invention are general knowledge and common general knowledge in the art except for the contents specifically mentioned below, and the present invention is not particularly limited.

Example 1 selection of Mdr1a and Mdr1b targets

The Mdr1a and Mdr1b gene sequences of rat (Rattus norvegicus (Norway rat)) were found in NCBI database, followed by the start codon and stop codon of the gene, and the exon regions were marked. Since the first two exon sequences of the Mdr1a and Mdr1b genes are short (the number of bases is less than 70bp), the target site is selected on the third exon. And inputting the third exon sequences of the two genes into an online target point prediction website in sequence to obtain two target points with the length of 18 bp.

Wherein the online target point prediction website is http:// zifit.paratners.org/ZiFiT/ChoiceMenu.aspx; the Mdr1a gene target sequence is 5'-AGATAGCTTTGCAAATGT-3' (SEQ ID NO. 1); the Mdr1b gene target sequence is 5'-CCTCCTGATGCTGGTGTT-3' (SEQ ID NO. 2).

Example 2 Synthesis and extraction of sgRNA

Firstly, synthesizing an Oligo fragment with the length of 60bp, wherein the Oligo fragment comprises a sequence of a knockout target and a T7 promoter; then, by taking the Oligo fragment as a template, synthesizing a complete sgRNA double-stranded template with the length of 130bp by an overlapping PCR reaction, and extracting and separating the sgRNA double-stranded template by a phenol chloroform extraction method; and finally, carrying out in-vitro transcription on the sgRNA double-chain template by using a T7 in-vitro transcription kit, and extracting and separating a transcription product by adopting a phenol chloroform extraction method to obtain the sgRNA.

Example 3sgRNA and Cas9mRNA Co-injection and embryo transplantation

(1) Preparation of pseudopregnant mice. Selecting strong male SD rats aged for more than 8 weeks for sterilization operation, and selecting strong female SD rats aged for 7-8 weeks to mate with the sterilized male rats. Mated females will show signs of pregnancy, i.e., the desired pseudopregnant mice.

(2) Collecting fertilized eggs and microinjecting. Robust 6-7 week old female SD rats are selected for superovulation and then mated with robust normal bearing male rats. The day after mating, the female mouse is sacrificed and the fertilized egg is taken for standby. Before microinjection, collected fertilized eggs are put into embryo culture medium at 37 ℃ in CO₂Culturing for 3-4h in an incubator, then uniformly mixing sgRNA of Mdr1a and Mdr1b and Cas9mRNA, and injecting the mixture into cytoplasm of fertilized eggs. Wherein, the concentration of both sgRNAs is 25ng/mL, and the concentration of Cas9mRNA is 50 ng/mL.

(3) And (5) embryo transplantation. And (3) placing the fertilized eggs subjected to microinjection into a cell culture box for overnight culture, then transplanting the single-cell embryos to the oviduct of the pseudopregnant mouse, and finally placing the pseudopregnant mouse into a cage for normal feeding.

Example 4 genotyping of F0-Generation rats

(1) F0 rat genome extraction. The toes of rats were separated around one week after birth, at which time the F0 generation rats were randomly numbered and the corresponding toes were clipped and collected into labeled 1.5mL centrifuge tubes and the genome was extracted with phenol chloroform for use.

(2) And (3) designing and verifying primers. Sequences of approximately 1000bp (approximately 500bp upstream and downstream of the target) were selected near the target of the Mdr1a and Mdr1b genes and input to the Primer Premier software, and the better primers predicted by the software were selected for synthesis. After the primer synthesis, the genome of wild rat is first amplified and several annealing temperatures of 54 deg.c, 56 deg.c, 58 deg.c, 60 deg.c, 62 deg.c and 64 deg.c are selected. And (3) carrying out agarose gel electrophoresis on the amplified product, analyzing and comparing the different primers and the band brightness at different annealing temperatures, and finally selecting the primer with a bright and single band for subsequent experiments. Wherein the Mdr1a gene upstream primer sequence is 5'-GGGAAATACTCACCATCCAA-3' (SEQ ID NO.5), the downstream primer sequence is 5'-AGCCTCCACTACATAGACCACT-3' (SEQ ID NO.6), the length of the PCR product is 795bp, and the optimal annealing temperature is 62 ℃; the sequence of the Mdr1b gene upstream primer is 5'-TGTTTCTCCTCAGTGGTTGTAG-3' (SEQ ID NO.7), the sequence of the downstream primer is 5'-CACCGCCTTTCACAGCACAA-3' (SEQ ID NO.8), the length of the PCR product is 969bp, and the optimal annealing temperature is 58 ℃.

(3) The F0 rat genome was amplified and subjected to agarose gel electrophoresis. The Mdr1a gene in the F0 rat genome was amplified by using the validated primers, and the reaction system was 20. mu.L, the cycle number was 30, and the annealing temperature was 62 ℃. 1.5% (w/v) agarose gel was prepared, and 10. mu.L of the PCR product was subjected to agarose gel electrophoresis and photographed using a full-automatic gel imaging analysis system, and the result is shown in FIG. 1 (A). Since the target is located between the upstream and downstream primers, when a large fragment insertion or deletion mutation occurs near the target, a new band larger or smaller than the expected band may occur after agarose gel electrophoresis, accordingly. The electrophoresis results of 7#, 10#,11# F0 all showed bands shorter than the expected length (795bp), indicating that the 3 rats had large fragment of base deletion, resulting in PCR products shorter than expected. The PCR product length of the remaining 12 rats roughly corresponded to the expected product length, and there were two cases, one in which no change occurred in the rat genome, and the other in which the number of base insertions or deletions was too small to be detected by agarose gel electrophoresis.

(4) And carrying out enzyme digestion and agarose gel electrophoresis on the PCR product. The 10. mu.L of the PCR product remaining in (3) was gradient annealed, and then, T7EI endonuclease was added and digested in a 37 ℃ incubator for 30 min. Preparing 1.5% (w/v) agarose gel, carrying out agarose gel electrophoresis on the digestion product, photographing by using a full-automatic gel imaging analysis system, and comparing with the agarose gel electrophoresis result before digestion, wherein the result is shown in a figure 1 (B). The T7EI endonuclease can recognize and cut mismatched heteroduplex, if the F0 generation rat has insertion or deletion mutation, the PCR product is annealed and then treated by T7EI enzyme digestion, and a plurality of bands appear during agarose gel electrophoresis. Double bands appear in 1#,2#,3#,5#,6#,7#,9#,10#, and 13#, which indicates that insertion or deletion of base occurs. 11# has only one band shorter than the expected length (795bp), and it is possible that long fragment base deletion occurs, but PCR amplification is mainly based on the deletion type product, and no heteroduplex can be formed during annealing, so that only one band is remained after T7EI enzyme treatment. The electrophoresis results of 4#, 8#, 12#, 14#, and 15# have only one band, which is indicated as WT.

(5) And (5) recovering and purifying PCR products. 10F 0 rats (1#,2#,3#,5#,6#,7#,9#,10#,11#,13#) which may have Mdr1a gene insertion or deletion mutation are selected to amplify sequences near Mdr1a and Mdr1b gene targets, 1.5% (w/V) agarose gel is prepared, and a PCR product is electrophoresed for about 30min under the voltage of 120V until the limit between bands is clear. The gel was placed in an ultraviolet analyzer, the bright band was cut off with a razor blade, and the gel was placed in a 1.5mL centrifuge tube, and the DNA was extracted with an agarose gel DNA recovery kit. The purified DNA solution was subjected to concentration measurement and then stored in a refrigerator at-20 ℃ for future use.

(6) And connecting the PCR product with a carrier for amplification culture. The purified PCR product was ligated to pMD18-T vector, transformed into Trans 5. alpha. competent cells, and plated on ampicillin-resistant LB solid medium plate for overnight culture at 37 ℃.

Ampicillin-resistant LB liquid medium was prepared and then divided into a number of tubes (approximately 5mL of medium per tube) as required for the experiment in a clean bench. Selecting single colony with proper size and round shape, picking the single colony by a gun head, pumping the single colony into a test tube, tightly suspending the cover of the test tube, and then placing the test tube into a constant temperature shaking table (37 ℃,220rpm) overnight. Of these, 5 monoclonal colonies were picked per plate.

(7) And (5) plasmid extraction and sequencing. And extracting the plasmids in the bacterial liquid according to the requirements of the plasmid miniextract kit, measuring the concentration, and then sending to a sequencing company for sequencing. The sequencing results returned by the sequencing company are compared with the sequences of Mdr1a and Mdr1b genes in the NCBI database, and the gene mutation condition of each rat is determined. If and only if mutations in which the number of base insertions or deletions occurring in an exon is an integral multiple other than 3 are useful mutations in gene knock-out, 10F 0 rats tested all carry useful mutations with respect to Mdr1a gene; for the Mdr1b gene, only 2#, 5#,6#,7#,9#, and 10# F0 rats carried available mutations. The F0 generation rats carrying the available mutation together with Mdr1a/1b were left and the remaining rats were discarded.

Example 5 breeding of rats in the F0 generation and genotyping of rats in the F1 generation

(1) Breeding of F0 generation rat. When the F0 generation rats grow to 8 weeks of age, F0 generation rats carrying Mdr1a/1b available mutation and wild type rats of about 8 weeks of age are combined in cages. (hereinafter, 2# F0 and WT rat are combined as an example)

(2) And F1 generation rat genotype identification. Theoretically, at most one mutation type appears in each gene of each F1 rat, so that the genomic DNA can be directly sequenced after PCR amplification. Extracting the F1 rat genome, amplifying the target gene segment by PCR, and sending the amplified product to the company for sequencing. And comparing the sequencing result returned by the sequencing company with the gene sequence in the NCBI database to determine the gene mutation condition of each rat. In summary, four different genotypes appeared at the F1 generation, namely wild type, Mdr1a (+/-) carrying only the Mdr1a gene mutation, Mdr1b (+/-) carrying only the Mdr1b gene mutation, and Mdr1a (+/-)/1b (+/-) carrying both Mdr1a and Mdr1b gene mutations. Only rats carrying the Mdr1a/1b available mutation were left, and the remaining rats were discarded.

Example 6 breeding of rats in the F1 generation and genotyping of rats in the F2 generation

(1) Breeding in F1 generation rat. After the F1 generation rats grow to 8 weeks of age, male and female rats with the same gene mutation condition are selected for cage combination.

(2) And F2 generation rat genotype identification. According to the free combination law of genes, the F2 generation rats can present three genotypes, namely Wild type (Wild type, WT), heterozygote type (Heterozygous type, HZ) and homozygosity mutant type (Homozygous type). The homozygous mutant is a Knock-out (KO) gene. Extracting the F2 rat genome, amplifying the target gene segment by PCR, and sending the amplified product to the company for sequencing. The sequencing results were analyzed, and FIG. 2 shows the identification result of Mdr1a gene, and FIG. 3 shows the identification result of Mdr1b gene. In FIGS. 2 and 3, the graph (A) shows the sequencing peaks, and the graph (B) shows the specific deletion of bases. In panel (A), there is only one PCR product from WT and KO rats, and sequencing can obtain a single peak; there were two HZ rat PCR products, which all appeared as a mantle peak after the position where the mutation occurred during sequencing.

Example 7 detection of the off-target Effect in KO rats

(1) Selection of potential off-target sites and primer synthesis. Finding an Off-target (Off-target) effect prediction website (http:// cas9. winp. net /), inputting the sequences of knockout targets of Mdr1a and Mdr1b, and obtaining a plurality of sites with potential Off-target possibility at the same time. Selecting several sites with high off-target possibility, designing corresponding primers by using Primer Premier Primer design software, simultaneously selecting several annealing temperatures of 50 ℃, 53 ℃, 56 ℃, 59 ℃, 62 ℃ and 65 ℃ to amplify the genome of the WT rat, selecting proper primers and optimal annealing temperatures thereof according to the result of agarose gel electrophoresis of a PCR product, and using the primers and optimal annealing temperatures for verification of the KO rat.

Wherein, the Mdr1a target point and the selected potential off-target site are as follows:

the specific information of the primers designed according to the sequences of the potential off-target sites is as follows:

wherein, the Mdr1b target point and the selected potential off-target site are as follows:

(2) and carrying out enzyme digestion verification on the target gene amplified by the PCR and T7 EI. Randomly select 3 KO rats, and amplify the target fragment by using the designed primers of potential off-target sites, wherein the reaction system is 20 mu L and the cycle number is 30. Taking out 10 mu L of the amplification product, carrying out gradient annealing and carrying out enzyme digestion reaction. Preparing 1.5% agarose gel, adding 6 XDNA sample buffer solution into PCR products before and after T7EI enzyme treatment, mixing, sampling 8 μ L sample, performing 120V electrophoresis for 30min, and taking pictures by using a full-automatic gel imaging analysis system, wherein the result is shown in figure 4. Comparing the results of agarose gel electrophoresis before and after enzyme digestion, if a double band appears after the T7EI enzyme treatment, the off-target phenomenon exists. As can be seen from the figure, the electrophoretic bands of all PCR products are single and consistent in size after the T7EI enzyme treatment, which indicates that no off-target phenomenon occurs in the Mdr1a/1b KO rat at all the sites.

The protection of the present invention is not limited to the above embodiments. Variations and advantages that may occur to those skilled in the art may be incorporated into the invention without departing from the spirit and scope of the inventive concept, and the scope of the appended claims is intended to be protected.

SEQUENCE LISTING

<110> university of east China

<120> Mdr1a/1b double-gene knockout method and application

<160> 44

<170> PatentIn version 3.3

<210> 1

<211> 18

<212> DNA

<213> Artificial sequence

<400> 1

agatagcttt gcaaatgt 18

<210> 2

<211> 18

<212> DNA

<213> Artificial sequence

<400> 2

cctcctgatg ctggtgtt 18

<210> 3

<211> 60

<212> DNA

<213> Artificial sequence

<400> 3

gatcactaat acgactcact ataggagata gctttgcaaa tgtgttttag agctagaaat 60

<210> 4

<211> 60

<212> DNA

<213> Artificial sequence

<400> 4

gatcactaat acgactcact ataggcctcc tgatgctggt gttgttttag agctagaaat 60

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence

<400> 5

gggaaatact caccatccaa 20

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence

<400> 6

agcctccact acatagacca ct 22

<210> 7

<211> 22

<212> DNA

<213> Artificial sequence

<400> 7

tgtttctcct cagtggttgt ag 22

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence

<400> 8

caccgccttt cacagcacaa 20

<210> 9

<211> 21

<212> DNA

<213> Artificial sequence

<400> 9

agatagcttt gcaaatgtag g 21

<210> 10

<211> 19

<212> DNA

<213> Artificial sequence

<400> 10

atagctatgc aaatgtagg 19

<210> 11

<211> 21

<212> DNA

<213> Artificial sequence

<400> 11

agatatattt gcaaatgttg g 21

<210> 12

<211> 21

<212> DNA

<213> Artificial sequence

<400> 12

agatagatct gcaaatgtag g 21

<210> 13

<211> 21

<212> DNA

<213> Artificial sequence

<400> 13

agaatgcttt gcaaatgttg g 21

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence

<400> 14

ggtcaaggct ttactcatat 20

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence

<400> 15

tgtaggacta taagtggtgc 20

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence

<400> 16

aaacaagaac ttagccacag 20

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence

<400> 17

gtatccctta caaagcaaca 20

<210> 18

<211> 20

<212> DNA

<213> Artificial sequence

<400> 18

cttgggaagc atagcagaca 20

<210> 19

<211> 20

<212> DNA

<213> Artificial sequence

<400> 19

ccatattcta aggcccatct 20

<210> 20

<211> 20

<212> DNA

<213> Artificial sequence

<400> 20

ggcgtacaaa gtgacaagat 20

<210> 21

<211> 22

<212> DNA

<213> Artificial sequence

<400> 21

tcaaaggaat gaagactgaa at 22

<210> 22

<211> 21

<212> DNA

<213> Artificial sequence

<400> 22

cctcctgatg ctggtgttcg g 21

<210> 23

<211> 21

<212> DNA

<213> Artificial sequence

<400> 23

cctcctgacg ctggtgttag g 21

<210> 24

<211> 20

<212> DNA

<213> Artificial sequence

<400> 24

ctcctgctgc tggtgttggg 20

<210> 25

<211> 21

<212> DNA

<213> Artificial sequence

<400> 25

ccccctgaag ctggtgttgg g 21

<210> 26

<211> 19

<212> DNA

<213> Artificial sequence

<400> 26

tcctgttgct ggtgtttgg 19

<210> 27

<211> 19

<212> DNA

<213> Artificial sequence

<400> 27

tcctggtgct ggtgtttgg 19

<210> 28

<211> 19

<212> DNA

<213> Artificial sequence

<400> 28

tcctgaagct ggtgttggg 19

<210> 29

<211> 19

<212> DNA

<213> Artificial sequence

<400> 29

tcctgaggct ggtgttagg 19

<210> 30

<211> 24

<212> DNA

<213> Artificial sequence

<400> 30

tcaaatccac agtgatctgc ctac 24

<210> 31

<211> 20

<212> DNA

<213> Artificial sequence

<400> 31

aaacgcttcc gactggtgct 20

<210> 32

<211> 21

<212> DNA

<213> Artificial sequence

<400> 32

ttctgcctgg tcaaagagtg g 21

<210> 33

<211> 22

<212> DNA

<213> Artificial sequence

<400> 33

aactgccttc ttgtgcttgc tt 22

<210> 34

<211> 20

<212> DNA

<213> Artificial sequence

<400> 34

aagggaagat accgttctgg 20

<210> 35

<211> 20

<212> DNA

<213> Artificial sequence

<400> 35

ctgagccatt gatccccact 20

<210> 36

<211> 20

<212> DNA

<213> Artificial sequence

<400> 36

ggggctgtcc ctgtttatcc 20

<210> 37

<211> 21

<212> DNA

<213> Artificial sequence

<400> 37

ccctcctgtg agtgccttta c 21

<210> 38

<211> 20

<212> DNA

<213> Artificial sequence

<400> 38

tttgcccatt gcagcaactt 20

<210> 39

<211> 24

<212> DNA

<213> Artificial sequence

<400> 39

ccccaggaag gaacgtaata agag 24

<210> 40

<211> 21

<212> DNA

<213> Artificial sequence

<400> 40

agtggtcttt ggctagagtg g 21

<210> 41

<211> 20

<212> DNA

<213> Artificial sequence

<400> 41

tgtggtcctg gctatgatgc 20

<210> 42

<211> 21

<212> DNA

<213> Artificial sequence

<400> 42

gggagcatgt gcccactatc c 21

<210> 43

<211> 20

<212> DNA

<213> Artificial sequence

<400> 43

agaaccaccg aaggcagaca 20

<210> 44

<211> 4269

<212> RNA

<213> Artificial sequence

<400> 44

auggacuaua aggaccacga cggagacuac aaggaucaug auauugauua caaagacgau 60

gacgauaaga uggccccaaa gaagaagcgg aaggucggua uccacggagu cccagcagcc 120

gacaagaagu acagcaucgg ccuggacauc ggcaccaacu cugugggcug ggccgugauc 180

accgacgagu acaaggugcc cagcaagaaa uucaaggugc ugggcaacac cgaccggcac 240

agcaucaaga agaaccugau cggagcccug cuguucgaca gcggcgaaac agccgaggcc 300

acccggcuga agagaaccgc cagaagaaga uacaccagac ggaagaaccg gaucugcuau 360

cugcaagaga ucuucagcaa cgagauggcc aagguggacg acagcuucuu ccacagacug 420

gaagaguccu uccuggugga agaggauaag aagcacgagc ggcaccccau cuucggcaac 480

aucguggacg agguggccua ccacgagaag uaccccacca ucuaccaccu gagaaagaaa 540

cugguggaca gcaccgacaa ggccgaccug cggcugaucu aucuggcccu ggcccacaug 600

aucaaguucc ggggccacuu ccugaucgag ggcgaccuga accccgacaa cagcgacgug 660

gacaagcugu ucauccagcu ggugcagacc uacaaccagc uguucgagga aaaccccauc 720

aacgccagcg gcguggacgc caaggccauc cugucugcca gacugagcaa gagcagacgg 780

cuggaaaauc ugaucgccca gcugcccggc gagaagaaga auggccuguu cggaaaccug 840

auugcccuga gccugggccu gacccccaac uucaagagca acuucgaccu ggccgaggau 900

gccaaacugc agcugagcaa ggacaccuac gacgacgacc uggacaaccu gcuggcccag 960

aucggcgacc aguacgccga ccuguuucug gccgccaaga accuguccga cgccauccug 1020

cugagcgaca uccugagagu gaacaccgag aucaccaagg ccccccugag cgccucuaug 1080

aucaagagau acgacgagca ccaccaggac cugacccugc ugaaagcucu cgugcggcag 1140

cagcugccug agaaguacaa agagauuuuc uucgaccaga gcaagaacgg cuacgccggc 1200

uacauugacg gcggagccag ccaggaagag uucuacaagu ucaucaagcc cauccuggaa 1260

aagauggacg gcaccgagga acugcucgug aagcugaaca gagaggaccu gcugcggaag 1320

cagcggaccu ucgacaacgg cagcaucccc caccagaucc accugggaga gcugcacgcc 1380

auucugcggc ggcaggaaga uuuuuaccca uuccugaagg acaaccggga aaagaucgag 1440

aagauccuga ccuuccgcau ccccuacuac gugggcccuc uggccagggg aaacagcaga 1500

uucgccugga ugaccagaaa gagcgaggaa accaucaccc ccuggaacuu cgaggaagug 1560

guggacaagg gcgcuuccgc ccagagcuuc aucgagcgga ugaccaacuu cgauaagaac 1620

cugcccaacg agaaggugcu gcccaagcac agccugcugu acgaguacuu caccguguau 1680

aacgagcuga ccaaagugaa auacgugacc gagggaauga gaaagcccgc cuuccugagc 1740

ggcgagcaga aaaaggccau cguggaccug cuguucaaga ccaaccggaa agugaccgug 1800

aagcagcuga aagaggacua cuucaagaaa aucgagugcu ucgacuccgu ggaaaucucc 1860

ggcguggaag aucgguucaa cgccucccug ggcacauacc acgaucugcu gaaaauuauc 1920

aaggacaagg acuuccugga caaugaggaa aacgaggaca uucuggaaga uaucgugcug 1980

acccugacac uguuugagga cagagagaug aucgaggaac ggcugaaaac cuaugcccac 2040

cuguucgacg acaaagugau gaagcagcug aagcggcgga gauacaccgg cuggggcagg 2100

cugagccgga agcugaucaa cggcauccgg gacaagcagu ccggcaagac aauccuggau 2160

uuccugaagu ccgacggcuu cgccaacaga aacuucaugc agcugaucca cgacgacagc 2220

cugaccuuua aagaggacau ccagaaagcc cagguguccg gccagggcga uagccugcac 2280

gagcacauug ccaaucuggc cggcagcccc gccauuaaga agggcauccu gcagacagug 2340

aagguggugg acgagcucgu gaaagugaug ggccggcaca agcccgagaa caucgugauc 2400

gaaauggcca gagagaacca gaccacccag aagggacaga agaacagccg cgagagaaug 2460

aagcggaucg aagagggcau caaagagcug ggcagccaga uccugaaaga acaccccgug 2520

gaaaacaccc agcugcagaa cgagaagcug uaccuguacu accugcagaa ugggcgggau 2580

auguacgugg accaggaacu ggacaucaac cggcuguccg acuacgaugu ggaccauauc 2640

gugccucaga gcuuucugaa ggacgacucc aucgacaaca aggugcugac cagaagcgac 2700

aagaaccggg gcaagagcga caacgugccc uccgaagagg ucgugaagaa gaugaagaac 2760

uacuggcggc agcugcugaa cgccaagcug auuacccaga gaaaguucga caaucugacc 2820

aaggccgaga gaggcggccu gagcgaacug gauaaggccg gcuucaucaa gagacagcug 2880

guggaaaccc ggcagaucac aaagcacgug gcacagaucc uggacucccg gaugaacacu 2940

aaguacgacg agaaugacaa gcugauccgg gaagugaaag ugaucacccu gaaguccaag 3000

cugguguccg auuuccggaa ggauuuccag uuuuacaaag ugcgcgagau caacaacuac 3060

caccacgccc acgacgccua ccugaacgcc gucgugggaa ccgcccugau caaaaaguac 3120

ccuaagcugg aaagcgaguu cguguacggc gacuacaagg uguacgacgu gcggaagaug 3180

aucgccaaga gcgagcagga aaucggcaag gcuaccgcca aguacuucuu cuacagcaac 3240

aucaugaacu uuuucaagac cgagauuacc cuggccaacg gcgagauccg gaagcggccu 3300

cugaucgaga caaacggcga aaccggggag aucguguggg auaagggccg ggauuuugcc 3360

accgugcgga aagugcugag caugccccaa gugaauaucg ugaaaaagac cgaggugcag 3420

acaggcggcu ucagcaaaga gucuauccug cccaagagga acagcgauaa gcugaucgcc 3480

agaaagaagg acugggaccc uaagaaguac ggcggcuucg acagccccac cguggccuau 3540

ucugugcugg ugguggccaa aguggaaaag ggcaagucca agaaacugaa gagugugaaa 3600

gagcugcugg ggaucaccau cauggaaaga agcagcuucg agaagaaucc caucgacuuu 3660

cuggaagcca agggcuacaa agaagugaaa aaggaccuga ucaucaagcu gccuaaguac 3720

ucccuguucg agcuggaaaa cggccggaag agaaugcugg ccucugccgg cgaacugcag 3780

aagggaaacg aacuggcccu gcccuccaaa uaugugaacu uccuguaccu ggccagccac 3840

uaugagaagc ugaagggcuc ccccgaggau aaugagcaga aacagcuguu uguggaacag 3900

cacaagcacu accuggacga gaucaucgag cagaucagcg aguucuccaa gagagugauc 3960

cuggccgacg cuaaucugga caaagugcug uccgccuaca acaagcaccg ggauaagccc 4020

aucagagagc aggccgagaa uaucauccac cuguuuaccc ugaccaaucu gggagccccu 4080

gccgccuuca aguacuuuga caccaccauc gaccggaaga gguacaccag caccaaagag 4140

gugcuggacg ccacccugau ccaccagagc aucaccggcc uguacgagac acggaucgac 4200

cugucucagc ugggaggcga caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa 4260

aagaaaaag 4269

Claims

1. A method for double Mdr1a/1b gene knockout, which is characterized by comprising the following steps:

(1) selecting Mdr1a and Mdr1b targets;

selecting Mdr1a and Mdr1b knock-out targets by using an online target prediction website;

(2) synthesizing and extracting sgRNA;

firstly, synthesizing an Oligo fragment with the length of 60bp, wherein the Oligo fragment comprises a sequence of a knockout target and a T7 promoter; then, by taking the Oligo fragment as a template, synthesizing a complete sgRNA double-stranded template with the length of 130bp by an overlapping PCR reaction, and extracting and separating the sgRNA double-stranded template by a phenol chloroform extraction method; finally, carrying out in-vitro transcription on the sgRNA double-stranded template by using a T7 in-vitro transcription kit, and extracting and separating a transcription product to obtain sgRNAs of Mdr1a and Mdr1b genes;

(3) co-injection of sgRNA and Cas9mRNA and embryo transfer;

microinjecting the two sgrnas and Cas9mRNA into fertilized egg plasma of a rat; wherein the sgRNA is the sgRNA of Mdr1a and Mdr1b genes;

(4) genotype identification of the F0 generation;

extracting F0-generation rat genome DNA, designing primers to respectively amplify sequences near Mdr1a and Mdr1b gene targets, connecting a vector for sequencing, and identifying the gene mutation condition;

(5) f0 generation breeding and F1 generation genotype identification;

combining the F0 generation carrying the usable mutation of the Mdr1a/1b and the wild type, extracting the F1 generation genome, carrying out PCR amplification on sequences near Mdr1a and Mdr1b gene targets, and carrying out sequencing;

(6) f1 generation breeding and F2 generation genotype identification;

mating female and male individuals carrying Mdr1a/1b and capable of using mutant F1 generations to obtain F2 generations, extracting F2 generations of genomes, and performing PCR amplification on sequences near Mdr1a and Mdr1b gene targets to obtain Mdr1a/1b gene knockout individuals;

(7) detecting off-target effect;

according to the off-target effect prediction website, the sites with high off-target possibility caused by sgRNA of Mdr1a or Mdr1b are found, and primers are designed to verify whether the sites are mutated.

2. The method of claim 1, wherein in step (1), the Mdr1a knockout target sequence is 5'-AGATAGCTTTGCAAATGT-3' as shown in SEQ ID No. 1; the Mdr1b gene knockout target sequence is 5'-CCTCCTGATGCTGGTGTT-3' shown as SEQ ID NO. 2.

3. The method of claim 1, wherein in step (1), the sequence of the Oligo fragment comprising the Mdr1a gene knockout target is 5' -GATCACTAATACGACTCACTATAGG as shown in SEQ ID NO.3AGATAGCTTTGCAA ATGTGTTTTAGAGCTAGAAAT-3'; the sequence of the Oligo fragment containing the Mdr1b gene knockout target is 5' -GATCACTAATACGACTCACTATAGG shown as SEQ ID NO.4CCTCCTGATGCTGGTGTTGTTTTAGAGCTAGAAAT-3’。

4. The method of claim 1, wherein in step (3), the concentration ratio of sgRNA of Mdr1a gene, sgRNA of Mdr1b gene and Cas9mRNA is 1-2: 1-2; after the two sgRNAs and the Cas9mRNA are mixed, 0.1-0.2 mu L of each fertilized egg is injected.

5. The method of claim 1, wherein in step (7), when the phenomenon of off-target caused by sgRNA directed against Mdr1a is detected, the specific information of the selected potential off-target sites and the primers used are as follows: mdr1a _ off _ 1: an upstream primer GGTCAAGGCTTTACTCATAT, a downstream primer TGTAGGACTATAAGTGGTGC, a product length of 519bp, and an optimal annealing temperature of 56 ℃; mdr1a _ off _ 2: an upstream primer AAACAAGAACTTAGCCACAG and a downstream primer GTATCCCTTACAAAGCAACA, wherein the length of a product is 472bp, and the optimal annealing temperature is 56 ℃; mdr1a _ off _ 3: an upstream primer CTTGGGAAGCATAGCAGACA and a downstream primer CCATATTCTAAGGCCCATCT, wherein the length of a product is 501bp, and the optimal annealing temperature is 56 ℃; mdr1a _ off _ 4: the upstream primer GGCGTACAAAGTGACAAGAT and the downstream primer TCAAAGGAATGAAGACTGAAAT were found to have a product length of 503bp and an optimal annealing temperature of 53 ℃.

6. The method of claim 1, wherein when detecting the phenomenon of off-target caused by sgRNA directed against Mdr1b, the selected potential off-target sites and the specific information on the primers used are: mdr1b _ off _ 1: an upstream primer TCAAATCCACAGTGATCTGCCTAC and a downstream primer AAACGCTTCCGACTGGTGCT, wherein the length of a product is 472bp, and the optimal annealing temperature is 59 ℃; mdr1b _ off _ 2: an upstream primer TTCTGCCTGGTCAAAGAGTGG and a downstream primer AACTGCCTTCTTGTGCTTGCTT, wherein the length of a product is 413bp, and the optimal annealing temperature is 56 ℃; mdr1b _ off _ 3: an upstream primer AAGGGAAGATACCGTTCTGG and a downstream primer CTGAGCCATTGATCCCCACT, wherein the length of a product is 553bp, and the optimal annealing temperature is 56 ℃; mdr1b _ off _ 4: an upstream primer GGGGCTGTCCCTGTTTATCC and a downstream primer CCCTCCTGTGAGTGCCTTTAC, wherein the length of a product is 523bp, and the optimal annealing temperature is 56 ℃; mdr1b _ off _ 5: an upstream primer TTTGCCCATTGCAGCAACTT, a downstream primer CCCCAGGAAGGAACGTAATAAGAG, a product length 563bp and an optimal annealing temperature 56 ℃; mdr1b _ off _ 6: an upstream primer AGTGGTCTTTGGCTAGAGTGG and a downstream primer TGTGGTCCTGGCTATGATGC, wherein the product length is 495bp, and the optimal annealing temperature is 56 ℃; mdr1b _ off _ 7: the upstream primer GGGAGCATGTGCCCACTATCC and the downstream primer AGAACCACCGAAGGCAGACA were found to have a product length of 580bp and an optimal annealing temperature of 56 ℃.

7. The application of the method for Mdr1a/1b double gene knockout of any one of claims 1-6 in constructing an Mdr1a/1b gene knockout rat model.