CN109536616A - Screen the SNP marker and copy number variation method of prolificacy Mauremys mutica female parent - Google Patents

Screen the SNP marker and copy number variation method of prolificacy Mauremys mutica female parent Download PDF

Info

Publication number
CN109536616A
CN109536616A CN201811465384.9A CN201811465384A CN109536616A CN 109536616 A CN109536616 A CN 109536616A CN 201811465384 A CN201811465384 A CN 201811465384A CN 109536616 A CN109536616 A CN 109536616A
Authority
CN
China
Prior art keywords
copy number
pcr
atp6
primer
prolificacy
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201811465384.9A
Other languages
Chinese (zh)
Other versions
CN109536616B (en
Inventor
朱新平
王亚坤
赵建
刘晓莉
李伟
欧阳淑
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pearl River Fisheries Research Institute CAFS
Original Assignee
Pearl River Fisheries Research Institute CAFS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pearl River Fisheries Research Institute CAFS filed Critical Pearl River Fisheries Research Institute CAFS
Priority to CN201811465384.9A priority Critical patent/CN109536616B/en
Publication of CN109536616A publication Critical patent/CN109536616A/en
Application granted granted Critical
Publication of CN109536616B publication Critical patent/CN109536616B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to technical field of molecular marker-assisted breeding, disclose a kind of SNP marker and copy number variation method for screening prolificacy Mauremys mutica female parent, comprising: obtain candidate maternal DNA；Screen the ND1 fragment primer of 3 SNP sites and the primer of ND4 and ATP6 copy number；PCR amplification obtains ND1 segment and the amplified fragments of ND4 and ATP6 is imported plasmid；Sequencing and the copy number that ND4 and ATP6 is obtained according to plasmid concentration；The screening of prolificacy individual is carried out according to the copy number of SNP site and ND4 and ATP6.The present invention carries out paternity test using multiple PCR technique, determines the fertility of each female parent；It is arranged from high to low according to fertility, chooses the highest female tortoise of fertility and construct prolificacy group；The present invention can be used for constructing basic population and carry out subsequent fine-variety breeding work.

Description

Screen the SNP marker and copy number variation method of prolificacy Mauremys mutica female parent
Technical field
The invention belongs to technical field of molecular marker-assisted breeding more particularly to a kind of screening prolificacy Mauremys muticas Maternal SNP marker and copy number variation method.It is maternal to can be used for screening high fertility Mauremys mutica more particularly to one kind Chondriogen SNP marker and copy number variation identification and application.
Background technique
Currently, the prior art commonly used in the trade is such that
The energy that the oxidative phosphorylation occurred in mitochondria generates is the key that organism reproductive success.It is lost as the third generation Label is passed, single nucleotide polymorphism (SNP) is distributed widely in the whole gene group including mitochondrial genomes.Mitochondria Not only the frequency of mutation is high for gene, but also is mutated bring variation and produces great influence to the breeding of biology, is related to fertility, Sperm motility and ovarian dysfunction etc..Copying number variation (Copy number variation) is newly to send out in recent years A kind of existing altered fragments cover whole gene group, and the total nucleotide number to make a variation is far more than the genome knot of SNP site sum Structure variation.Relatively common in the copy online mitochondrial genes of number variation, the stabilization of mitochondria DNA copy number is conducive to egg mother cell Development, the maintenance of rate of fertilization and fertilization egg implantation and embryonic development.Currently, in relation to chondriogen SNP and copy number variation Research with fertility mainly has been reported in mammals.There is not yet in terms of influence of the two to Chelonian fertility Report.
Mauremys mutica be China it is important have economy, one of Hard-shelled Freshwater Turtles of medicinal and ornamental value are emerging One of aquaculture kind.The general 4-5 sexal maturity of Mauremys mutica, the annual 4-8 month breed, and average every female tortoise obtains seedling every year 4-5 is only.As Mauremys mutica propagates scale continuous enlargement artificially, seed yield is asked as one for perplexing the industry development Topic.By reinforcing raising to reproductive population in practical breeding production, food quality and quantity is especially improved, can effectively be made numerous It grows group and obtains more ovum number.Due between breeding individual there are reproductive capacity difference phenomenon, in addition to reinforcing nutrition, How to be excavated out of Mauremys mutica reproductive population, filters out the strong individual of a collection of fertility as reproductive population, with The sustainable development for promoting the industry is problem to be solved.
In conclusion problem of the existing technology is:
(1) in the prior art, not from energy utilization angle, screen and identify line grain relevant to female tortoise fertility Body gene mutation site and copy number do not promote the breeding of prolificacy strain with this, mention for the sustainable development of the industry For genetic resources abundant.
(2) currently, traditional selection is mainly unexpected mass incident, however, since the Mauremys mutica sexal maturity time is long, 4-5 is generally needed from seedling to sexal maturity, so very long sexual maturation cycle is unfavorable for the generation breeding of Mauremys mutica.
(3) Mauremys mutica does not have shield ovum behavior, and egg laying amount, there are individual difference, conventional selection can not be quasi- Really screen the individual of fertility strong (for example egg laying amount is more).
Solve the difficulty and meaning of above-mentioned technical problem:
Difficulty: (1) Mauremys mutica does not have shield ovum behavior, therefore conventional method can not determine the fertility of individual； (2) screening that the high fertility individual of Mauremys mutica is carried out using group breeding method, needs at least to carry out 3 generations breeding ability Determining has the individual for stablizing hereditary potency, breeding excessive cycle.
Meaning: by solving the above technical problem, it on the one hand can use molecular mark selected reproduction ability Strong group eliminates the weak individual of fertility as candidate parent, improves the utilization rate of manpower and material resources and financial resources, another Aspect directly can carry out reinforced cultivating to the young with high fertility arrived using molecular marker screening, improve breeding effect Rate shortens breeding cycle, to accelerate the sustainable development of Mauremys mutica industry.
Summary of the invention
In view of the problems of the existing technology, the present invention provides a kind of for screening Mauremys mutica breeding populations The detection method of SNP site.Using the genomic DNA of primer amplification sample to be tested provided by the invention, then respectively by common PCR is sequenced and determines based on quantitative fluorescent PCR the genotype of each female parent and the copy number of target gene.The present invention can quickly, The strong Mauremys mutica female parent of accurate screening fertility carries out subsequent fine-variety breeding work for constructing basic population.
The invention is realized in this way a kind of SNP marker for screening prolificacy Mauremys mutica female parent and copy number become Different method, comprising:
Step 1 obtains candidate maternal genomic DNA；
Step 2 screens the ND1 fragment primer of 3 SNP sites and the primer of ND4 and ATP6 copy number；PCR amplification obtains It obtains ND1 segment and imports the amplified fragments of ND4 and ATP6 in the big DH5 α of Escherichia coli, and extract plasmid；
Step 3, sequencing and the copy number that ND4 and ATP6 is obtained according to plasmid concentration；
Step 4 carries out the screening of prolificacy individual according to the copy number of SNP site and ND4 and ATP6.
Further, in step 2, the ND1 segment of 3 SNP sites is screened, comprising:
1) ND1 sequence SEQ ID of primer SEQ ID NO:1, primer SEQ ID the NO:2 amplification comprising SNP site is utilized NO:3；
2) sample is collected and DNA is extracted: being carried out paternity test using multiple PCR technique, is determined the breeding of each female parent Ability；It is arranged from high to low according to fertility, chooses the highest female tortoise of fertility and construct prolificacy group, choose breeding energy The minimum female tortoise of power constructs low reproductive capacity group, and preliminary screening goes out SNP site relevant to fertility；It is verified using linear model Candidate SNP site；
3) PCR amplification and sequence analysis: PCR amplification is carried out；
It expands obtained PCR product to be detected with 1.0% agarose gel electrophoresis, using DNA plastic recovery kit to PCR Product is purified, is recycled, and recovery product imports bacillus coli DH 5 alpha after the connection conversion of PMD-19T carrier, is trained by clone Good product progress upstream and downstream bidirectional sequencing is expanded after supporting detection.
Further, it is manually proofreaded after the sequence alignment obtained using 7.0 Duis of software Bioedit, deletes both sides redundancy Base, guarantee sequence both ends alignment；Nucleotide mutant site analysis carries out in software MEGA5.0；
Linear model is constructed using SPSS19.0, candidate SNP locus is verified.
Further, in step 3), PCR reaction system is 50ul, comprising: pcr amplification reaction system: DNA profiling 1 μ L, 2 × 25 μ L of T5Super PCR Mix, upstream and downstream primer (10pmol/ μ L) each 2 μ L, 20 μ L of deionized water；
Amplification condition are as follows:
PCR response procedures: 98 DEG C of initial denaturation 2min；98 DEG C of denaturation 40s, 54 DEG C of annealing 40s, 72 DEG C of extension 50s, 35 are followed Ring；Last 72 DEG C of extensions 10min.
Further, step 3, the method according to the copy number of plasmid concentration acquisition ND4 and ATP6 include:
The first step, sample DNA extract:
The genomic DNA of sample is extracted using phenol-chloroform method or various DNA extraction kits；The total DNA of extraction is with ultraviolet After spectrophotometric determination concentration, 50ng/ μ L is diluted to sterile water；
Second step expands ND4 using primer SEQ ID NO:4, primer SEQ ID NO:5, obtains SEQ ID NO:6 sequence Column；
Third step expands ATP6 using primer SEQ ID NO:7, primer SEQ ID NO:8, obtains sequence SEQ ID NO: 9；
4th step, PCR amplification and Specification Curve of Increasing:
PCR amplification is carried out according to following reaction system, PCR reaction system is 50ul；Include: pcr amplification reaction system: Upstream primer, the downstream primer each 2 of 10pmol/ μ L of 1 μ L, 2 × T5Super PCR Mix of DNA profiling, 25 μ L, 10pmol/ μ L μ L, 20 μ L of deionized water；
PCR response procedures: 98 DEG C of initial denaturation 2min；98 DEG C of denaturation 40s；
Primer optimum temperature annealing 40s, 72 DEG C of extension 50s, 35 recycle；Last 72 DEG C of extensions 10min；
The 1.0% agarose gel electrophoresis detection of obtained PCR product is expanded, using with DNA plastic recovery kit pair PCR product is purified, is recycled, and recovery product imports bacillus coli DH 5 alpha after the connection conversion of PMD-19T carrier, by clone Plasmid is extracted after culture detection, utilizes spectrophotometric determination plasmid concentration；
The copy number of standard items: copy number/μ L=(X × 6.02 × 1023 × 10-9)/(Y × 660) is calculated according to formula；
X: standard items mass concentration ng/ μ L, Y: fragment length bp vector+insert；Finally by standard items by 10 times by Grade is diluted to 7 concentration gradients, constructs the standard curve between copy number and gene magnification CT value；
Quantitative fluorescent PCR reaction system is 20ul, includes:
Absolute quantitation carries out in ABI StepOnePlus fluorescence quantitative PCR instrument, absolute quantitation reaction system: 50ng/ μ L 1 μ L of DNA profiling,10 μ L, 10pmol/ μ L upstream primer of Green Realtime PCR Master Mix, Each 0.5 μ L of 10pmol/ μ L downstream primer, adds deionized water to supply 20 μ L；Reaction carries out in quantitative fluorescent PCR, high light transmission envelope Template die covering sealing；
Amplification and testing conditions are as follows:
After reaction system prepares reagent, reaction plate is placed in ABI stepone plus real-time PCR, is arranged Following procedure: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 40s, 60 annealing 45s, 72 DEG C of extension 30s, 35 recycle；Last 95 DEG C 5s, 60 DEG C of for 30s, and 95 DEG C of for 15s obtain solubility curve；
5th step determines ND4 and ATP6 according to the standard curve of correlativity between the CT value and copy number of gene magnification Copy number；Obtain the equation of linear regression of ND4 and ATP6 copy number and 4 years offspring mean numbers.
Further, the equation of linear regression of ND4 and APT6 copy number and 4 annual subalgebras, is respectively as follows:
ND4:Y=3.99*X-24.40；
ATP6:Y=3.12*X-17.86；
Y indicates that average annual subalgebra, X indicate the copy number of corresponding gene；P < 0.05 indicates that equation has statistical significance.
Further, primer ND4F SEQ ID NO:4 and ND4R SEQ ID NO:5 and ATP6F SEQ ID NO is utilized: 7 and ATP6R SEQ ID NO:8 obtains the plasmid containing carrier and segment according to the 4th step and brings correspondence into after Concentration Testing Formula obtains the predicted value of ND4, ATP6 of each maternal average annual subalgebra；
It is respectively as follows: ND4:Y=1.0007*X+0.0221；ATP6:Y=1.0015*X+0.0248.
Y indicates that average annual subalgebra, X indicate the copy number of corresponding gene.
The above operating process can be completed in two weeks, moreover, it is smaller to the injury of female tortoise, it is more to shorten conventional method progress For the period of unexpected mass incident.
In conclusion advantages of the present invention and good effect are as follows:
Advantage: figure it is seen that the average annual subalgebra of breeding Qian Ji group is 4.91, numerous group of height is sub every year after breeding 27% more than algebra subalgebra more average annual than group, 75% more than low numerous group of average annual subalgebra.As can be seen that compared with before breeding, benefit It is that the average annual subalgebra of parent that label carries out after breeding improves 27% with SNP site, there are biggish breeding potentiality.
(2) from fig. 4, it can be seen that maternal average annual subalgebra predicted value and actual value are consistent substantially, illustrate building It can really reflect the fertility of female tortoise about gene copy number and the regression equation of fertility, be suitable for close tortoise and breed energy The assessment of power.
In addition, start with using from chondriogen SNP, the high frequency of the maternal inheritance characteristics and SNP that have using mitochondria Rate, stability and popularity, while not limited by tissue and organ, provide the flexibility that traditional breeding method does not have And high efficiency.
Good effect: the present invention screens and identifies mitochondria relevant to female tortoise fertility from energy utilization angle Gene mutation site and copy number promote the breeding of prolificacy strain with this, for the industry sustainable development provide it is abundant Genetic resources.
The SNP site and ND4 and ATP6 copy number being related in the present invention are suitable for Mauremys mutica height breeding energy The screening of power group can provide effective genetic marker for promotion Mauremys mutica industry development.
Detailed description of the invention
Fig. 1 is after utilization MEGA5.0 provided in an embodiment of the present invention is analyzed, and the genotype of each sample can identify figure.
In figure: figure A, to represent TT homozygous, is accredited as high numerous individual；Scheme B, be that CC is homozygous, is accredited as low numerous individual；Figure C, it is homozygous to represent GG, is accredited as high numerous individual；Figure D, to represent AA homozygous, is accredited as low numerous individual；Figure E, CC homozygosis is represented Type is accredited as high numerous individual；Figure F, to represent AA homozygous, is accredited as low numerous individual.
Fig. 2 be it is provided in an embodiment of the present invention utilize 3 SNP sites, entire group is divided into high numerous group and numerous group low, and And statistics is numerous group high, the average annual subalgebra figure of low numerous group of female tortoise and entire group.
Fig. 3 is ND4 and APT6 copy number provided in an embodiment of the present invention (conversion of log 10) and female 4 annual subalgebra of tortoise Equation of linear regression figure.
In figure: (A) ND4:Y=3.99*X-24.40；(B) ATP6:Y=3.12*X-17.86.
Fig. 4 is correlativity graph of equation of the building based on predicted value and observation provided in an embodiment of the present invention.
In figure: (A) Y=1.0007*X+0.0221；(B) Y=1.0015*X+0.0248.
Specific embodiment
In order to make the objectives, technical solutions, and advantages of the present invention clearer, with reference to embodiments, to the present invention It is further elaborated.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, it is not used to Limit the present invention.
After the present invention can quickly, accurately screen the strong Mauremys mutica female parent of fertility for constructing basic population progress Continuous fine-variety breeding work.
Application of the invention is further described below with reference to concrete analysis.
The SNP marker of screening prolificacy Mauremys mutica female parent provided in an embodiment of the present invention and copy number variation side Method, comprising:
Step 1 obtains candidate maternal DNA；
Step 2 screens the ND1 fragment primer of 3 SNP sites and the primer of ND4 and ATP6 copy number；PCR amplification obtains It obtains ND1 segment and imports the amplified fragments of ND4 and ATP6 in Escherichia coli α, and extract plasmid；
Step 3, sequencing and the copy number that ND4 and ATP6 is obtained according to plasmid concentration；
Step 4 carries out the screening of prolificacy individual according to the copy number of SNP site and ND4 and ATP6.
The SNP marker method of screening prolificacy Mauremys mutica female parent provided in an embodiment of the present invention, comprising:
(1) the ND1 sequence using following primer amplification comprising SNP site:
Primer is (underscore part in sequence):
Primer F:5'ATAATCCCAATCCTCATCGC 3'SEQ ID NO:1；
Primer R:5'GTATTGGCGGGAGTCCTGAT 3'SEQ ID NO:2；
Extension increasing sequence are as follows: SEQ ID NO:3；
ATAATCCCAATCCTCATCGCCGTAGCTTTTTTCACCCTTATTGAACGCAAAGTACTAGGTTACATACA ACTTCGAAAAGGCCCTAACATCGTAGGCCCACAAGGGTTACTACAACCAGTGGCAGACGGAGTAAAATTATTTATC AAAGAACCAATCTAC(T)CCGCTAAATTCATCAATCACATTATTCACTATTTCACCAATTATAGCTCTAACACTAG CCCTATTAATTTGACTCCCCCTCCCTATACCCTTCCCACTAACTGACCTTAACTTAGGCCTTTTATTTATAATTGC CATCTCCAGTTTCATGGCCTATTCAATTTTATGATCTGGATGAGCTTCAAACTCAAAATATGCCCTA(G)ATAGGG GCCCTACGGGCAGTAGCTCAAACTATCTCATATGAAGTAACCCTGGGAATCATTCTACTTTCCATAATCCTCTTCT CAGGGGGCTTCAACA(C)TACAAACATTTACAATAGTACAAGAACCTATATACTTAATATTCTCCTCCTGACCACT AATGACAATATGATATATTTCCACACTAGCTGAAACTAACCGAGCACCCTTTGATTTAACCGAAGGTGAATCTGAAC TCGTATCGGGATTTAACGTCGAATATGCTGCTGGTCCCTTTGCCCTATTCTTCCTAGCAGAGTACGCAAACATCCTA ATAATAAACACTCTAACTACCATTCTATTTCTAAATCCCGCCCACATCAACAATACCCCAGAATTATTCACCCTATC ACTGATCTCAAAAGCAATACTCTTATCAGCAGGATTCCTATGAATTCGAACCTCCTACCCACGATTCCGATATGACC AACTCATACATCTCCTATGAAAAAACTTCCTCCCAATCACCTTAGCACTATGCTTTTGACACATATCAATACCAATC ACCCTATCAGGACTCCCGCCAATAC
Black is SNP site, when base is respectively T, when G and C homozygote, for high numerous individual.When sample is respectively C, A and It is low numerous individual when A homozygote.Parenthetic letter indicates SNP site.
(2) sample is collected and DNA is extracted
The female Mauremys mutica in 83 13 ages is chosen as experimental subjects, counts hatching within 2013-2016 continuous 4 years Young tortoise number carries out paternity test using multiple PCR technique (this laboratory is in application patent of invention in 2015), determines each mother This fertility (average annual subalgebra).It is arranged from high to low according to fertility (average annual subalgebra number), chooses breeding The highest preceding 21 female tortoises of ability construct " prolificacy " group, choose latter 21 minimum female tortoises of fertility and construct " low breeding Power " group is used for preliminary screening SNP site relevant to fertility.Candidate SNP site is verified using general linear model to exist The applicability of 83 female tortoises.
The genomic DNA of sample is extracted using ordinary skill in the art means, including phenol-chloroform method and various DNA are mentioned Take kit.50ng/ul is diluted to sterile water after extraction total DNA.
(3) PCR amplification and sequence analysis
PCR amplification is carried out according to following reaction system, PCR reaction system is 50ul, comprising: pcr amplification reaction system: 1 μ L, 2 × T5Super PCR Mix of DNA profiling 25 μ L, upstream and downstream primer (10pmol/ μ L) each 2 μ L, 20 μ L of deionized water.
Amplification condition are as follows:
PCR response procedures: 98 DEG C of initial denaturation 2min；98 DEG C of denaturation 40s, 54 DEG C of annealing 40s, 72 DEG C of extension 50s, 35 are followed Ring；Last 72 DEG C of extensions 10min.The 1.0% agarose gel electrophoresis detection of obtained PCR product is expanded, using with DNA glue QIAquick Gel Extraction Kit (TaKaRa) purifies PCR product, is recycled, and recovery product imports after the connection conversion of PMD-19T carrier Bacillus coli DH 5 alpha, by clone culture detection after expand good product be sent to Qing Ke Bioisystech Co., Ltd (Guangzhou) into Row upstream and downstream bidirectional sequencing.
The sequence analysis software used are as follows:
It is manually proofreaded after the sequence alignment obtained using 7.0 Duis of software Bioedit, deletes the base of both sides redundancy, Guarantee the alignment of sequence both ends.Nucleotide mutant site analysis is completed in software MEGA5.0.
General linear model is constructed using SPSS19.0, candidate SNP locus is verified.Such as Fig. 1.
As a result: after MEGA5.0 analysis, the genotype of each sample can identify, wherein to represent TT homozygous by figure A, It is accredited as high numerous individual；Scheming B is that CC is homozygous, is accredited as low numerous individual.
Wherein it is homozygous to represent GG by figure C, is accredited as high numerous individual；Scheming D is that AA is homozygous, is accredited as low numerous individual.
Wherein it is homozygous to represent CC by figure E, is accredited as high numerous individual；Scheming F is that AA is homozygous, is accredited as low numerous individual.
It is significant from distributional difference of 3 SNP sites that ND1 is screened in 83 female tortoises.It is as shown in the table:
Below with reference to concrete application, the invention will be further described.
Application example 1:
Using above-mentioned 3 SNP sites, entire group is divided into high numerous group and numerous group low, and count numerous group, low numerous group high As a result the average annual subalgebra of female tortoise and entire group see the table below (* * difference is extremely significant): Fig. 2.
As the result is shown: more than low numerous group of average annual subalgebra 27% more than high numerous group of average annual subalgebra subalgebra more average annual than group 75%.As can be seen that being that the average annual subalgebra of parent that label carries out after breeding improves using SNP site compared with before breeding 27%, there are biggish breeding potentiality.
The copy number variation provided in an embodiment of the present invention for being used to screen high fertility Mauremys mutica breeding populations Detection method contains following steps:
(1) sequence of following primer amplification ND4 is utilized:
Primer is (underscore part in sequence):
Primer F:5'ACCCACCTCACGAAAACG 3'SEQ ID NO:4；
Primer R:5'TGGCAGAGACCCGATAAG 3'SEQ ID NO:5；
Extension increasing sequence are as follows:
SEQ ID NO:6
ACCCACCTCACGAAAACGAGCCTTTATCTTCATCACCATTTTACTACAAATCTCACTAATCCTAGCTTT TTCAACAACAGAACTAATTATATTCTTCATCGCATTCGAATCTACATTACTCCCCACACTAGTAATTATTACACGTT GAGGTGGCCAAATAGAACGACTAAACGCCGGAACCTATTTCCTATTTTACACTCTTATCGGGTCTCTGCCA
(2) sequence of following primer amplification ATP6 is utilized:
Primer F:5'CCCAACTCTCAATAAACATAGG 3'SEQ ID NO:7；
Primer R:5'GTCGGATAAAAAGGCTGATT 3'SEQ ID NO:8
Extension increasing sequence are as follows:
SEQ ID NO:9
CCCAACTCTCAATAAACATAGGACTAGCCATCCCAATATGACTCGCCACAGTACTCACAGGTCTTCGA AATCAACTAACAACATCACTAGGACATTTATTGCCAGAAGGGACTCCAGCTCCACTCATCCCAATCCTCATTATTA TTGAAACAATCAGCCTTTTTATCCGAC。
(3) sample DNA extracts
The genomic DNA of sample can be extracted using the conventional method of this field, including phenol-chloroform method and various DNA are mentioned Take kit.After the total DNA of extraction measures concentration with ultraviolet specrophotometer, 50ng/ μ L is diluted to sterile water.
(4) PCR amplification and Specification Curve of Increasing
PCR amplification is carried out according to following reaction system, PCR reaction system is 50ul, comprising: pcr amplification reaction system: 1 μ L, 2 × T5Super PCR Mix of DNA profiling 25 μ L, upstream and downstream primer (10pmol/ μ L) each 2 μ L, 20 μ L of deionized water. PCR response procedures: 98 DEG C of initial denaturation 2min；98 DEG C of denaturation 40s, primer optimum temperature (table 1) annealing 40s, 72 DEG C of extension 50s, 35 circulations；Last 72 DEG C of extensions 10min.It expands obtained PCR product to be detected with 1.0% agarose gel electrophoresis, utilize Purified with DNA plastic recovery kit (TaKaRa) to PCR product, recycled, recovery product is connected through PMD-19T carrier and converted After import bacillus coli DH 5 alpha, by clone culture detection after extract plasmid, utilize spectrophotometric determination plasmid concentration.
The copy number of standard items is calculated according to formula:
Copy number/(X × 6.02 × 10 μ L=23×10-9)/(Y × 660),
X: standard items mass concentration (ng/ μ L), Y: fragment length bp (vector+insert).Standard items are finally pressed 10 It is diluted to 7 concentration gradients step by step again, constructs the standard curve between copy number (conversion of log 10) and gene magnification CT value.
Quantitative fluorescent PCR reaction system is 20ul, includes:
Absolute quantitation carries out in ABI StepOnePlus fluorescence quantitative PCR instrument, absolute quantitation reaction system: DNA profiling 1μL(50ng/μL),Green Realtime PCR Master Mix (Toyobo) 10 μ L, upstream and downstream are drawn Object (10pmol/ μ L) each 0.5 μ L, adds deionized water to supply 20 μ L.Reaction carries out in quantitative fluorescent PCR, high light transmission sealing plate mould Covering sealing.
Amplification and testing conditions are as follows:
After preparing reagent by above-mentioned reaction system, reaction plate is placed in ABI stepone plus real-time PCR In, following procedure: 95 DEG C of initial denaturation 5min is set；95 DEG C of denaturation 40s, 60 annealing 45s, 72 DEG C of extension 30s, 35 recycle；Most 95 DEG C of 5s afterwards, 60 DEG C of for 30s, and 95 DEG C of for 15s obtain solubility curve.
Using Linear Regression Model in One Unknown, the CT value of ND4 and ATP6 is analyzed as 4 years subalgebras are (with average value ± standard Accidentally indicate) variation tendency.According to the standard curve of correlativity between the CT value and copy number (log10 conversion) of gene magnification Determine the copy number (log10 conversion) of ND4 and ATP6.Finally obtain ND4 and ATP6 copy number (Log10 conversion) and filial generation in 4 years The equation of linear regression of average.
Use instrument and software are as follows:
The use of instrument is that ABI StepOnePlus carries out PCR amplification and signal collection, utilizes instrument software after reaction Stepone 2.3 carries out preliminary analysis, saves file.It is based on using the building of software GraphPad Prism Version 5.0 The equation of linear regression of ND4 and ATP6 copy number (log10 conversion) and 4 years offspring mean numbers.If Fig. 3 is that the embodiment of the present invention mentions The equation of linear regression of ND4 and APT6 copy number (conversion of log 10) and female 4 annual subalgebra of tortoise of confession.
As a result:
The equation of linear regression of ND4 and APT6 copy number (conversion of log 10) and female 4 annual subalgebra of tortoise, is respectively as follows: Fig. 3 (A) ND4:Y=3.99*X-24.40；
Fig. 3 (B) ATP6:Y=3.12*X-17.86；
Y indicates that average annual subalgebra, X indicate the copy number (conversion of log 10) of corresponding gene.P < 0.05 indicates that equation has system Count meaning.
Application example 2:
Using above-mentioned primer ND4F and ND4R and ATP6F and ATP6R, is obtained according to step (4) method and contain carrier and piece The plasmid of section brings corresponding formula into after Concentration Testing, obtains the predicted value of each maternal average annual subalgebra.
Construct the correlativity equation based on predicted value and observation: if Fig. 4 is building base provided in an embodiment of the present invention In the correlativity equation of predicted value and observation.
In figure: (A) Y=1.0007*X+0.0221；(B) Y=1.0015*X+0.0248
As can be seen that predicted value and actual value are consistent substantially, the assessment suitable for close tortoise fertility.In addition, this It invents 3 SNP sites obtained and ND4 and ATP6 copy number and is synthesized to female tortoise extracting genome DNA from primer, then to below Sequencing and using fluorescent quantitative PCR technique carry out prolificacy individual screening, whole operation process can be complete in two weeks At, moreover, it is smaller to the injury of female tortoise, it shortens conventional method and carries out mostly for the period of unexpected mass incident.
In short, the SNP site and ND4 and ATP6 copy number that are related in the present invention are suitable for Mauremys mutica Gao Fan The screening of ability group is grown, effective genetic marker can be provided for promotion Mauremys mutica industry development.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all in essence of the invention Made any modifications, equivalent replacements, and improvements etc., should all be included in the protection scope of the present invention within mind and principle.
Sequence table
<110>China's Pearl River Fishery Research Institute of Aquatic Science Research Institute
<120>SNP marker and copy number variation method of prolificacy Mauremys mutica female parent are screened
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
ataatcccaa tcctcatcgc 20
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
gtattggcgg gagtcctgat 20
<210> 3
<211> 925
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
ataatcccaa tcctcatcgc cgtagctttt ttcaccctta ttgaacgcaa agtactaggt 60
tacatacaac ttcgaaaagg ccctaacatc gtaggcccac aagggttact acaaccagtg 120
gcagacggag taaaattatt tatcaaagaa ccaatctacc cgctaaattc atcaatcaca 180
ttattcacta tttcaccaat tatagctcta acactagccc tattaatttg actccccctc 240
cctataccct tcccactaac tgaccttaac ttaggccttt tatttataat tgccatctcc 300
agtttcatgg cctattcaat tttatgatct ggatgagctt caaactcaaa atatgcccta 360
ataggggccc tacgggcagt agctcaaact atctcatatg aagtaaccct gggaatcatt 420
ctactttcca taatcctctt ctcagggggc ttcaacatac aaacatttac aatagtacaa 480
gaacctatat acttaatatt ctcctcctga ccactaatga caatatgata tatttccaca 540
ctagctgaaa ctaaccgagc accctttgat ttaaccgaag gtgaatctga actcgtatcg 600
ggatttaacg tcgaatatgc tgctggtccc tttgccctat tcttcctagc agagtacgca 660
aacatcctaa taataaacac tctaactacc attctatttc taaatcccgc ccacatcaac 720
aataccccag aattattcac cctatcactg atctcaaaag caatactctt atcagcagga 780
ttcctatgaa ttcgaacctc ctacccacga ttccgatatg accaactcat acatctccta 840
tgaaaaaact tcctcccaat caccttagca ctatgctttt gacacatatc aataccaatc 900
accctatcag gactcccgcc aatac 925
<210> 4
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
acccacctca cgaaaacg 18
<210> 5
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
tggcagagac ccgataag 18
<210> 6
<211> 217
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
acccacctca cgaaaacgag cctttatctt catcaccatt ttactacaaa tctcactaat 60
cctagctttt tcaacaacag aactaattat attcttcatc gcattcgaat ctacattact 120
ccccacacta gtaattatta cacgttgagg tggccaaata gaacgactaa acgccggaac 180
ctatttccta ttttacactc ttatcgggtc tctgcca 217
<210> 7
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
cccaactctc aataaacata gg 22
<210> 8
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
gtcggataaa aaggctgatt 20
<210> 9
<211> 171
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
cccaactctc aataaacata ggactagcca tcccaatatg actcgccaca gtactcacag 60
gtcttcgaaa tcaactaaca acatcactag gacatttatt gccagaaggg actccagctc 120
cactcatccc aatcctcatt attattgaaa caatcagcct ttttatccga c 171

Claims (7)

1. a kind of SNP marker and copy number variation method for screening prolificacy Mauremys mutica female parent, which is characterized in that described Screen prolificacy Mauremys mutica female parent SNP marker and copy number variation method include:
Step 1 obtains candidate maternal genomic DNA；
Step 2, design include the ND1 fragment primer of 3 SNP sites and the primer for detecting ND4 and ATP6 copy number；PCR expands Increase and obtain ND1 segment and import the amplified fragments of ND4 and ATP6 in bacillus coli DH 5 alpha, and extracts plasmid；
Step 3, sequencing and the copy number that ND4 and ATP6 is obtained according to plasmid concentration；
Step 4 carries out the screening of prolificacy individual according to the copy number of SNP site and ND4 and ATP6.
2. the SNP marker and copy number variation method of screening prolificacy Mauremys mutica female parent as described in claim 1, It is characterized in that, in step 2, screens the ND1 segment of 3 SNP sites, comprising:
1) ND1 sequence SEQ ID NO:3 of primer SEQ ID NO:1, primer SEQ ID the NO:2 amplification comprising SNP site is utilized；
2) sample is collected and DNA is extracted: being carried out paternity test using multiple PCR technique, is determined the fertility of each female parent； It is arranged from high to low according to fertility, chooses the highest female tortoise of fertility and construct prolificacy group, choose fertility most Low female tortoise constructs low reproductive capacity group, and preliminary screening goes out SNP site relevant to fertility；It is verified using linear model candidate SNP site；
3) PCR amplification and sequence analysis: PCR amplification is carried out；
It expands obtained PCR product to be detected with 1.0% agarose gel electrophoresis, using DNA plastic recovery kit to PCR product It purified, recycled, recovery product imports bacillus coli DH 5 alpha after the connection conversion of PMD-19T carrier, by clone's culture inspection Good product is expanded after survey carries out upstream and downstream bidirectional sequencing.
3. the SNP marker and copy number variation method of screening prolificacy Mauremys mutica female parent as claimed in claim 2, It is characterized in that, is manually proofreaded after the sequence alignment obtained using 7.0 Duis of software Bioedit, delete the alkali of both sides redundancy Base guarantees the alignment of sequence both ends；Nucleotide mutant site analysis carries out in software MEGA5.0；
Linear model is constructed using SPSS19.0, candidate SNP locus is verified.
4. the SNP marker and copy number variation method of screening prolificacy Mauremys mutica female parent as claimed in claim 2, It is characterized in that, in step 3), PCR reaction system is 50ul, comprising: pcr amplification reaction system: DNA profiling 1 μ L, 2 × T5 25 μ L of Super PCR Mix, upstream and downstream primer (10pmol/ μ L) each 2 μ L, 20 μ L of deionized water；
Amplification condition are as follows:
PCR response procedures: 98 DEG C of initial denaturation 2min；98 DEG C of denaturation 40s, 54 DEG C of annealing 40s, 72 DEG C of extension 50s, 35 recycle； Last 72 DEG C of extensions 10min.
5. the SNP marker and copy number variation method of screening prolificacy Mauremys mutica female parent as claimed in claim 2, It is characterized in that, step 3, includes: according to the method that plasmid concentration obtains the copy number of ND4 and ATP6
The first step, sample DNA extract:
The genomic DNA of sample is extracted using phenol-chloroform method or various DNA extraction kits；The total DNA ultraviolet spectrometry of extraction After photometric determination concentration, 50ng/ μ L is diluted to sterile water；
Second step expands ND4 using primer SEQ ID NO:4, primer SEQ ID NO:5, obtains SEQ ID NO:6 sequence；
Third step expands ATP6 using primer SEQ ID NO:7, primer SEQ ID NO:8, obtains sequence SEQ ID NO:9；
4th step, PCR amplification and Specification Curve of Increasing:
PCR amplification is carried out according to following reaction system, PCR reaction system is 50ul；It include: pcr amplification reaction system: DNA mould Each 2 μ L of downstream primer of the upstream primer of 1 μ L, 2 × T5 Super PCR Mix of plate, 25 μ L, 10pmol/ μ L, 10pmol/ μ L, 20 μ L of deionized water；
PCR response procedures: 98 DEG C of initial denaturation 2min；98 DEG C of denaturation 40s；
Primer optimum temperature annealing 40s, 72 DEG C of extension 50s, 35 recycle；Last 72 DEG C of extensions 10min；
It expands obtained PCR product to be detected with 1.0% agarose gel electrophoresis, PCR is produced using with DNA plastic recovery kit Object is purified, is recycled, and recovery product imports bacillus coli DH 5 alpha after the connection conversion of PMD-19T carrier, is cultivated by clone Plasmid is extracted after detection, utilizes spectrophotometric determination plasmid concentration；
The copy number of standard items: copy number/μ L=(X × 6.02 × 1023 × 10-9)/(Y × 660) is calculated according to formula；
X: standard items mass concentration ng/ μ L, Y: fragment length bp vector+insert；It is finally that standard items are dilute step by step by 10 times 7 concentration gradients are interpreted as, the standard curve between copy number and gene magnification CT value is constructed；
Quantitative fluorescent PCR reaction system is 20ul, includes:
Absolute quantitation carries out in ABI StepOnePlus fluorescence quantitative PCR instrument, absolute quantitation reaction system: 50ng/ μ L's DNA profiling 1 μ L, 2 ×10 μ L, 10pmol/ μ L upstream primer of Green Realtime PCR Master Mix, Each 0.5 μ L of 10pmol/ μ L downstream primer, adds deionized water to supply 20 μ L；Reaction carries out in quantitative fluorescent PCR, high light transmission envelope Template die covering sealing；
Amplification and testing conditions are as follows:
After reaction system prepares reagent, reaction plate is placed in ABI stepone plus real-time PCR, setting is following Program: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 40s, 60 annealing 45s, 72 DEG C of extension 30s, 35 recycle；Last 95 DEG C of 5s, 60 DEG C for 30s, and 95 DEG C of for 15s obtain solubility curves；
5th step determines copying for ND4 and ATP6 according to the standard curve of correlativity between the CT value and copy number of gene magnification Shellfish number；Obtain the equation of linear regression of ND4 and ATP6 copy number and 4 years offspring mean numbers.
6. the SNP marker and copy number variation method of screening prolificacy Mauremys mutica female parent as claimed in claim 5, It is characterized in that,
The equation of linear regression of ND4 and APT6 copy number and 4 annual subalgebras, is respectively as follows:
ND4:Y=3.99*X-24.40；
ATP6:Y=3.12*X-17.86；
Y indicates that average annual subalgebra, X indicate the copy number of corresponding gene；P < 0.05 indicates that equation has statistical significance.
7. the SNP marker and copy number variation method of screening prolificacy Mauremys mutica female parent as claimed in claim 5, It is characterized in that,
Utilize primer ND4F SEQ ID NO:4 and ND4R SEQ ID NO:5 and ATP6F SEQ ID NO:7 and ATP6R SEQ ID NO:8 obtains the plasmid containing carrier and segment according to the 4th step and brings corresponding formula into after Concentration Testing, obtains The predicted value of ND4, ATP6 of each maternal average annual subalgebra；
It is respectively as follows: ND4:Y=1.0007*X+0.0221；ATP6:Y=1.0015*X+0.0248.
Y indicates that average annual subalgebra, X indicate the copy number of corresponding gene.
CN201811465384.9A 2018-12-03 2018-12-03 SNP (Single nucleotide polymorphism) marker and copy number variation method for screening female parent of high-fertility mauremys mutica Active CN109536616B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811465384.9A CN109536616B (en) 2018-12-03 2018-12-03 SNP (Single nucleotide polymorphism) marker and copy number variation method for screening female parent of high-fertility mauremys mutica

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811465384.9A CN109536616B (en) 2018-12-03 2018-12-03 SNP (Single nucleotide polymorphism) marker and copy number variation method for screening female parent of high-fertility mauremys mutica

Publications (2)

Publication Number Publication Date
CN109536616A true CN109536616A (en) 2019-03-29
CN109536616B CN109536616B (en) 2020-02-18

Family

ID=65853601

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811465384.9A Active CN109536616B (en) 2018-12-03 2018-12-03 SNP (Single nucleotide polymorphism) marker and copy number variation method for screening female parent of high-fertility mauremys mutica

Country Status (1)

Country Link
CN (1) CN109536616B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111073884A (en) * 2020-02-14 2020-04-28 昆明理工大学 Method for improving accuracy of SNP locus detection with functional effect in SNP with distance of non-coding region less than 50bp
CN115181718A (en) * 2022-06-14 2022-10-14 中国水产科学研究院珠江水产研究所 Isolation culture method of ovary cells of mauremys mutica

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102533774A (en) * 2011-12-19 2012-07-04 西北农林科技大学 Single nucleotide polymorphism sequence of dairy cattle FGF2 (Fibroblast Growth Factor 2) gene and detection method of single nucleotide polymorphism sequence

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102533774A (en) * 2011-12-19 2012-07-04 西北农林科技大学 Single nucleotide polymorphism sequence of dairy cattle FGF2 (Fibroblast Growth Factor 2) gene and detection method of single nucleotide polymorphism sequence

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
WANG YK.等: "Identification of SNPs and copy number variations in mitochondrial genes related to the reproductive capacity of the cultured Asian yellow pond turtle (Mauremys mutica)", 《ANIMAL REPRODUCTION SCIENCE》 *
刘明军等: "牛羊分子细胞工程育种技术创新与优势性状新品种培育", 《科技创新导报》 *
李国治等: "基因组测序技术及其应用研究进展", 《安徽农业科学》 *
王建英等: "绵羊多羔性状候选基因的研究进展", 《草食家畜》 *
裴生伟等: "牛全基因组拷贝数变异研究进展", 《畜牧兽医学报》 *
赵建: "黄喉拟水龟种群分化与种质资源研究", 《中国博士学位论文全文数据库》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111073884A (en) * 2020-02-14 2020-04-28 昆明理工大学 Method for improving accuracy of SNP locus detection with functional effect in SNP with distance of non-coding region less than 50bp
CN115181718A (en) * 2022-06-14 2022-10-14 中国水产科学研究院珠江水产研究所 Isolation culture method of ovary cells of mauremys mutica

Also Published As

Publication number Publication date
CN109536616B (en) 2020-02-18

Similar Documents

Publication Publication Date Title
CN103798169B (en) A kind of method setting up YY supermale yellow cartfish improvement breeding line fast
WO2022111124A1 (en) Method for breeding novel species of normally developed fish without intermuscular bones
CN104351096B (en) A kind of Misgurnus auguillicaudatus fine-variety breeding method
CN110129456A (en) A kind of anti-vibrios molecular labeling combination of prawn and its application in breeding
CN107267627A (en) The preparation and application of the Six1 gene molecule marker related to pig production character
CN109536616A (en) Screen the SNP marker and copy number variation method of prolificacy Mauremys mutica female parent
CN109055580A (en) Litopenaeus vannamei c-type scavenger receptor is interior and grows related molecular marker and application
CN118028492A (en) Application of SNP locus combination of litopenaeus vannamei in family mixed culture trait evaluation of litopenaeus vannamei, probe and kit
CN112094921B (en) Molecular marker for identifying silky fowl and bamboo silky fowl and application thereof
CN108546777A (en) A kind of SNP marker and its application for detecting the anti-clubroot of Chinese cabbage
CN116334300B (en) Molecular marker closely linked with main effect QTL of wheat spike number per spike and application thereof
CN112359104A (en) Development method and application of sex specific marker of mandarin fish
CN109439763B (en) Molecular marker for identifying 817 broiler chickens and yellow-leg free-range chickens and application
CN115807037B (en) Breeding method of tetraploid fish with controllable inheritance and preparation method of triploid fish
CN111477272A (en) Method for assisting in selecting high-yield-litter-size rex rabbits by using SNPs (single nucleotide polymorphisms)
CN113249442B (en) Method for screening oyster unsaturated fatty acid content-related methylation modifying gene
CN112094917B (en) Western pig blood marginal infiltration site SNP marker related to body length in local pig in China and application
CN108588242B (en) SNP locus of crassostrea gigas AHR gene
CN108660225B (en) Molecular marker assisted breeding primer for growth traits of echinococcus intermedius and screening method
CN118272546B (en) SNP marker g.reelin-936 related to propagation traits of palaemon carinicauda and application thereof
CN113322342B (en) Molecular marker for assisting in selecting ptc1 common genic male sterile line and breeding line and application
CN116144708A (en) All-male sterile nile tilapia strain and construction method thereof
CN117844816A (en) Method for creating pink largemouth black bass by adopting gene editing technology
CN117230076A (en) Application of silkworm regulatory element BmAb as adult body color mark target and method
CN118480614A (en) SNPs (single nucleotide polymorphisms) marker of chicken Noggin4 gene promoter region and application of SNPs marker in chicken breeding

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant