CN109371012A - A kind of lysate and method extracting meat nucleic acid - Google Patents
A kind of lysate and method extracting meat nucleic acid Download PDFInfo
- Publication number
- CN109371012A CN109371012A CN201811423651.6A CN201811423651A CN109371012A CN 109371012 A CN109371012 A CN 109371012A CN 201811423651 A CN201811423651 A CN 201811423651A CN 109371012 A CN109371012 A CN 109371012A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- lysate
- amplification
- meat
- concentration
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Plant Pathology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of lysates and method for extracting meat nucleic acid.Lysate is dissolved in water by sodium chloride, dodecyl sodium sulfate, Nonidet P40 and polyvinylpyrrolidone and is mixed to get；Concentration of each component in mixed liquor is respectively as follows: sodium chloride: 0.2~1.5M, dodecyl sodium sulfate: 0.01~1g/ml, Nonidet P40: 0.01~0.5g/ml, polyvinylpyrrolidone: 0.01~0.1g/ml.Method are as follows: the meat sample that will be minced is mixed with lysate at normal temperature, stands a period of time；It is centrifugated again, takes supernatant to get nucleic acid extractive is arrived.Lysate of the invention is at low cost and nontoxic, and the rapidly extracting of meat nucleic acid may be implemented in extracting method, and operating process is simple and easy, and can be applied to PCR or LAMP amplification system and detected.
Description
Technical field
The invention belongs to food safety monitoring technical fields, more particularly to a kind of lysate for extracting meat nucleic acid and side
Method.
Background technique
Currently, many bad businessmans are commonly used cheap meat to replace high price meat, seriously to obtain economic interests in the market
Compromise consumers' rights and interests.Appearance discrimination between the meat as similar in some types (such as pork and beef, mutton and beef)
Less, ordinary consumer depends naked eyes alone and is difficult to be identified.In order to realize that the type to meat identifies, more commonly used method
It is that augmentation detection is carried out to nucleic acid sequence distinctive in meat using PCR or LAMP reaction.However before amplification, the core to meat is needed
Acid extracts.
Traditional meat method for extracting nucleic acid has very much, such as phenol-chloroform method, CTAB method, PVP method, tripoli method, guanidine-
Chloroform method etc..The heating of these method some needs, some operation time-consumings are very long, and operating procedure is more, and process is more numerous
It is trivial, nucleic acid extraction efficiency is greatly reduced, is unfavorable for realizing the rapidly extracting of nucleic acid and quickly detection.
In order to accelerate the nucleic acid extraction to meat, the extracting method that there are reports about meat nucleic acid is such as used
Tris-EDTA method, modified CTAB method, highly basic method, urea method etc., these methods are although simplify operation step compared with traditional detection method
Rapid and process, but it is still longer to operate time-consuming, and has some reagents to have certain toxicity, has certain danger to human body
Evil.In the market also there are many meat nucleic acid extraction kit (centrifugal column type), but be typically necessary heating to meat crack 1 hour with
On, and required reagent and operating procedure are more, higher cost.Therefore, a kind of simple, room temperature, nontoxic, quick meat core are developed
Sour extracting method is simultaneously applied to meat nucleic acid and quickly detects and be of great significance.
In conclusion defect and actual demand based on the prior art, the present invention develops a kind of extraction meat nucleic acid
Lysate and method, lysate of the invention is nontoxic and at low cost, using the lysate carry out meat extraction method have
Easy to operate, the advantages that extraction process is quick.
Summary of the invention
The purpose of the present invention is to provide a kind of lysates and method for extracting meat nucleic acid.Lysate cost of the invention
Low and nontoxic, the rapidly extracting of meat nucleic acid may be implemented in extracting method, and operating process is simple and easy, and can be applied to PCR or
LAMP amplification system is detected.
To achieve the above object, the present invention takes following technical scheme:
A kind of lysate extracting meat nucleic acid, the lysate is by sodium chloride, dodecyl sodium sulfate, the poly- second of ethylphenyl
Two pure and mild polyvinylpyrrolidones are dissolved in water and are mixed to get；Concentration of each component in mixed liquor is respectively as follows:
Sodium chloride: 0.2~1.5M,
Dodecyl sodium sulfate: 0.01~1g/ml,
Nonidet P40: 0.01~0.5g/ml,
Polyvinylpyrrolidone: 0.01g/ml~0.1g/ml.
Further, in above-mentioned lysate, it is preferred that the concentration of sodium chloride is 0.3~1M；It is furthermore preferred that sodium chloride
Concentration is 0.4~0.6M.
Further, in above-mentioned lysate, it is preferred that the concentration of dodecyl sodium sulfate is 0.1~0.8g/ml, more excellent
Choosing, the concentration of dodecyl sodium sulfate is 0.3~0.6g/ml.
Further, in above-mentioned lysate, it is preferred that the concentration of Nonidet P40 is 0.05~0.2g/ml；More
Preferably, the concentration of Nonidet P40 is 0.08~0.1g/ml.
Further, in above-mentioned lysate, it is preferred that the concentration of polyvinylpyrrolidone is 0.03~0.08g/ml；More
Preferably, the concentration of polyvinylpyrrolidone is 0.05g/ml~0.06g/ml.
The sodium chloride that higher concentration has been used in lysate of the invention makes animal tissue cell in the environment of high salt concentration
Middle dehydration releases intracellular nucleic acid.While the rupture in order to promote cell membrane, present invention uses certain density two kinds
Surfactant: dodecyl sodium sulfate and Nonidet P40 promote nucleic acid release to crack to cell membrane.
After film rupture, the impurity such as protein, fat in meat with releasing, can also influence the yield of nucleic acid and to subsequent expansion
Increasing has an important influence on.Therefore certain density polyvinylpyrrolidone being also added in lysate, this is a kind of crosslinking agent,
The contamination precipitations such as protein, fat can be got off.
A method of meat nucleic acid is extracted, is included the following steps:
(1) the meat sample that will be minced, is mixed with above-mentioned lysate at normal temperature, stands a period of time；
(2) it is centrifugated, takes supernatant to get nucleic acid extractive is arrived.
Further, the mass volume ratio of the meat sample and lysate is 2:2~2:6g/ml；It is furthermore preferred that sample
Mass volume ratio with lysate is 2:3~2:5g/ml；Most preferably, the mass volume ratio of sample and lysate is 2:3~2:
4g/ml。
Further, step (1) time of repose is 1~5min；It is furthermore preferred that time of repose is 2~4min；It is optimal
Choosing, time of repose is 2~3min.
Further, the centrifugal rotational speed is 8000rpm~15000rpm；It is furthermore preferred that revolving speed be 9000rpm~
12000rpm；Most preferably, revolving speed is 10000rpm~11000rpm.
Further, the centrifugation time is 1min.
Nucleic acid extractive needs to be diluted with TE buffer (its concentration is 10mM Tris, 1mM EDTA, pH 8.0).
Preferably, nucleic acid extractive is subjected to 20 to 100 times of dilutions with TE buffer；It is furthermore preferred that with TE buffer by nucleic acid extraction
Object carries out 30 to 80 times of dilutions；Most preferably, nucleic acid extractive is subjected to 40 to 60 times of dilutions with TE buffer.
The present invention has the advantage that
(1) present invention passes through sodium chloride, dodecyl sodium sulfate, Nonidet P40 and polyvinylpyrrolidone association
Same-action can promote the rupture of meat cell membrane, guarantee the release of nucleic acid, while effectively by contamination precipitation, can be quick
Realization meat nucleic acid extraction.
(2) raw material sources of lysate of the present invention are at low cost, have no toxic side effect.
(3) method of present invention extraction meat nucleic acid is easy to operate, can be completed at normal temperature by 5 minutes or so, right
The detection of nucleic acids of meat is extremely important.
Detailed description of the invention
Fig. 1 is the PCR amplification of embodiment 3 as a result, wherein 1 representing positive sample, 2 represent negative sample, and Rn, which is represented, to be eliminated
The fluorescent value of background signal.
Fig. 2 is the LAMP amplification of embodiment 4, wherein 1 represents positive sample, 2 represent negative sample, and Rn, which is represented, to be eliminated
The fluorescent value of background signal.
Fig. 3 is the PCR amplification of embodiment 5 as a result, wherein 1 representing positive sample, 2 represent negative sample, and Rn, which is represented, to be eliminated
The fluorescent value of background signal.
Fig. 4 is the LAMP amplification of embodiment 6, wherein 1 represents positive sample, 2 represent negative sample, and Rn, which is represented, to be eliminated
The fluorescent value of background signal.
Fig. 5 is the PCR amplification of embodiment 7 as a result, wherein 1 representing positive sample, 2 represent negative sample, and Rn, which is represented, to be eliminated
The fluorescent value of background signal.
Fig. 6 is the LAMP amplification of embodiment 8, wherein 1 represents positive sample, 2 represent negative sample, and Rn, which is represented, to be eliminated
The fluorescent value of background signal.
Fig. 7 is the PCR amplification of embodiment 9 as a result, wherein 1 representing positive sample, 2 represent negative sample, and Rn, which is represented, to be eliminated
The fluorescent value of background signal.
Fig. 8 is the LAMP amplification of embodiment 10, wherein 1 represents positive sample, 2 represent negative sample, and Rn representative disappears
Except the fluorescent value of background signal.
Fig. 9 is the PCRP amplification of embodiment 11, wherein 1 represents positive sample, 2 represent negative sample, and Rn representative disappears
Except the fluorescent value of background signal.
Figure 10 is the LAMP amplification of embodiment 12, wherein 1 represents positive sample, 2 represent negative sample, and Rn representative disappears
Except the fluorescent value of background signal.
Figure 11 is the PCR amplification of embodiment 13 as a result, wherein 1 representing positive sample, 2 represent negative sample, and Rn representative disappears
Except the fluorescent value of background signal.
Figure 12 is the LAMP amplification of embodiment 14, wherein 1 represents positive sample, 2 represent negative sample, and Rn representative disappears
Except the fluorescent value of background signal.
Specific embodiment
Following specific embodiments are the further explanations to method provided by the invention and technical solution, but are not construed as
Limitation of the present invention.
Embodiment 1
In order to determine four kinds of ingredient (sodium chloride, dodecyl sodium sulfate, Nonidet P40, poly- second in lysate
Alkene pyrrolidone) optium concentration, determine use L9(34) orthogonal arrage formulate experimental program, and using range analysis method come
Obtain four kinds of ingredient optium concentrations in lysate.Their factor level table is shown in Table 1.
Table 1
In an experiment, pork is used to carry out orthogonal experiment as sample, the mass volume ratio for fixing pork and lysate is 2:
3g/ml, sample and lysate stand 1min after mixing, and then fixed rotating speed is 8000rpm, are centrifuged 1min.Finally buffered with TE
Liquid is unified to carry out 50 times of dilutions, obtains nucleic acid extractive.The C reacted according to real-time fluorescence PCRtValue (can be detected in PCR reaction
The initial cycle number of fluorescence signal) size determine nucleic acid extraction effect, CtIt is worth smaller, illustrates that nucleic acid amount to obtain is more.It is real
It tests conceptual design and the results are shown in Table 2.C in table 2t(j1) first horizontal C of each factor is representedtIt is worth summation；Ct(j2) it represents every
Second horizontal C of a factortIt is worth summation；Ct(j3) C of each factor third level is representedtIt is worth summation；Rj represent it is each because
Plain CtIt is worth the difference of the maxima and minima of summation.
The PCR amplification system of pork are as follows:
PCR system: PCR reaction carries out in 25 μ L systems, which includes 0.8 μM of SYTO 9, TaKaRa Taq
HS polymerase 0.625U, 10 × PCR Buffer (Mg2+Plus), (purchase cures biotechnology (Beijing) from precious day to each 0.2mM of dNTP
Co., Ltd), primer concentration is 0.4 μM of (buying from Sangon Biotech (Shanghai) Co., Ltd.) limited liability company).
PCR amplification program: 94 DEG C of thermal starting 5min, 40 circulations, each circulation include 94 DEG C of reaction 30s, 60 DEG C of reactions
30s, 72 DEG C of reaction 30s.
The primer sequence used:
F (SEQ ID NO.1): 5 ' GAAGGTTCAGGTTTACTCACG 3 '
R (SEQ ID NO.2): 5 ' TCAGCAAATCAATTTCAATCTGG 3 '
The template sequence (SEQ ID NO.3) of amplification:
5’GAAGGTTCAGGTTTACTCACGCCACCCAGCGGAAAACGGAAAGCCAAATTACCTGAACTGCTATGT
ATCTGGGTTCCATCCGCCCCAGATTGAAATTGATTTGCTGA3’(GeneBank:NC_010443.5)
Table 2
According to the result in table 2 it is found that the sequence of Rj value from big to small are as follows: sodium chloride, Nonidet P40,12
Sodium alkyl sulfonate, polyvinylpyrrolidone.Illustrate that the concentration of sodium chloride in lysate is the largest nucleic acid extraction influence, secondly
It is Nonidet P40, is thirdly dodecyl sodium sulfate, is finally polyvinylpyrrolidone.Simultaneously according to CtValue is got over
Small nucleic acids extracted amount is more, it is known that: the optium concentration of sodium chloride is 0.6M；The optium concentration of dodecyl sodium sulfate is 0.6g/
ml；The optium concentration of Nonidet P40 is 0.1g/ml；The optium concentration of polyvinylpyrrolidone is 0.05g/ml.Cause
In next case study on implementation, lysate all uses optium concentration combination to be tested for this.
Embodiment 2
It has determined in lysate after the optium concentration of four kinds of ingredients, has also needed the mass volume ratio for determining sample and lysate
(unit: g/ml), time of repose and the optimum speed that nucleic acid can be allowed to separate with impurity etc. three after sample is mixed with lysate
A factor (extension rate of nucleic acid extractive finally determines again).In order to reduce test number (TN) as far as possible, still determine to use L9
(34) orthogonal arrage formulate experimental program, and obtain using range analysis method the optimum condition of these three factors.They
Factor level table is shown in Table 3.In table with letter A, B, C respectively represent the mass volume ratio of sample and lysate, time of repose, from
Heart revolving speed.
Table 3
In an experiment, pork is used to carry out orthogonal experiment as sample, each ingredient is best in embodiment 1 in lysate
The quality of concentration, sample is fixed as 100mg.Pork and lysate are mixed and stand a period of time, then with the centrifugation of certain revolving speed
1min finally carries out 50 times of dilutions with TE buffer is unified, obtains nucleic acid extractive.The C reacted according to real-time fluorescence PCRtValue
The size of the initial cycle number of fluorescence signal (can be detected) determines nucleic acid extraction effect, CtBe worth it is smaller, illustrate nucleic acid obtain
It measures more.Experimental designs and it the results are shown in Table 4.C in table 4t(j1) first horizontal C of each factor is representedtIt is worth summation；Ct
(j2) second horizontal C of each factor is representedtIt is worth summation；Ct(j3) C of each factor third level is representedtIt is worth summation；Rj
Represent each factor CtIt is worth the difference of the maxima and minima of summation.
PCR amplification system, amplification program and the extension increasing sequence of pork are the same as embodiment 1.
Table 4
According to the result in table 4 it is found that the sequence of Rj value from big to small are as follows: the mass volume ratio of sample and lysate, from
Heart revolving speed, time of repose.Illustrate that the mass volume ratio of sample and lysate is the largest nucleic acid extraction influence, is followed by centrifuged
Revolving speed is finally time of repose.Simultaneously according to CtIt is more to be worth smaller nucleic acid extraction amount, it is known that: the best matter of sample and lysate
Amount volume ratio is 2:3g/ml, and the best time of repose after sample and lysate mix is 2min, and best centrifugal rotational speed is
10000rpm.In next embodiment, all tested using above-mentioned optimum condition.
Embodiment 3
Firstly, by lysate (0.6M sodium chloride, the dodecyl sulphur of 0.6g/ml of the fresh pork of 100mg and 150 μ L
Sour sodium, the Nonidet P40 of 0.1g/ml, 0.05g/ml polyvinylpyrrolidone) mix, room temperature stand 2 minutes；So
Afterwards, 10000rpm is centrifuged 1 minute, draws supernatant, is obtained nucleic acid extractive, is determined using PCR nucleic acid extraction effect.
Pork PCR amplification system, amplification program and extension increasing sequence are the same as embodiment 1.
It uses TE buffer solution that nucleic acid extractive is diluted 20 times as PCR reaction template to expand, obtains amplified fluorescence
Curve graph 1.
As the result is shown: positive sample generates amplification curve in Fig. 1, and negative sample does not generate amplification, shows that the nucleic acid mentions
It takes method that can effectively extract the nucleic acid in pork, and can be reacted and be detected using PCR.
Embodiment 4
Firstly, by lysate (0.6M sodium chloride, the dodecyl sulphur of 0.6g/ml of the fresh pork of 100mg and 150 μ L
Sour sodium, the Nonidet P40 of 0.1g/ml, 0.05g/ml polyvinylpyrrolidone) mix, room temperature stand 2 minutes；So
Afterwards, 10000rpm is centrifuged 1 minute, draws supernatant, is obtained nucleic acid extractive, is determined using LAMP nucleic acid extraction effect.
Pork LAMP system: LAMP reaction carries out in 25 μ L systems, which includes 0.4 μM of SYTO9, Bst DNA
Polymerase (large fragment) 16U, 10xThermoPol Reaction, Betaine (glycine betaine) 0.8M, MgCl22mM, dNTP are each
0.35mM, primers F 3/B3 concentration are respectively 0.2 μM, and primers F IP/BIP concentration is respectively 1.6mM, and primer LF/LB concentration is respectively 0.4 μM
(buying from Sangon Biotech (Shanghai) Co., Ltd.) limited liability company).
LAMP amplification program: 63 DEG C heated at constant temperature 45 minutes, 90 circulation, every 30s read a fluorescent value.
The primer sequence used:
F3 (SEQ ID NO.4): 5 ' AGACTATGAAGACCTCACCTT 3 '
B3 (SEQ ID NO.5): 5 ' AGTGCTGACTAGCTTCTCA 3 '
FIP (SEQ ID NO.6):
5’AGGGATGGGACGGCTCATGACAATCGAGTTGTTCTACCA 3’
BIP (SEQ ID NO.7):
5’ACAGATGCTATCCCAGGACGATCTGAGCACTGTCCGTAA 3’
LF (SEQ ID NO.8): 5 ' GCAGTACGTCTTCAGAGGATAC 3 '
LB (SEQ ID NO.9): 5 ' CTCTAATATCCACACGACCTGG 3 '
The template sequence (SEQ ID NO.10) of amplification:
5’AGACTATGAAGACCTCACCTTTGACTCATATATAATCCCCACATCAGATCTTAAACCTGGAGAAAT
ACGACTACTAGAAGTAGACAATCGAGTTGTTCTGCCAATAGAAATAACAATCCGAATATTAGTGTCCTCTGAAGAC
GTACTACACTCATGAGCTGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACCAAACAACTC
TAATATCCACACGACCTGGCCTTTATTACGGACAGTGCTCAGAAATCTGTGGATCAAACCACAGCTTCATGCCCAT
TGTACTTGAACTTGTCCCATTAAAGTACTTCGAAAAATGGTCAACATCAATATTAACAGGTTCATTGAGAAGCTAG
TCAGCACT3’(GeneBank:KC469586.1)
It uses TE buffer solution that nucleic acid extractive is diluted 20 times as LAMP reaction template to expand, obtains amplified fluorescence
Curve graph 2.
As the result is shown: positive sample generates amplification curve in Fig. 2, and negative sample does not generate amplification, shows that the nucleic acid mentions
It takes method that can effectively extract the nucleic acid in pork, and can be reacted and be detected using LAMP.
Embodiment 5
Firstly, by lysate (0.6M sodium chloride, the dodecyl sulphur of 0.6g/ml of the fresh pork of 100mg and 150 μ L
Sour sodium, the Nonidet P40 of 0.1g/ml, 0.05g/ml polyvinylpyrrolidone) mix, room temperature stand 2 minutes；So
Afterwards, 10000rpm is centrifuged 1 minute, draws supernatant, is obtained nucleic acid extractive, is determined using PCR nucleic acid extraction effect.
Pork PCR amplification system, amplification program and extension increasing sequence are the same as embodiment 1.
It uses TE buffer solution that nucleic acid extractive is diluted 50 times as PCR reaction template to expand, obtains amplified fluorescence
Curve graph 3.
As the result is shown: positive sample generates amplification curve in Fig. 3, and negative sample does not generate amplification and in embodiment 3
Amplification compare, the fluorescent amplification curve C of the positive sampletValue will be located further forward, and illustrate the nucleic acid extractive diluting 50
20 times than dilution of effect again of effect is good.
Embodiment 6
Firstly, by lysate (0.6M sodium chloride, the dodecyl sulphur of 0.6g/ml of the fresh pork of 100mg and 150 μ L
Sour sodium, the Nonidet P40 of 0.1g/ml, 0.05g/ml polyvinylpyrrolidone) mix, room temperature stand 2 minutes；So
Afterwards, 10000rpm is centrifuged 1 minute, draws supernatant, is obtained nucleic acid extractive, is determined using LAMP nucleic acid extraction effect.
Pork LAMP amplification system, amplification program and extension increasing sequence are the same as embodiment 4.
It uses TE buffer solution that nucleic acid extractive is diluted 50 times as LAMP reaction template to expand, obtains amplified fluorescence
Curve graph 4.
As the result is shown: positive sample generates amplification curve in Fig. 4, and negative sample does not generate amplification, and in embodiment 4
Amplification compare, the fluorescent amplification curve T of the positive samplet(the initial of fluorescence signal can be detected in LAMP reaction in value
Time) it to be located further forward, illustrate that the effect that the nucleic acid extractive is diluted to 20 times than dilution of effect of 50 times is good.
Embodiment 7
Firstly, by lysate (0.6M sodium chloride, the dodecyl sulphur of 0.6g/ml of the fresh pork of 100mg and 150 μ L
Sour sodium, the Nonidet P40 of 0.1g/ml, 0.05g/ml polyvinylpyrrolidone) mix, room temperature stand 2 minutes；So
Afterwards, 10000rpm is centrifuged 1 minute, draws supernatant, is obtained nucleic acid extractive, is determined using PCR nucleic acid extraction effect.
Pork PCR amplification system, amplification program and extension increasing sequence are the same as embodiment 1.
It uses TE buffer solution that nucleic acid extractive is diluted 80 times as PCR reaction template to expand, obtains amplified fluorescence
Curve graph 5.
As the result is shown: positive sample generates amplification curve in Fig. 5, and negative sample does not generate amplification, in embodiment 5
Amplification is compared, the fluorescent amplification curve C of the positive sampletValue will lean on latter point, illustrate the nucleic acid extractive diluting 80
50 times than dilution of effect again of effect is poor.
Embodiment 8
Firstly, by lysate (0.6M sodium chloride, the dodecyl sulphur of 0.6g/ml of the fresh pork of 100mg and 150 μ L
Sour sodium, the Nonidet P40 of 0.1g/ml, 0.05g/ml polyvinylpyrrolidone) mix, room temperature stand 2 minutes；So
Afterwards, 10000rpm is centrifuged 1 minute, draws supernatant, is obtained nucleic acid extractive, is determined using LAMP nucleic acid extraction effect.
Pork LAMP amplification system, amplification program and extension increasing sequence are the same as embodiment 4.
It uses TE buffer solution that nucleic acid extractive is diluted 80 times as LAMP reaction template to expand, obtains amplified fluorescence
Curve graph 6.
As the result is shown: positive sample generates amplification curve in Fig. 6, and negative sample does not generate amplification, and in embodiment 4
Amplification compare, the fluorescent amplification curve T of the positive sampletValue will lean on latter point, illustrate to dilute the nucleic acid extractive
50 times than dilution of 80 times of effect of effect is poor.
Embodiment 9
Firstly, by lysate (0.6M sodium chloride, the dodecyl sulphur of 0.6g/ml of the fresh beef of 100mg and 150 μ L
Sour sodium, the Nonidet P40 of 0.1g/ml, 0.05g/ml polyvinylpyrrolidone) mix, room temperature stand 2 minutes；So
Afterwards, 10000rpm is centrifuged 1 minute, draws supernatant, is obtained nucleic acid extractive, is determined using PCR nucleic acid extraction effect.
Beef PCR system: PCR reaction carries out in 25 μ L systems, which includes 0.8 μM of SYTO 9, TaKaRa
Taq HS polymerase 0.625U, 10 × PCR Buffer (Mg2+Plus), (purchase cures biotechnology from precious day to each 0.2mM of dNTP
(Beijing) Co., Ltd), primer concentration is 0.4 μM of (buying from Sangon Biotech (Shanghai) Co., Ltd.) limited liability company).
PCR amplification program: 94 DEG C of thermal starting 5min, 40 circulations, each circulation include 94 DEG C of reaction 30s, 60 DEG C of reactions
30s, 72 DEG C of reaction 30s.
The primer sequence used:
F (SEQ ID NO.11): 5 ' CTGCTATGTGTATGGGTTCC 3 '
R (SEQ ID NO.12): 5 ' GTAGAAAGACCAGTCCTTGC 3 '
The template sequence (SEQ ID NO.13) of amplification:
5’CTGCTATGTGTATGGGTTCCATCCACCCCAGATTGAAATCGATTTGCTGAAGAATGGGGAGAAGAT
TAAATCGGAGCAGTCAGACCTGTCTTTCAGCAAGGACTGGTCTTTCTAC3’(GeneBank:NC_037337.1)
It uses TE buffer solution that nucleic acid extractive is diluted 20 times as PCR reaction template to expand, obtains amplified fluorescence
Curve graph 7.
As the result is shown: positive sample generates amplification curve in Fig. 7, and negative sample does not generate amplification, shows that the nucleic acid mentions
It takes method that can effectively extract the nucleic acid in beef, and can be reacted and be detected using PCR.
Embodiment 10
Firstly, by lysate (0.6M sodium chloride, the dodecyl sulphur of 0.6g/ml of the fresh beef of 100mg and 150 μ L
Sour sodium, the Nonidet P40 of 0.1g/ml, 0.05g/ml polyvinylpyrrolidone) mix, room temperature stand 2 minutes；So
Afterwards, 10000rpm is centrifuged 1 minute, draws supernatant, is obtained nucleic acid extractive, is determined using LAMP nucleic acid extraction effect.
Beef LAMP system: LAMP reaction carries out in 25 μ L systems, which includes 0.4 μM of SYTO9, Bst DNA
Polymerase (large fragment) 16U, 10xThermoPol Reaction, Betaine (glycine betaine) 0.8M, MgCl22mM, dNTP are each
0.35mM, primers F 3/B3 concentration are respectively 0.2 μM, and primers F IP/BIP concentration is respectively 1.6mM, and primer LF/LB concentration is respectively 0.4 μM
(buying from Sangon Biotech (Shanghai) Co., Ltd.) limited liability company).
LAMP amplification program: 63 DEG C heated at constant temperature 45 minutes, 90 circulation, every 30s read a fluorescent value.
The primer sequence used:
F3 (SEQ ID NO.14): 5 ' GCTAATCAGCCCATGCTC 3 '
B3 (SEQ ID NO.15): 5 ' TTGACTTTGTTTGGAGTGCT 3 '
FIP (SEQ ID NO.16):
5’TCCAGCTACAATAGATGCTCCGACACATAACTGTGCTGTCAT 3’
BIP (SEQ ID NO.17):
5’GCATCTTGAGCACCAGCATAAAGTGGTGGTAGATATTTAAGGG 3’
LF (SEQ ID NO.18): 5 ' ATAGCTGAGTCCAAGCATCC 3 '
LB (SEQ ID NO.19): 5 ' CAGTCAATGGTCACAGGACA 3 '
The template sequence (SEQ ID NO.20) of amplification:
5’GCTAATCAGCCCATGCTCACACATAACTGTGCTGTCATACATTTGGTATTTTTTTATTTTGGGGGA
TGCTTGGACTCAGCTATGGCCGTCAAAGGCCCTGACCCGGAGCATCTATTGTAGCTGGACTTAACTGCATCTTGAG
CACCAGCATAATGATAAGCATGGACATTACAGTCAATGGTCACAGGACATAAATTATATTATATATCCCCCCTTCA
TAAAAATTTCCCCCTTAAATATCTACCACCACTTTTAACAGACTTTTCCCTAGATACTTATTTAAATTTTTCACGC
TTTCAATACTCAATTTAGCACTCCAAACAAAGTCAA3’(GeneBank:AY526085.1)
It uses TE buffer solution that nucleic acid extractive is diluted 20 times as LAMP reaction template to expand, obtains amplified fluorescence
Curve graph 8.
As the result is shown: positive sample generates amplification curve in Fig. 8, and negative sample does not generate amplification, shows that the nucleic acid mentions
It takes method that can effectively extract the nucleic acid in beef, and can be reacted and be detected using LAMP.
Embodiment 11
Firstly, by lysate (0.6M sodium chloride, the dodecyl sulphur of 0.6g/ml of the fresh beef of 100mg and 150 μ L
Sour sodium, the Nonidet P40 of 0.1g/ml, 0.05g/ml polyvinylpyrrolidone) mix, room temperature stand 2 minutes；So
Afterwards, 10000rpm is centrifuged 1 minute, draws supernatant, is obtained nucleic acid extractive, is determined using PCR nucleic acid extraction effect.
Beef PCR amplification system, amplification program and extension increasing sequence are the same as embodiment 9.
It uses TE buffer solution that nucleic acid extractive is diluted 50 times as PCR reaction template to expand, obtains amplified fluorescence
Curve graph 9.
As the result is shown: positive sample generates amplification curve in Fig. 9, and negative sample does not generate amplification, in embodiment 9
Amplification is compared, the fluorescent amplification curve C of the positive sampletValue will be located further forward, and illustrate the nucleic acid extractive diluting 50 times
Effect than dilution 20 times effect it is good.
Embodiment 12
Firstly, by lysate (0.6M sodium chloride, the dodecyl sulphur of 0.6g/ml of the fresh beef of 100mg and 150 μ L
Sour sodium, the Nonidet P40 of 0.1g/ml, 0.05g/ml polyvinylpyrrolidone) mix, room temperature stand 2 minutes；So
Afterwards, 10000rpm is centrifuged 1 minute, draws supernatant, is obtained nucleic acid extractive, is determined using LAMP nucleic acid extraction effect.
Pork LAMP amplification system, amplification program and extension increasing sequence are the same as embodiment 10.
It uses TE buffer solution that nucleic acid extractive is diluted 50 times as LAMP reaction template to expand, obtains amplified fluorescence
Curve graph 10.
As the result is shown: positive sample generates amplification curve in Figure 10, and negative sample does not generate amplification, and with embodiment 10
In amplification compare, the fluorescent amplification curve T of the positive sampletValue will be located further forward, and illustrate to dilute the nucleic acid extractive
20 times than dilution of 50 times of effect of effect is good.
Embodiment 13
Firstly, by lysate (0.6M sodium chloride, the dodecyl sulphur of 0.6g/ml of the fresh beef of 100mg and 150 μ L
Sour sodium, the Nonidet P40 of 0.1g/ml, 0.05g/ml polyvinylpyrrolidone) mix, room temperature stand 2 minutes；So
Afterwards, 10000rpm is centrifuged 1 minute, draws supernatant, is obtained nucleic acid extractive, is determined using PCR nucleic acid extraction effect.
Beef PCR amplification system, amplification program and extension increasing sequence are the same as embodiment 9.
It uses TE buffer solution that nucleic acid extractive is diluted 80 times as PCR reaction template to expand, obtains amplified fluorescence
Curve graph 11.
As the result is shown: positive sample generates amplification curve in Figure 11, and negative sample does not generate amplification, in embodiment 9
Amplification compare, the fluorescent amplification curve C of the positive sampletValue will lean on latter point, illustrate to dilute the nucleic acid extractive
50 times than dilution of 80 times of effect of effect is poor.
Embodiment 14
Firstly, by lysate (0.6M sodium chloride, the dodecyl sulphur of 0.6g/ml of the fresh beef of 100mg and 150 μ L
Sour sodium, the Nonidet P40 of 0.1g/ml, 0.05g/ml polyvinylpyrrolidone) mix, room temperature stand 2 minutes；So
Afterwards, 10000rpm is centrifuged 1 minute, draws supernatant, is obtained nucleic acid extractive, is determined using LAMP nucleic acid extraction effect.
Pork LAMP amplification system, amplification program and extension increasing sequence are the same as embodiment 10.
It uses TE buffer solution that nucleic acid extractive is diluted 80 times as LAMP reaction template to expand, obtains amplified fluorescence
Curve graph 12.
As the result is shown: positive sample generates amplification curve in Figure 12, and negative sample does not generate amplification, and with embodiment 10
In amplification compare, the fluorescent amplification curve T of the positive sampletValue will lean on latter point, illustrate the nucleic acid extractive is dilute
The effect for releasing 50 times than dilution of 80 times of effect is poor.
Comparative example 1
Firstly, the lysate of the fresh pork of 100mg and 150 μ L are mixed, room temperature stands 2 minutes；Then, 10000rpm
Supernatant is drawn in centrifugation 1 minute, is obtained nucleic acid extractive, is determined using PCR nucleic acid extraction effect.
This experiment is tested using the lysate of five kinds of heterogeneity contents, this five kinds different lysates are distinguished
Labeled as E, F, G, H, I.
E:0.6M sodium chloride；
F:0.6M sodium chloride, the dodecyl sodium sulfate of 0.6g/ml；
G:0.6M sodium chloride, the Nonidet P40 of the dodecyl sodium sulfate of 0.6g/ml, 0.1g/ml；
H:0.6M sodium chloride, the dodecyl sodium sulfate of 0.6g/ml, the Nonidet P40 of 0.1g/ml, 0.05g/
The polyvinylpyrrolidone of ml.
The dodecyl sodium sulfate of I:0.6g/ml, the Nonidet P40 of 0.1g/ml, 0.05g/ml polyethylene
Pyrrolidones.
Pork PCR amplification system, amplification program and extension increasing sequence are the same as embodiment 1.
It uses TE buffer solution that nucleic acid extractive is diluted 20 times as PCR reaction template to expand, according to real-time fluorescence
The C of PCR reactiontThe size of the value initial cycle number of fluorescence signal (can be detected) determines nucleic acid extraction effect, CtBe worth it is smaller,
Illustrate that nucleic acid amount to obtain is more.Experimental designs and it the results are shown in Table 5.
Table 5
| Lysate | Ct |
| E | 31.0 |
| F | 29.7 |
| G | 28.1 |
| H | 27.3 |
| I | 32.9 |
From the results of view, pork, C are cracked using sodium chloride merelytValue is very big, illustrates to use sodium chloride cracking effect merely
Fruit is poor；When dodecyl sodium sulfate is added, CtValue obviously becomes smaller, and illustrates that dodecyl sodium sulfate can assist in sodium chloride together
Accelerate sample dissociation；When continuously adding Nonidet P40, CtValue continues to become smaller, and illustrates Nonidet P40 energy
It is enough to assist to accelerate sample dissociation together；When continuously adding polyvinylpyrrolidone, CtValue is still becoming smaller, but amplitude of variation is not
It is very greatly, to illustrate that polyvinylpyrrolidone can also accelerate sample dissociation to a certain extent, but effect may not have dodecane
Both base sodium sulfonate and Nonidet P40 effect are obvious；When being added without sodium chloride, C is foundtValue significantly increases, and says
Bright sodium chloride plays a significant role during lysate sample.
The method of the present invention that the above embodiments are only used to help understand and its core concept.It should be pointed out that for
For those skilled in the art, without departing from the principle of the present invention, if can also be carried out to the present invention
Dry improvement and modification, these improvement and modification are also fallen into the claims in the present invention protection scope.
Sequence table
<110>Hangzhou peace reputation new bridge education and science Co., Ltd
<120>a kind of lysate and method for extracting meat nucleic acid
<160> 20
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 1
gaaggttcag gtttactcac g 21
<210> 2
<211> 23
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 2
tcagcaaatc aatttcaatc tgg 23
<210> 3
<211> 107
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 3
gaaggttcag gtttactcac gccacccagc ggaaaacgga aagccaaatt acctgaactg 60
ctatgtatct gggttccatc cgccccagat tgaaattgat ttgctga 107
<210> 4
<211> 21
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 4
agactatgaa gacctcacct t 21
<210> 5
<211> 19
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 5
agtgctgact agcttctca 19
<210> 6
<211> 39
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 6
agggatggga cggctcatga caatcgagtt gttctacca 39
<210> 7
<211> 39
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 7
acagatgcta tcccaggacg atctgagcac tgtccgtaa 39
<210> 8
<211> 22
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 8
gcagtacgtc ttcagaggat ac 22
<210> 9
<211> 22
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 9
ctctaatatc cacacgacct gg 22
<210> 10
<211> 378
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 10
agactatgaa gacctcacct ttgactcata tataatcccc acatcagatc ttaaacctgg 60
agaaatacga ctactagaag tagacaatcg agttgttctg ccaatagaaa taacaatccg 120
aatattagtg tcctctgaag acgtactaca ctcatgagct gtcccatccc tcggtttaaa 180
aacagatgct atcccaggac gactaaacca aacaactcta atatccacac gacctggcct 240
ttattacgga cagtgctcag aaatctgtgg atcaaaccac agcttcatgc ccattgtact 300
tgaacttgtc ccattaaagt acttcgaaaa atggtcaaca tcaatattaa caggttcatt 360
gagaagctag tcagcact 378
<210> 11
<211> 20
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 11
ctgctatgtg tatgggttcc 20
<210> 12
<211> 20
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 12
gtagaaagac cagtccttgc 20
<210> 13
<211> 115
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 13
ctgctatgtg tatgggttcc atccacccca gattgaaatc gatttgctga agaatgggga 60
gaagattaaa tcggagcagt cagacctgtc tttcagcaag gactggtctt tctac 115
<210> 14
<211> 18
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 14
gctaatcagc ccatgctc 18
<210> 15
<211> 20
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 15
ttgactttgt ttggagtgct 20
<210> 16
<211> 42
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 16
tccagctaca atagatgctc cgacacataa ctgtgctgtc at 42
<210> 17
<211> 43
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 17
gcatcttgag caccagcata aagtggtggt agatatttaa ggg 43
<210> 18
<211> 20
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 18
atagctgagt ccaagcatcc 20
<210> 19
<211> 20
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 19
cagtcaatgg tcacaggaca 20
<210> 20
<211> 330
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 20
gctaatcagc ccatgctcac acataactgt gctgtcatac atttggtatt tttttatttt 60
gggggatgct tggactcagc tatggccgtc aaaggccctg acccggagca tctattgtag 120
ctggacttaa ctgcatcttg agcaccagca taatgataag catggacatt acagtcaatg 180
gtcacaggac ataaattata ttatatatcc ccccttcata aaaatttccc ccttaaatat 240
ctaccaccac ttttaacaga cttttcccta gatacttatt taaatttttc acgctttcaa 300
tactcaattt agcactccaa acaaagtcaa 330
Claims (10)
1. a kind of lysate for extracting meat nucleic acid, which is characterized in that the lysate is by sodium chloride, dodecyl sodium sulfate, second
Base phenyl polyethylene glycol and polyvinylpyrrolidone are dissolved in water and are mixed to get；Concentration of each component in mixed liquor is respectively as follows:
Sodium chloride: 0.2~1.5M,
Dodecyl sodium sulfate: 0.01~1g/ml,
Nonidet P40: 0.01~0.5g/ml,
Polyvinylpyrrolidone: 0.01g/ml~0.1g/ml.
2. lysate according to claim 1, which is characterized in that concentration of the sodium chloride in mixed liquor be 0.3~
1M。
3. lysate according to claim 1, which is characterized in that concentration of the dodecyl sodium sulfate in mixed liquor
For 0.1~0.8g/ml.
4. lysate according to claim 1, which is characterized in that the Nonidet P40 is dense in mixed liquor
Degree is 0.05~0.2g/ml.
5. lysate according to claim 1, which is characterized in that concentration of the polyvinylpyrrolidone in mixed liquor
For 0.03~0.08g/ml.
6. a kind of method for extracting meat nucleic acid, which comprises the steps of:
(1) the meat sample that will be minced is mixed with the described in any item lysates of claim 1-5 at normal temperature, is stood
For a period of time；
(2) it is centrifugated, takes supernatant to get nucleic acid extractive is arrived.
7. according to the method described in claim 6, it is characterized in that, the mass volume ratio of the meat sample and lysate is 2:
2~2:6g/ml.
8. according to the method described in claim 6, it is characterized in that, the step (1) time of repose is 1~5min.
9. according to the method described in claim 6, it is characterized in that, the centrifugal rotational speed is 8000rpm~15000rpm.
10. according to the method described in claim 6, it is characterized in that, the centrifugation time is 1min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811423651.6A CN109371012B (en) | 2018-11-27 | 2018-11-27 | Lysate and method for extracting meat nucleic acid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811423651.6A CN109371012B (en) | 2018-11-27 | 2018-11-27 | Lysate and method for extracting meat nucleic acid |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109371012A true CN109371012A (en) | 2019-02-22 |
| CN109371012B CN109371012B (en) | 2021-02-09 |
Family
ID=65377117
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811423651.6A Active CN109371012B (en) | 2018-11-27 | 2018-11-27 | Lysate and method for extracting meat nucleic acid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109371012B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111808847A (en) * | 2020-08-12 | 2020-10-23 | 济南国益生物科技有限公司 | Release agent for rapidly extracting nucleic acid by one-step method and preparation and use methods thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1884524A (en) * | 2006-06-16 | 2006-12-27 | 北京未名凯拓农业生物技术有限公司 | Method for extracting plant RNA |
| CN102146374A (en) * | 2011-01-27 | 2011-08-10 | 四川农业大学 | Cell lysis solution for extracting animal DNA, kit and method |
| CN104673926A (en) * | 2015-03-21 | 2015-06-03 | 苏州天隆生物科技有限公司 | Pine wood nematode PCR (polymerase chain reaction) detection kit and detection method thereof |
| WO2015119719A1 (en) * | 2014-02-04 | 2015-08-13 | Syngenta Participations Ag | Genomic dna extraction reagent and method |
| CN106755575A (en) * | 2016-12-27 | 2017-05-31 | 湖南新南方养殖服务有限公司 | A kind of real-time fluorescence RT PCR kits for detecting piglet Cord blood highly pathogenic PRRSV variant and application thereof |
| CN108048452A (en) * | 2017-12-27 | 2018-05-18 | 北京百迈客生物科技有限公司 | The method for extracting fish musculature genomic DNA |
| CN108277218A (en) * | 2018-03-31 | 2018-07-13 | 中国农业科学院草原研究所 | A kind of Leymus chinensis seeds RNA extraction method at sprouting initial stage |
-
2018
- 2018-11-27 CN CN201811423651.6A patent/CN109371012B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1884524A (en) * | 2006-06-16 | 2006-12-27 | 北京未名凯拓农业生物技术有限公司 | Method for extracting plant RNA |
| CN102146374A (en) * | 2011-01-27 | 2011-08-10 | 四川农业大学 | Cell lysis solution for extracting animal DNA, kit and method |
| WO2015119719A1 (en) * | 2014-02-04 | 2015-08-13 | Syngenta Participations Ag | Genomic dna extraction reagent and method |
| CN104673926A (en) * | 2015-03-21 | 2015-06-03 | 苏州天隆生物科技有限公司 | Pine wood nematode PCR (polymerase chain reaction) detection kit and detection method thereof |
| CN106755575A (en) * | 2016-12-27 | 2017-05-31 | 湖南新南方养殖服务有限公司 | A kind of real-time fluorescence RT PCR kits for detecting piglet Cord blood highly pathogenic PRRSV variant and application thereof |
| CN108048452A (en) * | 2017-12-27 | 2018-05-18 | 北京百迈客生物科技有限公司 | The method for extracting fish musculature genomic DNA |
| CN108277218A (en) * | 2018-03-31 | 2018-07-13 | 中国农业科学院草原研究所 | A kind of Leymus chinensis seeds RNA extraction method at sprouting initial stage |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111808847A (en) * | 2020-08-12 | 2020-10-23 | 济南国益生物科技有限公司 | Release agent for rapidly extracting nucleic acid by one-step method and preparation and use methods thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109371012B (en) | 2021-02-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Matthaei et al. | Characteristics and stabilization of DNAase-sensitive protein synthesis in E. coli extracts | |
| CN104946790B (en) | A kind of PCR method for 8 kinds of animal derived materials of identification of tracing to the source | |
| CN104946788A (en) | PCR primer and kit for identifying eight kinds of animal-derived components | |
| CA2703884A1 (en) | Method and kit for preparation of sample for use in nucleic acid amplification | |
| CN107058498B (en) | Triple real-time fluorescence PCR method for detecting bovine, ovine and porcine derived components | |
| WO2019017452A1 (en) | Method for detecting presence or absence of non-enveloped rna virus | |
| Brachet et al. | The effect of nucleases on cytochemical reactions for amino acids and on staining with acid dyes | |
| CN109371012A (en) | A kind of lysate and method extracting meat nucleic acid | |
| Hnilica et al. | Fractionation and analysis of nuclear proteins in sea urchin embryos | |
| CN102094090A (en) | Cholera toxin virulence gene detection kit and detection method thereof | |
| CN109355407B (en) | Primer, kit and method for detecting pseudomonas aeruginosa through PSR isothermal amplification reaction | |
| CN104962650B (en) | A kind of synchronous PCR method and kit for differentiating animal derived materials | |
| Choules et al. | Peptidase activity in the membranes of Mycoplasma laidlawii | |
| JPH11512602A (en) | Control for PCR | |
| Trkov et al. | Detection of Salmonella in food over 30 h using enrichment and polymerase chain reaction | |
| CN104789692B (en) | A kind of primer sets and kit for differentiating cattle and sheep pig derived component | |
| JP6880692B2 (en) | Improved screening method for intestinal bacteria | |
| CN109355408A (en) | A kind of primer, kit and its method of PSR detection Escherichia coli type I shiga toxin | |
| CN112831571A (en) | Double-dye fluorescence PCR (polymerase chain reaction) specific detection system for simultaneously detecting species of acipenser ruthenus and acipenser sibiricus and application thereof | |
| CN109355405A (en) | A kind of primer, kit and its method of PSR isothermal amplification detection vibrio parahemolyticus | |
| CN101153343A (en) | Fluorescence quantification PCR primer and method for special detection of virulent and medially virulent newcastle disease virus | |
| JP2018166410A (en) | Methods for long term storage of nucleic acid in biological samples | |
| Cacace et al. | Isolation of Multiple Forms of DNA‐Dependent RNA Polymerase from Calf‐Liver Nuclei | |
| CN108251534B (en) | Multiple PCR detection kit for rapidly detecting meat-derived food | |
| CN101824482A (en) | Detection kit for vibrio cholerae O1 group and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |