CN109355405A - A kind of primer, kit and its method of PSR isothermal amplification detection vibrio parahemolyticus - Google Patents
A kind of primer, kit and its method of PSR isothermal amplification detection vibrio parahemolyticus Download PDFInfo
- Publication number
- CN109355405A CN109355405A CN201811006089.7A CN201811006089A CN109355405A CN 109355405 A CN109355405 A CN 109355405A CN 201811006089 A CN201811006089 A CN 201811006089A CN 109355405 A CN109355405 A CN 109355405A
- Authority
- CN
- China
- Prior art keywords
- primer
- vibrio parahemolyticus
- detection
- isothermal amplification
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses primer, kit and its methods of a kind of PSR isothermal amplification detection vibrio parahemolyticus.The present invention devises a pair of of detection primer Ft/Bt and a pair of of acceleration primer I F/IB for vibrio parahemolyticus specific target sequence tlh, and for nucleotide sequence as shown in NO.1~4 SEQ ID, which ensure that the reliability of testing result.A kind of kit of PSR isothermal amplification detection vibrio parahemolyticus is additionally provided in the present invention, good with high sensitivity, specificity, easy to operate quickly as a result accurately and reliably, testing cost is low, the characteristics of being suitble to middle-size and small-size unit and on-site test to apply.The present invention carries out the detection of polymerase spiral response using kit to Listeria monocytogenes, and this method will not cause the loss of time because of the change of temperature, and time-consuming short, amplified production does not need gel electrophoresis, can be with naked eyes judging result after directly being developed the color with fluorescent dye.
Description
Technical field
The invention belongs to field of biotechnology, in particular to a kind of PSR isothermal amplification detection vibrio parahemolyticus
Primer, kit and its method.
Background technique
Vibrio parahemolyticus is a kind of halophagia bacterium, is primarily present in seawater, bottom sediment and fish, the shrimp of offshore
In the marine products such as class, shellfish, oyster.People Duo Yin is edible to be caused to eat by vibrio parahemolyticus pollution and not cooked marine product
Object poisoning, ratio is high in food posioning, and harm is big.Currently, most of China's common detection methods will be by selection
Property culture, the reaction process such as biochemical identification and serology.These experimental implementations are cumbersome, need 5~6 days (d) of time-consuming, recall rate
It is low, bring difficulty to marine product production, inspection and quarantining for import/export, Food Hygiene Surveillance etc..There is parahemolyticas arc in China every year
Bacterium causes the report of food poisoning, and disease incidence is in rising trend in recent years.Therefore, it is quick, accurate, special to establish vibrio parahemolyticus
Body, sensitivity checkout and diagnosis method be very necessary.
Mainly there are traditional biochemical identification method and molecular biotechnology to the detection method of vibrio parahemolyticus at present
PCR method, there are also the detection method of enzyme linked immunological kit and all kinds of biochemical automatic assessing instruments of application based on immunology,
And most emerging genechip detection means.Genechip detection developed in recent years and PCR amplification method have
It is stronger specific, quick, sensitive, but higher cost.Immunological detection method, such as ELISA, immunochromatography etc., sensitivity
Height, but operating process is complicated, high expensive is unsuitable for extensive test sample.Current most widely used constant-temperature amplification skill
Art-LAMP also has its limitation, as design of primers is complicated, false positive rate is high, reagent valence height is higher.Polymerase spiral response
(Polymerase Spiral Reaction, PSR) technology, can be fast under isothermal conditions compared with other nucleic acid amplification technologies
Speed, efficiently, specifically expand target sequence, and it is easy to operate, do not need accurately alternating temperature equipment, cost is relatively low, food-borne micro-
Field of biological detection shows vast potential for future development.Therefore, establish it is a kind of for vibrio parahemolyticus it is novel have it is independent
The isothermal nucleic acid amplification method of intellectual property has great importance.
Summary of the invention
The primary purpose of the present invention is that the shortcomings that overcoming the prior art and deficiency, provide a kind of PSR isothermal amplification
Detect the primer of vibrio parahemolyticus.
Another object of the present invention is to provide a kind of kits of PSR isothermal amplification detection vibrio parahemolyticus.
Another object of the present invention is to provide a kind of method of PSR isothermal amplification detection vibrio parahemolyticus.It should
Method has high sensitivity, specificity good, and easy to operate quick, as a result accurately and reliably, testing cost is low, and suitable on-site test is answered
The characteristics of using.
The purpose of the invention is achieved by the following technical solution: a kind of PSR isothermal amplification detection vibrio parahemolyticus
Primer, including detection primer Ft and detection primer Bt accelerates primer I F and accelerates primer I B, the following institute of nucleotide sequence
Show:
Detection primer Ft:5 '-CGTGATGTTGTAACCTTGCGTGCGAAAGTGCTTGAGA T-3 ' (SEQ ID
NO.1)；
Detection primer Bt:5 '-GCGTTCCAATGTTGTAGTGCGATGAGCGGTTGATGTC C-3 ' (SEQ ID
NO.2)；
Accelerate primer I F:5 '-TGTGCCTTGATGAACTCGT-3 ' (SEQ ID NO.3)；
Accelerate primer I B:5 '-CTAACTTCTGCGCCCGA-3 ' (SEQ ID NO.4).
The vibrio parahemolyticus is preferably vibrio parahemolyticus ATCC17802 or vibrio parahemolyticus ATCC27969.
A kind of kit of PSR isothermal amplification detection vibrio parahemolyticus, including the inspection of above-mentioned PSR isothermal amplification
Survey the primer of vibrio parahemolyticus.
In the primer of the described PSR isothermal amplification detection vibrio parahemolyticus each primer (detection primer Ft, Bt,
And accelerate primer I F, IB) concentration be 50 μM.
The kit of the PSR isothermal amplification detection vibrio parahemolyticus, also comprises the following components:
A, 2 × reaction buffer: the ammonium sulfate of the Tris-HCl of 40.0mM, 20.0mM, the potassium chloride of 20.0mM, 16.0mM
Magnesium sulfate, the Tween 20 of 0.2% (v/v), the glycine betaine of 1.4M, the dNTPs (each) of 10.0mM；
B, Bst archaeal dna polymerase；
C, the mixed solution of calcein and manganese chloride.
Bst archaeal dna polymerase described in component B is preferably the Bst archaeal dna polymerase aqueous solution that concentration is 8U/ μ L.
The calcein of the mixed solution of calcein described in component C and manganese chloride and the concentration ratio of manganese chloride (rub
That ratio) it is 1:8.
The mixed solution of calcein described in component C and manganese chloride is prepared via a method which to obtain:
(i) calcein is dissolved in dimethyl sulfoxide (DMSO), the calcein solution of 50 μM of configuration；Manganese chloride is molten
Yu Shuizhong configures the manganese chloride aqueous solution of 1mM；
(ii) it takes the calcein solution of 50 μM of 25 μ L and the manganese chloride aqueous solution of 10 μ L 1mM to be uniformly mixed, obtains calcium
The mixed solution of yellowish green element and manganese chloride.
The primer of the PSR isothermal amplification detection vibrio parahemolyticus or the detection of PSR isothermal amplification are secondary molten
Application of the kit of hemorrhagic vibrios in detection vibrio parahemolyticus.
A kind of method of PSR isothermal amplification detection vibrio parahemolyticus, includes the following steps:
(1) DNA of bacteria of measuring samples is extracted as template DNA, and controls the OD of template DNA aqueous solution260/OD280Value
It is 1.8~2.0；
(2) 45~60 minutes progress polymerase spiral amplified reactions are kept the temperature in 65 DEG C of water-baths；Wherein, polymerase spiral expands
Increasing reaction system is 26 μ L reaction systems: 2 × reaction buffer 12.5 μ L, 50 μM of detection primer Ft and 50 μM of detection primer
Bt each 0.8 μ L, 50 μM of acceleration primer I each 0.8uL of F and IB, the 1.0 μ L of Bst archaeal dna polymerase of 2.0 μ L, 8U/ μ L of DNA profiling,
Deionized water complements to 25 μ L；It is eventually adding the calcein of 1 μ L and the mixed solution of manganese chloride；
(3) to keep the temperature the reaction of termination in 2 minutes in 80 DEG C of water-baths after the reaction was completed, then detect by an unaided eye color change,
If color is yellow, illustrate in measuring samples without containing vibrio parahemolyticus；If color becomes green, illustrate to contain in measuring samples
There is vibrio parahemolyticus.
The nucleotide sequence of detection primer Ft described in step (2) is as shown in SEQ ID NO.1, the core of detection primer Bt
Nucleotide sequence accelerates the nucleotide sequence such as SEQ ID NO.3 of primer I F as shown in SEQ ID NO.2, accelerates the core of primer I B
Nucleotide sequence is as shown in SEQ ID NO.4.
The time of polymerase spiral amplified reaction described in step (2) is preferably 45 minutes.
The mixed solution of calcein described in step (2) and manganese chloride is prepared via a method which to obtain:
(i) calcein is dissolved in dimethyl sulfoxide (DMSO), the calcein solution of 50 μM of configuration；Manganese chloride is molten
Yu Shuizhong configures the manganese chloride aqueous solution of 1mM；
(ii) it takes the calcein solution of 50 μM of 25 μ L and the manganese chloride aqueous solution of 10 μ L 1mM to be uniformly mixed, obtains calcium
The mixed solution of yellowish green element and manganese chloride (concentration of calcein solution and manganese chloride solution ratio is 1:8).
The present invention has the following advantages and effects with respect to the prior art:
(1) polymerase spiral designed by vibrio parahemolyticus specific target sequence tlh is directed to provided in the present invention
Testing and appraisal system, the period needed for solving method in the prior art is long, and sensitivity is low, at high cost, and field application difficulty etc. lacks
It falls into.
(2) method of the invention can will test the time and be reduced to 60 minutes, with tradition loop-mediated isothermal amplification technique phase
Than quick-break detection cycle, the on-site test of exploitation and microorganism to the amplification of novel constant-temperature amplification technique has great importance.
Meanwhile the invention also discloses the specific regions of the conserved region specific target sequence tlh for vibrio parahemolyticus to devise one
To detection primer, to ensure that the reliability of testing result.Secondly, the present invention expands under isothermal conditions, it will not be because of temperature
Change and cause the loss of time, it is time-consuming short, at 60 minutes with regard to achievable result interpretation.In addition, the technology do not need it is special, high
Expensive instrument and reagent, amplified production do not need gel electrophoresis, can directly be operated with naked eyes judging result with fluorescent dye colour developing
Simple and efficient, testing cost is lower.The particularly suitable middle-size and small-size unit of kit and method of the invention and on-site test.
Detailed description of the invention
Fig. 1 is the electrophoresis result figure of tlh primer screening experiment；Wherein, swimming lane M is DNA Marker, and swimming lane 1 is secondary haemolysis
Property vibrios ATCC17802, swimming lane 2 be vibrio parahemolyticus ATCC27969, NG is blank control.
Fig. 2 is the result figure that polymerase spiral response technology detects vibrio parahemolyticus；Wherein, NG is blank control, and 1 is
Vibrio parahemolyticus ATCC17802,2 be vibrio parahemolyticus ATCC27969.
Fig. 3 is that accelerate primer I F and IB by design tlh primer in proliferation time be respectively 5min, 10min, 15min,
20min, 25min, 30min, 35min, 40min, 45min, 50min, 55min, 60min are to colour developing result interpretation and electrophoresis knot
The influence diagram of fruit；Wherein, figure A is electrophoretogram under the differential responses time, swimming lane 1~12: the reaction time is respectively 5,10,15,20,
25,30,35,40,45,50,55,60min, swimming lane M are DS 2000Marker；Scheming B is chromogenic reaction knot under the differential responses time
Fruit.
Fig. 4 is specific detection experimental result picture；Wherein, swimming lane M is DNA Marker, swimming lane 1: vibrio parahemolyticus
ATCC17802；Swimming lane 2: vibrio parahemolyticus ATCC27969；Swimming lane 3: Escherichia coli E019；Swimming lane 4: Escherichia coli E020；
Swimming lane 5: Escherichia coli ATCC43894；Swimming lane 6: Escherichia coli ATCC43895；Swimming lane 7: salmonella ATCC29629；Swimming lane
8: salmonella ATCC19585；Swimming lane 9: salmonella ATCC14028；Swimming lane 10: salmonella ATCC13076；Swimming lane 11:
Listeria monocytogenes ATCC19116；Swimming lane 12: Listeria monocytogenes ATCC15313；Swimming lane 13: Listeria monocytogenes
ATCC19115；Swimming lane 14: Listeria monocytogenes ATCC19113；Swimming lane 15: pseudomonas aeruginosa ATCC27853；Swimming lane 16: copper
Green aeruginosa atcc 10145；Swimming lane 17: pseudomonas aeruginosa ATCC9027；Swimming lane 18: pseudomonas aeruginosa ATCC15442；
Swimming lane 19: staphylococcus aureus ATCC23235；Swimming lane 20: staphylococcus aureus ATCC6358；Swimming lane 21: golden yellow Portugal
Grape coccus ATCC12600；Swimming lane 22: staphylococcus aureus ATCC27664.
Fig. 5 is sensitivity experiments result figure；Wherein, swimming lane M is DNA Marker, and swimming lane 1 is 64ng/ μ L, and swimming lane 2 is
6.4ng/ μ L, swimming lane 3 are 640pg/ μ L, and swimming lane 4 is 64pg/ μ L, and swimming lane 5 is 6.4pg/ μ L, and swimming lane 6 is 640fg/ μ L, swimming lane 7
For 64fg/ μ L, swimming lane 8 is negative control.
Specific embodiment
Below with reference to embodiment, the present invention is described in further detail, and embodiments of the present invention are not limited thereto.
Unless stated otherwise, the present invention uses reagent, method and apparatus is the art conventional reagents, method and apparatus.Unless
It illustrates, agents useful for same, material and bacterial strain of the present invention can pass through commercially available acquisition.
The primer screening of 1 polymerase spiral response of embodiment detection vibrio parahemolyticus
1. design primer
It is as shown in Table 1 more for tlh shot design using PrimerPremier software according to PSR amplified reaction principle
Group primer.
Table 1
| Primer | Sequence (5 ' -3 ') |
| Ft-tlh-1 | ACGCCACGGTTGTAGTTCATTACAAACCAGCAAACACC |
| Bt-tlh-1 | TACTTGATGTTGGCACCGCAGTCCGTCAAACGAATCAG |
| Ft-tlh-2 | AGGTTTGGTTTTCTTGCGTGGAAGAGCCAACCTTATCAC |
| Bt-tlh-2 | GTGCGTTCTTTTGGTTTGGACCACCAGTAGCCGTCAAT |
| Ft-tlh-3 | CGTGATGTTGTAACCTTGCG-TGCGAAAGTGCTTGAGAT |
| Bt-tlh-3 | GCGTTCCAATGTTGTAGTGC-GATGAGCGGTTGATGTCC |
| Accelerate Primer | Sequence (5 ' -3 ') |
| IF-tlh-1 | CCAAACTCAAGCGTAA |
| IB-tlh-1 | AGTGAAAGCGGATTATG |
| IF-tlh-2 | ATCACTTCAGACGCTG |
| IB-tlh-2 | CTATGTTCGCTGTTGG |
| IF-tlh-3 | TGTGCCTTGATGAACTCGT |
| IB-tlh-3 | CTAACTTCTGCGCCCGA |
2. establishing polymerase spiral response detection method
(1) reaction system
1. concentration is respectively 50 μM of primer pair combination in table 1.
2. 2 × reaction liquid storage: the Tris-HCl for being 40.0mM by concentration, the ammonium sulfate of 20.0mM, the potassium chloride of 20.0mM,
The magnesium sulfate of 16.0mM, the Tween 20 of 0.2% (v/v), the glycine betaine of 1.4M, the mixed liquor of the dNTPs (each) of 10.0mM
Composition.
3. (Bst DNA Polymerase, Large Fragment, is purchased from the Bst archaeal dna polymerase that concentration is 8U/ μ L
NEB company) aqueous solution；
(2) detection method
1. extracting the DNA of bacteria of measuring samples as template DNA:
With vibrio parahemolyticus ATCC17802, vibrio parahemolyticus ATCC27969 is research object to designed primer
It is screened.It is thin that each group is extracted using DNA extraction kit (being purchased from Guangdong Dongsheng Biotechnology Co., Ltd, article No. N1152)
Bacterium DNA, operates according to kit specification, the OD of DNA of bacteria aqueous solution obtained by experimental group260/OD280Value (260nm and
Absorption photometric ratio under 280nm) it is 2.0；Blank control is done to be enucleated sour water.
The polymerase spiral amplified reaction of 2 zero vibrio parahemolyticus: being directed to target spot tlh, configures in reaction tube respectively total
Volume is the polymerase spiral amplification reaction system of 25 μ L；2 × reaction liquid storage, 12.5 μ L is added, corresponding Ft and Bt is mixed in equal volume
Close primer mixed liquor 1.6 μ L, corresponding acceleration primer I F and IB isometric mixed liquor 1.6uL, Bst archaeal dna polymerase 1 μ L, DNA
2.0 μ L of template supplements volume to 25 μ L with deionized water.Each material concentration at this time are as follows: Tris-HCl 20.0mM, ammonium sulfate
10.0mM, potassium chloride 10.0mM, magnesium sulfate 8.0mM, Tween 20 0.1% (v/v), glycine betaine 0.7M, dNTPs (each)
1.4mM, Bst archaeal dna polymerase 8U, accelerate each 1.6 μM of primer I F, IB by each 1.6 μM of primers F t, Bt.Reaction tube is placed in 65 DEG C
Insulation reaction 60 minutes in water-bath keep the temperature the reaction of termination in 2 minutes in 80 DEG C of water-baths.
3. carrying out 2% agarose gel electrophoresis to the product after amplification.As a result as shown in FIG. 1, FIG. 1 is target spots
The electrophoretogram of tlh primer screening, target spot tlh correspond to first set (Ft-tlh-1, Bt-tlh-1, IF-tlh-1 and
IB-tlh-1；) and second set of (Ft-tlh-2, Bt-tlh-2, IF-tlh-2 and IB-tlh-2 tlh1；Tlh2 it) designs
Primer in the third set primer swimming lane 1 and 2 that does not occur amplified band, and design there is amplified band, stoning is added
The swimming lane NG of sour water occurs without band, illustrates that the effect of this primer is best.Therefore third is selected to cover primer (Ft-tlh-3, Bt-
Tlh-3, IF-tlh-3 and IB-tlh-3；Tlh3) the best primer as detection tlh target spot.Primer of the invention is for two kinds
Different vibrio parahemolyticus can be achieved fast and accurately to detect, and illustrate that primer applicability is good.
Embodiment 2 is based on polymerase spiral response isothermal amplification technique and detects vibrio parahemolyticus
(V.parahaemolyticus) microbial process of ATCC27969
1, the method based on polymerase spiral isothermal amplification technique detection pathogenic microorganism, the present embodiment is with parahemolyticas arc
It is as follows using reagent for bacterium (V.parahaemolyticus) ATCC27969:
A. concentration be respectively 50 μM detection primer Ft aqueous solution and Bt aqueous solution primer and accelerate primer I F aqueous solution,
Accelerate primer I B aqueous solution, sequence is following (5 ' -3 '):
Detection primer Ft:
CGTGATGTTGTAACCTTGCGTGCGAAAGTGCTTGAGAT(SEQ ID NO.1)；
Detection primer Bt:
GCGTTCCAATGTTGTAGTGCGATGAGCGGTTGATGTCC(SEQ ID NO.2)；
Accelerate primer I F:TGTGCCTTGATGAACTCGT (SEQ ID NO.3)；
Accelerate primer I B:CTAACTTCTGCGCCCGA (SEQ ID NO.4).
B.2 × reaction liquid storage: the Tris-HCl for being 40.0mM by concentration, the ammonium sulfate of 20.0mM, the potassium chloride of 20.0mM,
The magnesium sulfate of 16.0mM, the Tween 20 of 0.2% (v/v), the glycine betaine of 1.4M, the mixed liquor of the dNTPs (each) of 10.0mM
Composition；
C. concentration is Bst archaeal dna polymerase (large fragment, NEB company) aqueous solution of 8U/ μ l；
D. the mixed solution of calcein and manganese chloride: (dimethyl is sub- for the calcein solution that first configuration concentration is 50 μM
Sulfone dissolution)；Then the calcein solution for taking 50 μM of 25 μ L, is uniformly mixed that (calcium is yellowish green with the manganese chloride aqueous solution of 10 μ L 1mM
The concentration of plain solution and manganese chloride solution ratio is 1:8).
2, vibrio parahemolyticus is detected using polymerase spiral response amplification technique using mentioned reagent, including walked as follows
It is rapid:
(1) DNA of bacteria of measuring samples is extracted as template DNA:
Experimental group and blank control group is arranged simultaneously in the present embodiment, and wherein experimental group is two plants of vibrio parahemolyticus
ATCC17802 and ATCC27969 (American Type Culture Collecti)；Using DNA extraction kit, (Guangdong Dongsheng biotechnology is limited
Company) each group DNA of bacteria is extracted, it is operated according to kit specification, the OD of DNA of bacteria aqueous solution obtained by experimental group260/OD280
Value (260nm and 280nm under absorption photometric ratio) be 2.0.
(2) polymerization that total volume is 26 μ l the polymerase spiral amplified reaction of vibrio parahemolyticus: is configured in reaction tube
Enzyme spiral amplification reaction system；2 × reaction 12.5 μ L of liquid storage, detection primer Ft and the isometric mix primer mixed liquor of Bt is added
1.6 μ L, corresponding acceleration primer I F and IB isometric mixed liquor 1.6uL, 1 μ L of Bst archaeal dna polymerase, 2.0 μ L of DNA profiling are used
Deionized water supplements volume to 25 μ L, is eventually adding the 1 μ L of calcein and manganese chloride mixed liquor aqueous solution of above-mentioned concentration, mixes
?.Each material concentration at this time are as follows: Tris-HCl20.0mM, ammonium sulfate 10.0mM, potassium chloride 10.0mM, magnesium sulfate 8.0mM,
Tween 20 0.1% (v/v), glycine betaine 0.7M, dNTPs (each) 1.4mM, Bst archaeal dna polymerase 8U, detection primer Ft, Bt
Each 1.6 μM, accelerate each 1.6 μM of primer I F, IB.Reaction tube is placed in 65 DEG C of water-baths insulation reaction 60 minutes, then at 80 DEG C of water
The reaction of termination in 2 minutes is kept the temperature in bath.
(3) color developing detection: to the color change that after reaction, detects by an unaided eye
As a result as shown in Fig. 2, as the result is shown: the color of blank control group is yellow, illustrates to detect bacterial strain without containing secondary molten
Hemorrhagic vibrios gene；The color of experimental group becomes green, illustrates containing vibrio parahemolyticus gene, then carries out to amplified production
2% agarose gel electrophoresis, the positive group present trapezoid-shaped strips, negative group without amplified band, it is consistent with expected results.
Influence of 3 reaction time of embodiment to PSR amplification system
PSR amplified reaction is a kind of efficient, quick GENE Assay analysis means, can by designing corresponding acceleration primer
To obtain testing result in 1h.Mainly there are observation method of naked eye and gel electrophoresis to test the method for PSR reaction result judgement at present
Card.And gel electrophoresis is due to that only can be unable to reach the purpose of on-site test in laboratory operation, it is a kind of visual therefore, it is desirable to construct
Change reaction system to expand the operation strategies of PSR amplification technique.Therefore this experiment assists electrophoresis verifying by visualization color change,
Determine the Best Times of the reaction optimum detection.PSR amplification reaction system is constructed with vibrio parahemolyticus tlh target spot, is inquired into
Under the conditions of 65 DEG C, influence of the reaction time to PSR amplification system.
(1) the step of reference implementation example 1 selects primers F t-tlh-3, Bt-tlh-3, IF-tlh-3 and IB-tlh-3 to pair
Hemolytic vibrios ATCC17802 and vibrio parahemolyticus ATCC27969 carries out PSR amplified reaction；Wherein, reaction temperature 65
DEG C, the reaction time is respectively 5,10,15,20,25,30,35,40,45,50,55,60min.Product after amplification is carried out
2% agarose gel electrophoresis, as a result as shown in Figure 3A.
(2) the step of reference implementation example 2, to vibrio parahemolyticus ATCC17802 and vibrio parahemolyticus ATCC27969 into
Row PSR amplified reaction；Wherein, reaction temperature is 65 DEG C, the reaction time is respectively 5,10,15,20,25,30,35,40,45,50,
55,60min.To the color change that after reaction, detects by an unaided eye, the result that develops the color is as shown in Figure 3B.
(3) interpretation of result: in conjunction with Fig. 3 A and 3B it is found that when the time of amplified reaction is that 40min or more carries out PSR amplification
When, apparent color change (color gradually becomes green) can occur, reaction result is the positive at this time.Amplified production is through 2%
Agarose electrophoresis result verification, discovery can produce scalariform band after 35min, show as positive findings.So explanation is logical
Corresponding acceleration the primer I F and IB of design is crossed, the PSR amplification reaction system of foundation can be obtained within 60min to reaction result
Interpretation.But judge whether reaction carries out illustrating whether to contain strain to be tested needs time-consuming about 50min with this by electrophoresis result,
It is not available in detection at the scene simultaneously, this is not inconsistent with the purpose for establishing rapid and convenient reaction system.Therefore, the foundation of exploitation
Whether PSR amplification reaction system is carried out with color change to judge to react.It is yellow by designing corresponding acceleration primer and addition calcium
The mixed solution of green element and manganese chloride determines that optimal PSR reaction proliferation time is 45min.
4 polymerase spiral response of embodiment detects vibrio parahemolyticus specific test
By vibrio parahemolyticus (vibrio parahemolyticus ATCC17802, vibrio parahemolyticus ATCC27969) and other bacterial strains
(Escherichia coli E019；Escherichia coli E020；Escherichia coli ATCC43894；Escherichia coli ATCC43895；Salmonella
ATCC29629；Salmonella ATCC19585；Salmonella ATCC14028；Salmonella ATCC13076；Listeria monocytogenes
ATCC19116；Listeria monocytogenes ATCC15313；Listeria monocytogenes ATCC19115；Listeria monocytogenes ATCC19113；
Pseudomonas aeruginosa ATCC27853；Pseudomonas aeruginosa ATCC10145；Pseudomonas aeruginosa ATCC9027；Pseudomonas aeruginosa
ATCC15442；Staphylococcus aureus ATCC23235；Staphylococcus aureus ATCC6358；Staphylococcus aureus
ATCC12600；Staphylococcus aureus ATCC27664) genomic DNA according to reaction system (primer: Ft- in embodiment 1
Tlh-3, Bt-tlh-3, IF-tlh-3 and IB-tlh-3) and condition establish polymerase spiral response detection method, carry out specificity
Test.It is positive control that the genome containing vibrio parahemolyticus, which is arranged, and ultrapure water is negative control (in negative control and Fig. 1
Blank control result it is identical).Wherein, above-mentioned Escherichia coli E019 and Escherichia coli E020 can refer to document (all Rong low temperature
[D] South China Science & Engineering University is studied in the influence for storing induction and toxin expression quantity to enterorrhagia Escherichia coli VBNC state,
2015.) obtain.
As a result as shown in Figure 4.The result shows that only there is positive reaction containing vibrio parahemolyticus genome, remaining is
Negative reaction is presented.
The sensitivity tests of embodiment 5PSR detection vibrio parahemolyticus
The genome of vibrio parahemolyticus ATCC27969 is carried out 10 times of concentration gradients to dilute, respectively 64ng/ μ L,
6.4ng/ μ L, 640pg/ μ L, 64pg/ μ L, 6.4pg/ μ L, 640fg/ μ L, 64fg/ μ L, while negative control (deionization is set
Water), in accordance with the above-mentioned embodiment 1 in reaction system construct polymerase spiral response amplification method (primer: Ft-tlh-3, Bt-
Tlh-3, IF-tlh-3 and IB-tlh-3), to determine the sensibility of detection method, as a result as shown in Figure 5.The result shows that: it establishes
Vibrio parahemolyticus polymerase spiral response method can detect sample in 6.4pg/ μ L vibrio parahemolyticus DNA.
Conclusion: polymerase spiral response amplification method and Standard PCR and fluorescent PCR be can be seen that from above-mentioned experimental result
It has the advantages that
Operate and identify and is simple and efficient: Standard PCR whole process could go out in 2~4 hours as a result, quantitative fluorescent PCR
1~1.5 hour is needed, detection method provided by the present invention just may occur in which positive findings at 60 minutes.Secondly to instrument requirements
It is low, it is only necessary to a common water-bath, and testing result can directly be observed by fluorescent dye, eliminate traditional electrophoresis inspection
Survey step.Have wide practical use in quick detection and the practice of on-site test.
High specificity: only by whether amplification just can determine whether the presence or absence of target gene, so as to complete determining for bacterium
Property detection.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention,
It should be equivalent substitute mode, be included within the scope of the present invention.
Sequence table
<110>South China Science & Engineering University
<120>a kind of primer, kit and its method of PSR isothermal amplification detection vibrio parahemolyticus
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 38
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223>detection primer Ft
<400> 1
cgtgatgttg taaccttgcg tgcgaaagtg cttgagat 38
<210> 2
<211> 38
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223>detection primer Bt
<400> 2
gcgttccaat gttgtagtgc gatgagcggt tgatgtcc 38
<210> 3
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223>accelerate primer I F
<400> 3
tgtgccttga tgaactcgt 19
<210> 4
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223>accelerate primer I B
<400> 4
ctaacttctg cgcccga 17
<210> 5
<211> 38
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223> Ft-tlh-1
<400> 5
acgccacggt tgtagttcat tacaaaccag caaacacc 38
<210> 6
<211> 38
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223> Bt-tlh-1
<400> 6
tacttgatgt tggcaccgca gtccgtcaaa cgaatcag 38
<210> 7
<211> 39
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223> Ft-tlh-2
<400> 7
aggtttggtt ttcttgcgtg gaagagccaa ccttatcac 39
<210> 8
<211> 38
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223> Bt-tlh-2
<400> 8
gtgcgttctt ttggtttgga ccaccagtag ccgtcaat 38
<210> 9
<211> 16
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223> IF-tlh-1
<400> 9
ccaaactcaa gcgtaa 16
<210> 10
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223> IB-tlh-1
<400> 10
agtgaaagcg gattatg 17
<210> 11
<211> 16
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223> IF-tlh-2
<400> 11
atcacttcag acgctg 16
<210> 12
<211> 16
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223> IB-tlh-2
<400> 12
ctatgttcgc tgttgg 16
Claims (9)
1. a kind of primer of PSR isothermal amplification detection vibrio parahemolyticus, it is characterised in that: including detection primer Ft and inspection
Primer Bt is surveyed, primer I F is accelerated and accelerates primer I B, nucleotide sequence is as follows:
Detection primer Ft:5 '-CGTGATGTTGTAACCTTGCGTGCGAAAGTGCTTGAGAT-3 '；
Detection primer Bt:5 '-GCGTTCCAATGTTGTAGTGCGATGAGCGGTTGATGTCC-3 '；
Accelerate primer I F:5 '-TGTGCCTTGATGAACTCGT-3 '；
Accelerate primer I B:5 '-CTAACTTCTGCGCCCGA-3 '.
2. a kind of kit of PSR isothermal amplification detection vibrio parahemolyticus, it is characterised in that: including claim 1 institute
The primer for the PSR isothermal amplification detection vibrio parahemolyticus stated.
3. the kit of PSR isothermal amplification detection vibrio parahemolyticus according to claim 2, it is characterised in that:
The concentration of each primer in the primer of the PSR isothermal amplification detection vibrio parahemolyticus is 50 μM.
4. the kit of PSR isothermal amplification detection vibrio parahemolyticus according to claim 2 or 3, feature exist
In also comprising the following components:
A, 2 × reaction buffer: the ammonium sulfate of the Tris-HCl of 40.0mM, 20.0mM, the potassium chloride of 20.0mM, the sulphur of 16.0mM
Sour magnesium, the Tween 20 of 0.2% (v/v), the glycine betaine of 1.4M, the dNTPs (each) of 10.0mM；
B, Bst archaeal dna polymerase；
C, the mixed solution of calcein and manganese chloride.
5. the kit of PSR isothermal amplification detection vibrio parahemolyticus according to claim 4, it is characterised in that:
Bst archaeal dna polymerase described in component B is the Bst archaeal dna polymerase aqueous solution that concentration is 8U/ μ L.
6. the kit of PSR isothermal amplification detection vibrio parahemolyticus according to claim 4, which is characterized in that
The mixed solution of calcein described in component C and manganese chloride is prepared via a method which to obtain:
(i) calcein is dissolved in dimethyl sulfoxide, the calcein solution of 50 μM of configuration；Manganese chloride is soluble in water, match
Set the manganese chloride aqueous solution of 1mM；
(ii) it takes the calcein solution of 50 μM of 25 μ L and the manganese chloride aqueous solution of 10 μ L 1mM to be uniformly mixed, it is yellowish green to obtain calcium
The mixed solution of element and manganese chloride.
7. the primer or claim 2~6 of PSR isothermal amplification detection vibrio parahemolyticus described in claim 1 are any
Application of the kit of PSR isothermal amplification detection vibrio parahemolyticus described in detection vibrio parahemolyticus.
8. a kind of method of PSR isothermal amplification detection vibrio parahemolyticus, which comprises the steps of:
(1) DNA of bacteria of measuring samples is extracted as template DNA, and controls the OD of template DNA aqueous solution260/OD280Value is 1.8
~2.0；
(2) 45~60 minutes progress polymerase spiral amplified reactions are kept the temperature in 65 DEG C of water-baths；Wherein, the amplification of polymerase spiral is anti-
Answering system is 26 μ L reaction systems: 2 × reaction buffer 12.5 μ L, 50 μM of detection primer Ft and 50 μM of detection primer Bt are each
0.8 μ L, 50 μM of acceleration primer I each 0.8uL of F and IB, the 1.0 μ L of Bst archaeal dna polymerase of 2.0 μ L, 8U/ μ L of DNA profiling, go from
Sub- water complements to 25 μ L；It is eventually adding the calcein of 1 μ L and the mixed solution of manganese chloride；
(3) to keep the temperature the reaction of termination in 2 minutes in 80 DEG C of water-baths after the reaction was completed, then detect by an unaided eye color change, such as face
Color is yellow, is illustrated in measuring samples without containing vibrio parahemolyticus；If color becomes green, illustrate in measuring samples containing pair
Hemolytic vibrios；
The nucleotide sequence of detection primer Ft described in step (2) is as shown in SEQ ID NO.1, the nucleotide of detection primer Bt
Sequence accelerates the nucleotide sequence such as SEQ ID NO.3 of primer I F as shown in SEQ ID NO.2, accelerates the nucleotide of primer I B
Sequence is as shown in SEQ ID NO.4.
9. the method for PSR isothermal amplification detection vibrio parahemolyticus according to claim 8, it is characterised in that:
The time of polymerase spiral amplified reaction described in step (2) is 45 minutes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811006089.7A CN109355405B (en) | 2018-08-30 | 2018-08-30 | Primer, kit and method for detecting vibrio parahaemolyticus by PSR isothermal amplification reaction |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811006089.7A CN109355405B (en) | 2018-08-30 | 2018-08-30 | Primer, kit and method for detecting vibrio parahaemolyticus by PSR isothermal amplification reaction |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109355405A true CN109355405A (en) | 2019-02-19 |
| CN109355405B CN109355405B (en) | 2022-10-25 |
Family
ID=65350318
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811006089.7A Active CN109355405B (en) | 2018-08-30 | 2018-08-30 | Primer, kit and method for detecting vibrio parahaemolyticus by PSR isothermal amplification reaction |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109355405B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110628950A (en) * | 2019-10-10 | 2019-12-31 | 中国检验检疫科学研究院 | Primer combination, kit and PSR method for detecting EV71 virus |
| CN112695110A (en) * | 2020-12-29 | 2021-04-23 | 复旦大学 | Primer group and kit for rapidly detecting streptococcus pneumoniae nucleic acid through polymerase helix reaction and application of primer group and kit |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101358235A (en) * | 2008-08-22 | 2009-02-04 | 华南理工大学 | Rapid test kit of vibrio parahaemolyticus isothermal amplification and use method |
| CN103667498A (en) * | 2013-12-27 | 2014-03-26 | 集美大学 | Detection method for vibrio parahemolyticus |
| CN104975013A (en) * | 2015-07-07 | 2015-10-14 | 中国人民解放军疾病预防控制所 | Method for accelerating spiral reaction of polymerase and application of method |
| WO2017206194A1 (en) * | 2016-05-30 | 2017-12-07 | 北京安洁优科技有限公司 | One-tube packaging method for diagnostic reagent and bottle for one-tube packaged diagnostic reagent |
-
2018
- 2018-08-30 CN CN201811006089.7A patent/CN109355405B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101358235A (en) * | 2008-08-22 | 2009-02-04 | 华南理工大学 | Rapid test kit of vibrio parahaemolyticus isothermal amplification and use method |
| CN103667498A (en) * | 2013-12-27 | 2014-03-26 | 集美大学 | Detection method for vibrio parahemolyticus |
| CN104975013A (en) * | 2015-07-07 | 2015-10-14 | 中国人民解放军疾病预防控制所 | Method for accelerating spiral reaction of polymerase and application of method |
| WO2017206194A1 (en) * | 2016-05-30 | 2017-12-07 | 北京安洁优科技有限公司 | One-tube packaging method for diagnostic reagent and bottle for one-tube packaged diagnostic reagent |
Non-Patent Citations (4)
| Title |
|---|
| 丁良 等: ""实时定量聚合酶螺旋反应定量检测变形链球菌方法的建立"", 《生物技术通讯》 * |
| 周用直 等: "《感染性腹泻病原检测技术》", 30 August 1996, 周用直等 * |
| 王欢等: "基于颜色判定的环介导恒温扩增技术快速检测铜绿假单胞菌的研究", 《第三军医大学学报》 * |
| 马文 等: ""聚合酶螺旋反应快速检测甲型 H1N1 流感病毒"", 《军事医学》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110628950A (en) * | 2019-10-10 | 2019-12-31 | 中国检验检疫科学研究院 | Primer combination, kit and PSR method for detecting EV71 virus |
| CN110628950B (en) * | 2019-10-10 | 2022-06-07 | 中国检验检疫科学研究院 | Primer combination, kit and PSR method for detecting EV71 virus |
| CN112695110A (en) * | 2020-12-29 | 2021-04-23 | 复旦大学 | Primer group and kit for rapidly detecting streptococcus pneumoniae nucleic acid through polymerase helix reaction and application of primer group and kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109355405B (en) | 2022-10-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110195121B (en) | CPA primer, kit and detection method for detecting methicillin-resistant staphylococcus aureus | |
| WO2021129118A1 (en) | Primer, kit, and method for cpa detection of pseudomonas aeruginosa | |
| CN102864228A (en) | Loop-mediated isothermal amplification (LAMP) kit for rapidly detecting vibrio parahaemolyticus | |
| CN102094090B (en) | Cholera toxin virulence gene detection kit and detection method thereof | |
| CN109355405A (en) | A kind of primer, kit and its method of PSR isothermal amplification detection vibrio parahemolyticus | |
| CN110283936A (en) | A kind of African swine fever virus LAMP-HNB Visual retrieval kit | |
| CN109355407B (en) | Primer, kit and method for detecting pseudomonas aeruginosa through PSR isothermal amplification reaction | |
| CN104513857A (en) | Loop-mediated isothermal amplification detection primer group, detection method and kit of vibrio parahaemolyticus | |
| CN109355404A (en) | Primer, kit and detection method based on polymerase spiral response Constant Temperature Detection Listeria monocytogenes | |
| CN104878116A (en) | Quantitative determination method for pathogenic bacteria in food | |
| CN109355408A (en) | A kind of primer, kit and its method of PSR detection Escherichia coli type I shiga toxin | |
| CN108796118A (en) | A kind of target collarium mediated amplification detection primer and its detection method | |
| CN109735636A (en) | A kind of primer, kit and the method for PSR detection staphylococcus aureus leucocytic toxin | |
| CN109355403B (en) | Primer, kit and method for PSR (phosphosilicate-like receptor) detection of methicillin-resistant staphylococcus aureus | |
| CN108796098A (en) | A kind of primer, kit and its method of PSR isothermal amplifications detection colon bacillus shiga toxin | |
| CN105543350B (en) | A kind of the LAMP detection primer group and detection method of gnathostoma siamense | |
| CN109182467A (en) | Primer and its kit and method based on digital LAMP technology detection salmonella | |
| CN114703304A (en) | LAMP double-strand detection probe and freeze-dried microspheres of burkholderia gladioli, and preparation method and detection method thereof | |
| CN109517913B (en) | Primer, kit and method for PSR (phosphoenolpyruvate carboxylase) detection of heat-resistant direct hemolysin and heat-resistant related hemolysin | |
| CN107488720A (en) | For detecting the primer sets and its detection method of Escherichia coli O 157 in feed | |
| CN108754001A (en) | Primer, kit and detection method based on polymerase spiral response Constant Temperature Detection salmonella | |
| CN108796099A (en) | A kind of Escherichia coli O 157:PSR detection primers, kit and its detection method of H7 | |
| LU500199B1 (en) | LAMP-based nanomaterial and its application in visualization detection method for antibiotic resistant staphylococcus aureus in foods | |
| CN111549148A (en) | Visual detection method of brucella loop-mediated isothermal amplification technology | |
| CN110257530A (en) | Animal derived materials rapid detection method based on LAMP technology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |