CN110257530A - Animal derived materials rapid detection method based on LAMP technology - Google Patents
Animal derived materials rapid detection method based on LAMP technology Download PDFInfo
- Publication number
- CN110257530A CN110257530A CN201910613727.XA CN201910613727A CN110257530A CN 110257530 A CN110257530 A CN 110257530A CN 201910613727 A CN201910613727 A CN 201910613727A CN 110257530 A CN110257530 A CN 110257530A
- Authority
- CN
- China
- Prior art keywords
- primer
- lamp
- detection
- animal derived
- derived materials
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to animal derived materials authenticity identification methods, specifically utilize the method for ring mediated isothermal amplification (LAMP) technology detection horse derived component DNA, calf-derived Cyclospora DNA and sheep derived material DNA.This method devises the LAMP primer of specificity according to the mitochondrial DNA of horse, ox, goat, and provides matched kit, detection method and purposes.The present invention combines visualization report manner, and the visual colorimetric detection of a step can be realized by carrying out colorimetric detection with dimethyl diaminophenazine chloride pH indicator.The present invention carries out under isothermal conditions, and without accurate alternating temperature equipment, convenient, accurate, high resolution, detection process is suitable for field quick detection without operation of uncapping.
Description
Technical field
The invention belongs to animal derived materials authenticity identification methods, specifically detect Ma Yuan respectively using LAMP technology
The method of property ingredient, calf-derived Cyclospora and goat derived component DNA.
Background technique
In recent years, the adulteration of food frequently occurs, and it is relatively conventional a kind of food adulteration phenomenon that meat products, which mixes puppet,
Mainly some illegal retailers are to speculate, and mix into meat products and even replace with that form is similar, price is more honest and clean
The non-meat of the same race of valence.By taking " horseflesh disturbance " event as an example, the ox of many large supermarkets in European countries such as Britain in 2013
Horseflesh ingredient is detected in meat product.These adulterated meats without the examination by quarantine departments, even there is one mostly
The non-meat of a little things, the meat of these unknown sources may carry unknown pathogenic bacteria, or contain some harmful chemicals
Ingredient brings serious influence to consumer's health.In order to more efficiently supervise and control the generation of such phenomenon, to the greatest extent
Possible that this kind of adulterated meat is prevented to flow into consumer's hand, establishing effective animal derived materials detection method can not only have
The strike illegal retailer of power, and can targetedly take measures to reduce the generation of such phenomenon.
With the development of molecular biology technology, many be widely used by mesh object detection method of DNA molecular.Phase
Compared with traditional detection method, the detection method of nucleic acid amplification shows better stability and sensitivity.It is currently more common
Be polymerase chain reaction (PCR) technology, by temperature variation controlled denaturation, annealing, extension process to realize pair
The amplification of target molecule.Norihiro Tomita et al. proposed loop-mediated isothermal amplification technique (LAMP), the amplification in 2000
Process needs to use a pair of of inner primer of special designing and a pair of of outer primer plays a role jointly, realizes and expands under conditions of isothermal
Increase reaction.Final product is the stem ring DNA with different repetitive sequences and the cauliflower-shaped structure with multiple rings.Ring mediated isothermal
Amplification (LAMP) is a kind of Progress of Nucleic Acid Amplification Technologies carried out under isothermal conditions, shown within the shorter reaction time compared with
High sensitivity and amplification efficiency, LAMP method has become one of most common isothermal duplication means at present.LAMP reaction
Monitoring can be in such a way that real-time fluorescence is reported and end point fluorescence reports method, but need to be equipped with fluorescence detection device, is not suitable for
On-site quick screening.In recent years, visual analysis method shows advantage in rapid field detection.Visualize dye colorimetric analysis
Both the discrimination of naked eyes had been improved, operation is again more simple, in the case where guaranteeing its accuracy rate, can be directly used for quickly existing
Field detecting has report using pH indicator dimethyl diaminophenazine chloride (neutral red, N-red) as the visual method for reporting of a step, can
Making LAMP technology, field of fast detection is with greater advantage at the scene.
Summary of the invention
The object of the present invention is to provide based on LAMP technology detect animal derived (horse source property, Niu Yuanxing, goat source property) at
LAMP primer, kit, detection method and the purposes divided.
The specific LAMP primer of animal derived materials detection of the present invention is all based on the conservative of mtdna sequence
What region was designed.
The specific LAMP primer of horse derived component detection is that horse (Equus caballus) is found from GeneBank
Mitochondrial cytochrome oxidizing ferment I (COI) gene, by being compared with several species sequence, selection and other species differences
More segment devises the LAMP primer of horse as targeting sequence.Its nucleotide sequence is as follows:
Outer primer M-B3:TGAATAAGAAGATGAAGCCTAGA
Outer primer M-F3:GCTCACCACATGTTTACAGT
Inner primer M-BIP:GTAAAAGTATTCAGCTGACTAGCCACTCAGAGTATAGCTGGAGATCA
Inner primer M-FIP:CCAGTAGGGATAGCGATGATTATGGAGTAGGGATAGACGTTGACACA
Ring primer M-LB:CCCTGCACGGAGGAAATATCA
Ring primer M-LF:TAGCTGATGTGAAGTATGCTCG
The specific LAMP primer of calf-derived Cyclospora detection is the line that ox (Bos taurus) is found from GeneBank
Plastochondria D-loop gene is selected with the more segment of other species differences by being compared with several species sequence as targeting
Sequence devises the LAMP primer of ox.Its nucleotide sequence is as follows:
Outer primer N-B3:TTGACTTTGTTTGGAGTGC
Outer primer N-F3:AACTGCATCTTGAGCACC
Inner primer N-BIP:ATCTACCACCACTTTTAACAGACTT-AATTGAGTATTGAAAGCGTGAA
Inner primer N-FIP:GGAAATTTTTATGAAGGGGGGGATA-GCATAATGATAAGCGTGGACA
Ring primer N-LB:TTCCCTAGATACTTATTTAAATTT
Ring primer N-LF:ATTTATGTCCTGTGACCATTGACTG
The specific LAMP primer of goat derived component detection is that goat (Capra is found from GeneBank
Hircus mitochondrial cytochrome b (cytb) gene), by being compared with several species sequence, it is poor with other species to select
Different more segment devises the LAMP primer of goat as targeting sequence.Its nucleotide sequence is as follows:
Outer primer SY-B3:ACATACATTACGTTTATGCTGG
Outer primer SY-F3:TACAGACATGCCAACAGC
Inner primer SY-BIP:CGCTCGCCTACACACAAATACA ATATGTGTAGGGTAGATATACAGTA
Inner primer SY-FIP:GCATACACGTAATATTGTGTGGTGTAAAAACATCCCAATCCTAACC
Ring primer SY-LB:TACTAACATCCATATAACGCGGACATACAG
Ring primer SY-LF:TGGCGTTTGTGTGGGTATCTAAGTTG
Basic detection kit the present invention is based on LAMP technology detection animal derived materials includes above-mentioned corresponding animal
LAMP outer primer, inner primer, archaeal dna polymerase, dNTPs, glycine betaine, 10x LAMP reaction buffer, deionized water.
Acceleration detection kit the present invention is based on LAMP technology detection animal derived materials further includes above-mentioned corresponding animal
LAMP outer primer, inner primer, ring primer, archaeal dna polymerase, dNTPs, glycine betaine, 10x LAMP reaction buffer, deionization
Water.
The present invention is based on the basic detection kit of LAMP technology detection animal derived materials or acceleration detection kits also
May include that signal reports molecule is used to indicate testing result: when indicating result with fluorescence signal, signal reports molecule be can be
Fluorescent molecule such as SYBR Green I；When indicating result with macroscopic colorimetric signal, signal reports molecule can be hydroxyl
Naphthol blue or dimethyl diaminophenazine chloride etc..
Preferably, above-mentioned 10xLAMP reaction buffer includes 200mM Tris-HCl (pH8.8), 600mM KCl, 80mM
MgSO4,100mM (NH4)2SO4, 1%Triton X-100.
When particularly, using dimethyl diaminophenazine chloride as signal reports molecule, preferred above-mentioned 10xLAMP reaction buffer includes 50mM
Tris-HCl (pH8.8), 600mM KCl, 80mM MgSO4,100mM (NH4)2SO4, 1%Triton X-100.
The present invention is based on the detection method of the animal derived materials of LAMP technology, detecting step includes:
(1) extraction of sample to be tested DNA；
(2) DNA extracted using step (1) selects above-mentioned animal derived LAMP primer or kit to carry out as template
LAMP reaction；
(3) LAMP amplified production is analyzed: having amplified signal, then containing corresponding with the primer or kit in sample to be tested
Animal derived materials；Without amplified signal, then corresponding animal derived materials are free of in sample to be tested.
The basic amplification reaction system of animal derived detection method of the present invention based on LAMP technology, preferably are as follows:
When using real-time fluorescence reporting system, the concentration that fluorescent dye SYBR Green I is added is 1/50000；Work as benefit
When with colorimetric analysis reporter, the concentration that pH indicator dimethyl diaminophenazine chloride is added is 100 μm of mol/L.Finally 25 are complemented to ddH2O
μL。
The acceleration amplification reaction system of animal derived detection method of the present invention based on LAMP technology, preferably are as follows:
When using real-time fluorescence reporting system, the concentration that fluorescent dye SYBR Green I is added is 1/50000；Work as benefit
When with colorimetric analysis reporter, the concentration that pH indicator dimethyl diaminophenazine chloride is added is 100 μm of mol/L.Finally 25 are complemented to ddH2O
μL。
The reaction temperature of animal derived detection method of the present invention based on LAMP technology is 55-65 DEG C.
As used herein, following word/term has following meanings, unless otherwise stated.
" DNA ": DNA.It is a kind of large biological molecule for having hereditary information, by 4 kinds of main deoxyriboses
Nucleotide is formed by connecting by 3 ', 5 '-phosphodiester bonds, is the carrier of hereditary information.
" LAMP ": the isothermal duplication that ring mediates.It is a kind of technology of external isothermal duplication DNA specific fragment, amplification procedure
It is divided into initial product formation stages and cyclic amplification stage, it is final to generate the DNA macromolecular with a large amount of inverted repeats
Segment, this method have the characteristics that high specificity, high sensitivity, easy to operate, time saving.
The present invention has the advantages that be substantially better than the prior art, and major advantage includes:
1. specificity.The present invention is based on LAMP technology detection horse source property, Niu Yuanxing, goat source property primer all in accordance with
The mtdna sequence announced in GenBank is designed in its highly conserved region, the experimental results showed that each primer combines
Specificity preferably, can accurately detect target animal derived component, amplification is showed no to other animal derived materials；In mixing meat
0.1% target animal derived component can be easily told in class.
2. rapidity.Very quick using the method for the present invention detection, at most 40min is it can be learnt that testing result.
3. practicability.Animal derived materials detection method of the present invention only needs simple thermostat, therefore, be more suitable for
Field quick detection.
4. economy.When present invention combination dimethyl diaminophenazine chloride pH indicator carries out colorimetric detection, just without to primer and probe sequence
Column are modified, and synthesis is convenient, and can realize the visual colorimetric detection of a step, to substantially reduce testing cost.
Detailed description of the invention
Fig. 1 is specific embodiment 1 to being horse derived component LAMP detection method specific test result (by the 1- that puts in order
16 are respectively as follows: horse, ox, pig, sheep, rabbit, mouse, dog, chicken, duck, dove, the frog, fish, snake, deer, camel, NC: negative control).
Fig. 2 is that specific embodiment 2 is horse derived component LAMP detection method sensitivity test result (by the pipe 1- that puts in order
6 are respectively as follows: NC: negative control, 60ng horse dna, 6ng horse dna, 0.6ng horse dna, 60pg horse dna, 6pg horse dna).
Fig. 3 is that specific embodiment 3 is horse derived component LAMP detection method in detection different proportion horse ox meat mixture sample
Product test result (by putting in order, pipe 1-6 is respectively as follows: NC: negative control, horseflesh content be 100%, 10%, 1%,
0.1%, 0 sample).
Fig. 4 is specific embodiment 4 to being calf-derived Cyclospora LAMP detection method specific test result (by the 1- that puts in order
8 are respectively as follows: ox, pig, sheep, horse, rabbit, mouse, chicken；NC: negative control).
Fig. 5 is specific embodiment 5 to being goat derived component LAMP detection method specific test result (by putting in order
1-8 is respectively as follows: NC: negative control；Sheep, ox, pig, horse, rabbit, mouse, chicken).
Specific embodiment
With reference to the accompanying drawing, the present invention is further illustrated by example.It should be understood by those skilled in the art that these examples
It is merely to illustrate the present invention, rather than is limited the scope of the invention.
Embodiment 1, horse derived component detection method specific test
(1) sample DNA is extracted according to DNA extraction kit specification.
LAMP reaction is carried out as template using the DNA that 1 part of horseflesh sample and remaining 14 parts of animal sample extract.Remaining 14 kinds dynamic
Object sample includes: ox, pig, sheep, rabbit, mouse, dog, chicken, duck, dove, the frog, fish, snake, deer, camel.
(2) horse derived component detection method LAMP primer, primer sequence are as follows:
M-B3:TGAATAAGAAGATGAAGCCTAGA
M-F3:GCTCACCACATGTTTACAGT
M-BIP:GTAAAAGTATTCAGCTGACTAGCCACTCAGAGTATAGCTGGAGATCA
M-FIP:CCAGTAGGGATAGCGATGATTATGGAGTAGGGATAGACGTTGACACA
M-LB:TAGCTGATGTGAAGTATGCTCG
M-LF:CCCTGCACGGAGGAAATATCA
(3) LAMP reaction system and reaction condition
When using real-time fluorescence reporting system, the concentration that fluorescent dye SYBR Green I is added is 1/50000；Work as benefit
When with colorimetric analysis reporter, the concentration that pH indicator dimethyl diaminophenazine chloride is added is 100 μm of ol/L.
Reaction system is finally complemented into 25 μ L with ultrapure water.
LAMP reaction condition is: 61 DEG C of reaction 1h.
Negative control (NC) are as follows: add the ultrapure water for being equivalent to template volume in reaction tube.
(4) detection method
When carrying out colorimetric analysis using dimethyl diaminophenazine chloride, entire reaction is placed in thermostat or water-bath after reacting 1h directly
Taking-up visually observes.
(5) testing result
As shown in Fig. 1, horse is expanded simultaneously with this method, ox, pig, sheep, rabbit, mouse, dog, chicken, duck, dove, the frog, fish, snake,
Deer, 15 sample DNA of camel.Under dimethyl diaminophenazine chloride visualization system, after reaction carries out 1 hour, only horseflesh genomic DNA reacts
Observe red positive findings, and remaining 14 kinds of meat genomic DNA reaction result is still yellow, the negative control with no template
It is consistent.Show that the horse derived component detection method established in this research has good specificity, with 14 kinds of other animals
Sample does not generate cross reaction, does not occur false positive results, is one species specific, accurate horse derived component detection method.
The horse dna sample that embodiment 2, horse derived component LAMP method sensitivity test extract kit is used
It is 60ng/ μ L that NanoDrop, which measures sample concentration,.It is diluted by 10 times of gradients, successively obtains 60ng/ μ L, 6ng/ μ L,
The horse dna sample of 0.6ng/ μ L, 60pg/ μ L, 6pg/ μ L takes 1 μ L to carry out sensitivity experiment respectively.
As shown in Fig. 2, in the case where dimethyl diaminophenazine chloride visualizes amplification system, reaction carries out 1 hour, can obviously observe
60ng, 6ng, 0.6ng, 60pg, 6pg (pipe 2-6) reaction tube is pink positive findings, and the negative control without template is still protected
Hold yellow negative findings (pipe 1).Fluorescence curve result is consistent with visualization colour developing result, and it is good to show that this method has
Sensitivity, containing only 6pg horseflesh genome DNA sample can also detect in 1 hour.
Embodiment 3, horse derived component LAMP method are in the test for detecting different proportion horse ox meat mixture sample
It prepares meat mixture sample: weighing fresh horseflesh 1g and 9g fresh beef appetizer, uniformly mixing, obtains 10g and contain after pulverizing
The mixing sample of 10% horseflesh；Mixing sample and 9g fresh beef appetizer of the 1g containing 10% horseflesh are weighed, uniformly mixing, obtains after pulverizing
10g contains the mixing sample of 1% horseflesh；Mixing sample and 9g fresh beef appetizer of the 1g containing 1% horseflesh are weighed, uniformly mixing after pulverizing,
Obtain the mixing sample that 10g contains 0.1% horseflesh.Finally, 100% horseflesh sample, the mixing sample containing 10% horseflesh contain 1% horse
The mixing sample of meat, mixing sample containing 0.1% horseflesh and without the beef sample of horseflesh weigh 30mg respectively and are mentioned with kit
Take DNA.
As shown in Fig. 3, in the case where dimethyl diaminophenazine chloride visualizes amplification system, reaction carries out 1 hour, and horseflesh content is from 100%-
Pink positive findings (pipe 2-5) can be presented in 0.1% sample, and the sample (pipe 6) and the yin without template that horseflesh content is 0
Property control all present yellow negative findings (pipe 1).The above amplified fluorescence result is consistent with visual test result, is shown
This method is suitable for mixing the detection of sample, and only the horseflesh containing 0.1% can also detect in 1 hour.
Embodiment 4, calf-derived Cyclospora detection method specific test
(1) sample DNA is extracted according to DNA extraction kit specification.
LAMP reaction is carried out as template using the DNA that 1 part of beef sample and remaining 6 parts of animal sample extract.Remaining 6 kinds of animal
Sample includes: pig, sheep, horse, rabbit, mouse, chicken.
(2) calf-derived Cyclospora detection method LAMP primer, primer sequence are as follows:
N-B3:TTGACTTTGTTTGGAGTGC
N-F3:AACTGCATCTTGAGCACC
N-BIP:ATCTACCACCACTTTTAACAGACTTAATTGAGTATTGAAAGCGTGAA
N-FIP:GGAAATTTTTATGAAGGGGGGGATAGCATAATGATAAGCGTGGACA
N-LB:TTCCCTAGATACTTATTTAAATTT
N-LF:ATTTATGTCCTGTGACCATTGACTG
(3) LAMP reaction system and reaction condition
When being added using real-time fluorescence reporting system, the concentration that fluorescent dye SYBR Green I is added is 1/50000；
When using colorimetric analysis reporter, the concentration that pH indicator dimethyl diaminophenazine chloride is added is 100 μm of ol/L.
Reaction system is finally complemented into 25 μ L with ultrapure water.
LAMP reaction condition is: 61 DEG C of reaction 1h.
Negative control (NC) are as follows: add the ultrapure water for being equivalent to template volume in reaction tube.
(4) detection method
When carrying out colorimetric analysis using dimethyl diaminophenazine chloride, entire reaction is placed in thermostat or water-bath after reacting 1h directly
Taking-up visually observes.
(5) testing result
As shown in Fig. 4, ox, pig, sheep, horse, rabbit, mouse, 7 kinds of sample DNAs of chicken are expanded simultaneously with this method.Dimethyl diaminophenazine chloride can
Depending under change system, after reaction carries out 1 hour, red positive findings are observed in only beef genomic DNA reaction, and remaining 6
Kind meat genomic DNA reaction result is still yellow, is consistent with the negative control of no template.Show to establish in this research
Calf-derived Cyclospora detection method has good specificity, other animal samples do not generate cross reaction with 6 kinds, do not occur vacation
Positive findings are one species specific, accurate calf-derived Cyclospora detection method.
Embodiment 5, goat derived component detection method specific test
(1) sample DNA is extracted according to DNA extraction kit specification.
LAMP reaction is carried out as template using the DNA that 1 part of meat samples and remaining 6 parts of animal sample extract.Remaining 6 kinds of animal
Sample includes: ox, pig, horse, rabbit, mouse, chicken.
(2) sheep derived material detection method LAMP primer, primer sequence are as follows:
SY-B3:ACATACATTACGTTTATGCTGG
SY-F3:TACAGACATGCCAACAGC
SY-BIP:CGCTCGCCTACACACAAATACA ATATGTGTAGGGTAGATATACAGTA
SY-FIP:GCATACACGTAATATTGTGTGGTGTAAAAACATCCCAATCCTAACC
SY-LB:TACTAACATCCATATAACGCGGACATACAG
SY-LF:TGGCGTTTGTGTGGGTATCTAAGTTG
(3) LAMP reaction system and reaction condition
When being added using real-time fluorescence reporting system, the concentration that fluorescent dye SYBR Green I is added is 1/50000；
When using colorimetric analysis reporter, the concentration that pH indicator dimethyl diaminophenazine chloride is added is 100 μm of ol/L.
Reaction system is finally complemented into 25 μ L with ultrapure water.
LAMP reaction condition is: 61 DEG C of reaction 1h.
Negative control (NC) are as follows: add the ultrapure water for being equivalent to template volume in reaction tube.
(4) detection method
When carrying out colorimetric analysis using dimethyl diaminophenazine chloride, entire reaction is placed in thermostat or water-bath after reacting 1h directly
Taking-up visually observes.
(5) testing result
As shown in Fig. 4, sheep, ox, pig, horse, rabbit, mouse, 7 kinds of sample DNAs of chicken are expanded simultaneously with this method.Dimethyl diaminophenazine chloride can
Depending under change system, after reaction carries out 1 hour, red positive findings are observed in only mutton genomic DNA reaction, and remaining 6
Kind meat genomic DNA reaction result is still yellow, is consistent with the negative control of no template.Show to establish in this research
Sheep derived material detection method has good specificity, other animal samples do not generate cross reaction with 6 kinds, do not occur vacation
Positive findings are a species specific, accurate sheep derived material detection methods.
Claims (14)
1. the specific LAMP primer that the animal derived materials based on LAMP technology detect, it is characterized in that: being all based on mitochondria
What the conservative region of DNA sequence dna was designed；The specific LAMP primer of horse derived component detection is according to the mitochondrial of horse
The design of chromo-oxidase I (COI) gene；The specific LAMP primer of calf-derived Cyclospora detection is according to the mitochondrial Ca2+ base of ox
Because of design；The specific LAMP primer of goat derived component detection is set according to mitochondrial cytochrome b (cytb) gene of goat
Meter.
2. the specific LAMP primer of animal derived materials detection according to claim 1, it is characterized in that: including drawing outside
Object, inner primer, ring primer；
The specific LAMP primer of horse derived component detection, preferably are as follows:
Outer primer M-B3:TGAATAAGAAGATGAAGCCTAGA
Outer primer M-F3:GCTCACCACATGTTTACAGT
Inner primer M-BIP:GTAAAAGTATTCAGCTGACTAGCCACTCAGAGTATAGCTGGAGATCA
Inner primer M-FIP:CCAGTAGGGATAGCGATGATTATGGAGTAGGGATAGACGTTGACACA
Ring primer M-LB:CCCTGCACGGAGGAAATATCA
Ring primer M-LF:TAGCTGATGTGAAGTATGCTCG；
The specific LAMP primer of calf-derived Cyclospora detection, preferably are as follows:
Outer primer N-B3:TTGACTTTGTTTGGAGTGC
Outer primer N-F3:AACTGCATCTTGAGCACC
Inner primer N-BIP:ATCTACCACCACTTTTAACAGACTT-AATTGAGTATTGAAAGCGTGAA
Inner primer N-FIP:GGAAATTTTTATGAAGGGGGGGATA-GCATAATGATAAGCGTGGACA
Ring primer N-LB:TTCCCTAGATACTTATTTAAATTT
Ring primer N-LF:ATTTATGTCCTGTGACCATTGACTG；
The specific LAMP primer of goat derived component detection, preferably are as follows:
Outer primer SY-B3:ACATACATTACGTTTATGCTGG
Outer primer SY-F3:TACAGACATGCCAACAGC
Inner primer SY-BIP:CGCTCGCCTACACACAAATACA ATATGTGTAGGGTAGATATACAGTA
Inner primer SY-FIP:GCATACACGTAATATTGTGTGGTGTAAAAACATCCCAATCCTAACC
Ring primer SY-LB:TACTAACATCCATATAACGCGGACATACAG
Ring primer SY-LF:TGGCGTTTGTGTGGGTATCTAAGTTG.
3. based on the basic detection kit of LAMP technology detection animal derived materials, it is characterized in that: including claim 1 or 2
The LAMP outer primer, inner primer.
4. based on the acceleration detection kit of LAMP technology detection animal derived materials, it is characterized in that: including claim 1 or 2
The LAMP outer primer, inner primer, ring primer.
5. the detection kit according to claim 3 or 4 based on LAMP technology detection animal derived materials, feature
It is: further includes archaeal dna polymerase, dNTPs, 10xLAMP reaction buffer, deionized water.
6. according to the described in any item detection kits based on LAMP technology detection animal derived materials of claim 3-5,
It is characterized in: can also includes that signal reports molecule is used to indicate testing result, when indicating result with fluorescence signal, signal reports point
Son can be fluorescent molecule such as SYBR Green I；When indicating result with macroscopic colorimetric signal, signal reports molecule can
To be hydroxynaphthol blue or dimethyl diaminophenazine chloride.
7. 10xLAMP reaction buffer according to claim 5, it is characterized in that: preferably 200mM Tris-HCl
(pH8.8), 600mM KCl, 80mM MgSO4, 100mM (NH4)2SO4, 1%Triton X-100.
8. 10xLAMP reaction buffer according to claim 5, it is characterized in that: when using dimethyl diaminophenazine chloride as signal reports molecule,
Preferably 50mM Tris-HCl (pH8.8), 600mM KCl, 80mM MgSO4, 100mM (NH4)2SO4, 1%Triton X-
100。
9. the detection method of the animal derived materials based on LAMP technology, it is characterized in that:
(1) extraction of sample to be tested DNA；
(2) DNA extracted using step (1) is template, select animal derived LAMP primer of any of claims 1 or 2 or
Kit described in claim 3 or 4 carries out LAMP reaction；
(3) LAMP amplified production is analyzed: having amplified signal, then containing corresponding with the primer or kit dynamic in sample to be tested
Object derived component；Without amplified signal, then corresponding animal derived materials are free of in sample to be tested.
10. the detection method of the animal derived materials according to claim 9 based on LAMP technology, it is characterized in that: described
LAMP reaction can be using basic amplification reaction system (including LAMP outer primer, inner primer, archaeal dna polymerase, dNTPs, beet
Alkali, 10x LAMP reaction buffer, deionized water) or acceleration amplification reaction system (including LAMP outer primer, inner primer, ring draw
Object, archaeal dna polymerase, dNTPs, glycine betaine, 10x LAMP reaction buffer, deionized water).
11. basis amplification reaction system according to claim 10, it is characterized in that: system is preferably,
When using real-time fluorescence reporting system, the concentration that fluorescent dye SYBR Green I is added is 1/50000；When using than
When colour analysis reporter, the concentration that pH indicator dimethyl diaminophenazine chloride is added is 100 μm of mol/L；Finally 25 μ L are complemented to ddH2O.
12. basis amplification reaction system according to claim 10, it is characterized in that: system is preferably,
When using real-time fluorescence reporting system, the concentration that fluorescent dye SYBR Green I is added is 1/50000；When using than
When colour analysis reporter, the concentration that pH indicator dimethyl diaminophenazine chloride is added is 100 μm of mol/L；Finally 25 μ L are complemented to ddH2O.
13. the detection method of the animal derived materials according to claim 9 or 10 based on LAMP technology, it is characterized in that:
Reaction temperature is 55-65 DEG C, reaction time at most 40min.
14. any one of the specific LAMP primer of animal derived materials detection of any of claims 1 or 2 or claim 3-6
Any one of described basic detection kit or claim 9-10 based on LAMP technology detection animal derived materials right is wanted
Seek the purposes of the detection method of the animal derived materials based on LAMP technology.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910613727.XA CN110257530A (en) | 2019-07-09 | 2019-07-09 | Animal derived materials rapid detection method based on LAMP technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910613727.XA CN110257530A (en) | 2019-07-09 | 2019-07-09 | Animal derived materials rapid detection method based on LAMP technology |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110257530A true CN110257530A (en) | 2019-09-20 |
Family
ID=67925127
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910613727.XA Pending CN110257530A (en) | 2019-07-09 | 2019-07-09 | Animal derived materials rapid detection method based on LAMP technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110257530A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110904242A (en) * | 2019-11-18 | 2020-03-24 | 牡丹江友搏药业有限责任公司 | Primer composition and application thereof in identification of whitmania pigra |
-
2019
- 2019-07-09 CN CN201910613727.XA patent/CN110257530A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110904242A (en) * | 2019-11-18 | 2020-03-24 | 牡丹江友搏药业有限责任公司 | Primer composition and application thereof in identification of whitmania pigra |
| CN110904242B (en) * | 2019-11-18 | 2023-05-02 | 牡丹江友搏药业有限责任公司 | Primer composition and application thereof in identification of Hirudinaria manillensis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Jaroenram et al. | Xylenol orange-based loop-mediated DNA isothermal amplification for sensitive naked-eye detection of Escherichia coli | |
| CN108060257A (en) | It is a kind of that strong male rotten mould Primer composition and its detection method are detected based on loop-mediated isothermal amplification technique | |
| CN111926116A (en) | Primer and probe for rapidly and quantitatively detecting duck adenovirus type 4, detection method and application thereof | |
| CN102010913B (en) | Real-time fluorescence polymerase chain reaction (PCR) detection kit for screening listeria monocytogenes and detection method thereof | |
| CN109504804A (en) | A kind of RPA method, its primer special and probe and purposes detecting 3 type adenovirus hominis | |
| Li et al. | Multiplex PCR coupled with direct amplicon sequencing for simultaneous detection of numerous waterborne pathogens | |
| Deb et al. | LAMP assay for rapid diagnosis of cow DNA in goat milk and meat samples | |
| CN117070673B (en) | LAMP detection primer group for pangolin alpha coronavirus and application thereof | |
| CN110257530A (en) | Animal derived materials rapid detection method based on LAMP technology | |
| CN109777861A (en) | The loop-mediated isothermal amplification method of mispairing tolerance and application | |
| CN109504800A (en) | A kind of RPA method for detecting universal adenovirus hominis, its primer special and probe and purposes | |
| CN106520914A (en) | Primers and probe, kit and method used for precise and quantitative detection of ovine-derived materials | |
| CN104404132B (en) | A kind of SS2-LAMP detection kit of streptococcus suis 2-type and application | |
| CN110564822B (en) | LAMP technology-based transgenic corn Bt 176-related gene detection method and kit | |
| CN109852706B (en) | Kit for rapidly identifying duck-origin components in food and application thereof | |
| CN109504744B (en) | Multiplex loop-mediated isothermal nucleic acid amplification detection method and kit based on high-resolution fusion | |
| CN105274224A (en) | Method, kit and composition for quantitative detection of pork content in beef | |
| CN105506142A (en) | Primers and reagent kit for rapidly detecting specific vibrio parahemolyticus virulence plasmid pVA1 on site | |
| CN109825609A (en) | The kit of bovine material and its application in a kind of Rapid identification food | |
| LU500199B1 (en) | LAMP-based nanomaterial and its application in visualization detection method for antibiotic resistant staphylococcus aureus in foods | |
| CN108396067A (en) | A kind of the LAMP primer group and detection method of duck derived component | |
| CN105695580A (en) | LAMP-LFD (loop-mediated isothermal amplification-lateral flow dipstick) detection method for Ulva compressa | |
| CN110195113B (en) | Kit for rapidly identifying sheep-derived ingredients in food and application thereof | |
| CN109825607B (en) | Kit for rapidly identifying donkey-derived components in food and application thereof | |
| CN109852708B (en) | Kit for rapidly identifying goose-derived components in food and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190920 |
|
| WD01 | Invention patent application deemed withdrawn after publication |