CN109504744B - Multiplex loop-mediated isothermal nucleic acid amplification detection method and kit based on high-resolution fusion - Google Patents
Multiplex loop-mediated isothermal nucleic acid amplification detection method and kit based on high-resolution fusion Download PDFInfo
- Publication number
- CN109504744B CN109504744B CN201910033420.2A CN201910033420A CN109504744B CN 109504744 B CN109504744 B CN 109504744B CN 201910033420 A CN201910033420 A CN 201910033420A CN 109504744 B CN109504744 B CN 109504744B
- Authority
- CN
- China
- Prior art keywords
- amplification
- reaction
- lamp
- resolution melting
- melting curve
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a high-resolution fusion-based multiple loop-mediated isothermal nucleic acid amplification detection method and a kit. And (3) adopting a standard LAMP primer and a DNA fluorescent binding dye, directly melting after amplification, and carrying out normalization or principal component analysis on an acquired melting curve to realize simultaneous detection of multiple LAMP target sources. Compared with the traditional melting curve analysis, the method adopts the whole melting curve information rather than the Tm value to carry out identification detection; the design difficulty of multiple LAMP analysis primers is obviously reduced, so that a plurality of LAMP amplification products with tiny Tm difference can be simultaneously detected, and multicolor fluorescence labeling or multiple single amplification reactions carried out in parallel in space separation is avoided; the quantity of target DNA which can be simultaneously detected at one time is obviously increased, the identification capability is not influenced by the initial concentration of the template, the sensitivity can reach 10 copies, excellent detection performance is shown in a complex sample, and the method has stronger practical application value.
Description
Technical Field
The invention relates to a method for simultaneously detecting a plurality of DNA fragments by combining high-resolution melting curve analysis (HRM), multivariate statistics and loop-mediated isothermal amplification (LAMP) technologies, in particular to a method for distinguishing and identifying a plurality of amplicons in multiplex LAMP by using a high-resolution melting curve.
Background
Loop-mediated isothermal nucleic acid amplification (LAMP) is the most widely used and studied isothermal amplification technique due to its high sensitivity and specificity, as well as high amplification speed and resistance to various inhibitors present in the actual sample. However, since the LAMP amplification product does not have a fragment of a known specific size unlike the product of Polymerase Chain Reaction (PCR), and the gel electrophoresis thereof is a stepped structure, multiplex detection cannot be performed by observing the size and number of bands of the amplification product by conventional gel electrophoresis.
The multiple isothermal amplification and detection of nucleic acids can save cost and time in various fields including clinical examination, food safety and environmental analysis, and has very important significance. To achieve multiplex detection by LAMP technology, one has previously implemented multiple single reaction assays in spatial parallel, e.g., DNA binding dyes, nephelometry, and pyrophosphate ion indicators. However, these sequence-independent detection approaches may produce false positive results and require the splitting of the sample into several singleplex reactions. In contrast, multiplex LAMP can be realized in the true sense that multiple targets can be detected simultaneously in a single system. In order to distinguish different amplicons at once, there is a literature report that detection of multiple targets can be achieved by using a processing step of adding restriction digestion after LAMP amplification, and then performing gel electrophoresis or pyrosequencing (Iseki, H., et al. Journal of Microbiological Methods,2007.71.281.Liang, C., et al. Analytical Chemistry, 2012.84.3758), but there is a risk of aerosol contamination generation and the operation is complicated, time-consuming and laborious because of the need for tube opening. Multicolor fluorescence detection enables sequence-specific detection of multiple targets in closed tubes, but the DNA strand displacement detection used tends to inhibit LAMP reactions, and multicolor fluorescence labeling and multichannel optics result in higher detection costs.
The melting curve analysis provides a method for realizing multiple LAMP detection, and the method has the advantages of simple and convenient operation, rapid detection, no pollution in sealing and low cost. Since the melting temperature (i.e., melting temperature, tm) of DNA is mainly dependent on the length and GC content of different amplicon sequences, melting curve analysis of multiplex LAMP amplification allows simultaneous detection of multiple DNA sequences within one tube. However, traditional multiple melting curve analysis requires that amplicons in the system have a difference in melting temperature of 3-5 ℃ (Jiang Kan, et al, modern food technology, 2016.32.246; jiang Kan, et al, food and machinery, 2015.31.87.), and therefore, multiple LAMP primer design is required to ensure its specificity, avoid interaction between primers, and produce amplicons with sufficient Tm difference. However, the complexity of primer design and subsequent optimization steps limit the wide application of this type of multiplex LAMP detection.
Disclosure of Invention
The invention aims to provide a multiplex loop-mediated isothermal nucleic acid amplification detection method and a kit based on high-resolution melting.
In order to achieve the purpose, the invention adopts the following technical scheme:
a multiplex loop-mediated isothermal nucleic acid amplification detection method based on high-resolution melting comprises the following steps:
1) Target sequence singleplex LAMP amplification
Selecting target sequences according to different target genes to be detected in each target detection sample, designing corresponding primers (standard LAMP specific primers) aiming at the target sequences, extracting DNA in the target detection sample, and taking the DNA as a template; carrying out single LAMP amplification reaction on the template and the corresponding primers, and determining a reaction system of the LAMP amplification reaction according to a reaction result (mainly determining the effectiveness of the primers aiming at the target sequence);
2) Multiple LAMP reaction condition optimization
Combining the target detection sample related to the step 1) in pairs, then simultaneously carrying out LAMP amplification reaction on the two corresponding templates after combination, obtaining a high-resolution melting curve after amplification reaction, and then optimizing the reaction conditions of the amplification reaction according to the difference degree of melting peaks corresponding to the two amplification products; combining the optimization results of the reaction conditions corresponding to different target detection sample combinations (taking intersection) to obtain the reaction conditions of the multiple LAMP amplification reaction;
3) Multiplex amplification assay
After the step 2), extracting DNA in a sample to be detected, performing multiple LAMP amplification reaction by using the DNA as a template, obtaining a high-resolution melting curve after the amplification reaction, then normalizing the high-resolution melting curve or performing principal component analysis on the high-resolution melting curve, then comparing the high-resolution melting curve with a standard high-resolution melting curve model (curve set) which is constructed by the same normalization or principal component analysis, and identifying a single target sequence or a plurality of target sequences contained in the sample to be detected according to the comparison result, thereby identifying the type of a target detection object contained in the sample.
Preferably, the DNA is extracted by a kit method.
Preferably, the optimization of the reaction conditions is mainly directed to the reaction temperature (amplification temperature required for real-time fluorescent amplification by LAMP).
Preferably, in the step 2), the optimizing the reaction conditions of the amplification reaction specifically includes the following steps: determining the difference of melting temperatures of amplification products obtained by simultaneously amplifying the two templates, if the difference of the melting temperatures is greater than 3 ℃, selecting the reaction temperature at which the areas of corresponding melting peaks of the amplification products of the two templates are equal to each other as the optimized reaction temperature, and if the difference of the melting temperatures is less than or equal to 3 ℃, selecting the reaction temperature at which the normalized high-resolution melting curves of the amplification products of the two templates are located between the normalized high-resolution melting curves of the amplification products of the corresponding single template as the optimized reaction temperature.
Preferably, the method for constructing the standard high-resolution melting curve model specifically comprises the following steps: after the step 2), performing multiple LAMP amplification reactions on templates corresponding to any one or any number of combinations in the target detection sample related to the step 1) by using primers aiming at all target sequences respectively, then obtaining a high-resolution melting curve, and performing feature extraction on the corresponding high-resolution melting curve contour by adopting normalization or principal component analysis respectively.
Preferably, the target sequence is selected from one or more of the fem gene of Staphylococcus aureus (Staphylococcus aureus), virR gene of Listeria monocytogenes (Listeria monocytogenes), invA gene of salmonella.
Preferably, in the step 3), the multiple LAMP amplification reaction is selected from more than three LAMP amplification reactions.
A multiple loop-mediated isothermal nucleic acid amplification detection kit based on high resolution melting comprises reagents for constructing a reaction system of LAMP amplification reaction and a standard high resolution melting curve model for comparing target sequence amplification products of multiple target genes, wherein the model is obtained by normalizing or analyzing main components of high resolution melting curves of amplification products of one or any number of combinations in different target sequences; the reagents include standard LAMP-specific primers for amplification of the corresponding target sequence and a single nucleic acid dye (e.g., evaGreen) for LAMP real-time fluorescent amplification.
Preferably, the reagent further comprises a Buffer (e.g., 10 × Isothermal Amplification Buffer), dntps, betaine, magnesium sulfate, bst DNA polymerase, and the like, separately packaged components, and ultrapure water.
Preferably, the amplification reaction system and reaction conditions of the kit are determined by referring to the above steps 1) and 2), the method of using the kit is referred to the above step 3), and the model construction is performed by referring to the method of constructing the standard high-resolution melting curve model.
The invention has the beneficial effects that:
the present invention combines multiplex LAMP and HRM techniques, extracts melting characteristics from the entire melting curve profile using high resolution melting, rather than relying solely on Tm values, so that minor Tm differences can be clearly distinguished between two LAMP amplicons. And multiple target sources in the LAMP reaction can be intuitively identified by comparing the sample melting characteristics with the established standard HRM model. The invention has the advantages of sequence specificity, closed tube, lower cost and easy operation of the detection method, and can simply and conveniently realize the multiple LAMP detection.
Drawings
FIG. 1 is a diagram of a single LAMP amplification curve (A), an original high-resolution melting curve (B), a melting peak (C) and an amplification product gel electrophoresis (D); m in fig. 1D denotes Marker.
FIG. 2 is a graph of a dual LAMP amplification melting peak (A) and a normalized high resolution melting curve (B).
FIG. 3 is a graph of normalized high resolution melting curves (A) and (D), original high resolution melting curve cluster analysis (B) and melting peak (C) for triple LAMP amplification; FIG. 3A with seven independent normalized HRM melting curves for different target sequences or combinations of target sequences allows for the discrimination of all target sequences or combinations of target sequences; in FIG. 3B: factor1 and Factor2 respectively represent a first principal component and a second principal component, seven clustering circles obtained by analyzing the HRM curve profile by using Principal Component Analysis (PCA) correspond to each specific sample, no overlapping is observed among each sample, and a clearer visualization difference is shown compared with that of FIG. 3A; in fig. 3D: the staphylococcus aureus and listeria monocytogenes mixed samples with different proportions have respective independent normalized HRM melting curves.
Detailed Description
The present invention will be described in further detail with reference to the accompanying drawings and examples. The examples are given solely for the purpose of illustration and are not intended to limit the scope of the invention.
The invention establishes a multiplex LAMP detection technology based on high-resolution melting curve analysis (HRM) identification based on the difference of Tm values of three amplified target segments (namely target sequences).
Feasibility of high-resolution melting detection of multiple loop-mediated isothermal nucleic acid amplification
1. Design of LAMP primers
1.1 adopting a fem gene conserved sequence of Staphylococcus aureus (Staphylococcus aureus) as a target sequence S1, and amplifying specific primers of the S1 as follows:
S.aur-F 3 (5’-3’)：TTTAACAGCTAAAGAGTTTGGT
S.aur-B 3 (5’-3’)：TTTCATAATCGATCACTGGAC
S.aur-FIP(5’-3’)：CCTTCAGCAAAGCTTTAACTCATAGTTTTTCAGATAGCATGC CATACAGTC
S.aur-BIP(5’-3’)：ACAATAATAACGAGGTCATTGCAGCTTTTCTTGAACACTTTC ATAACAGGTAC
1.2, a partial fragment of a virR gene special for Listeria monocytogenes (Listeria monocytogenes) is adopted as a target sequence S2, and specific primers for amplifying S2 are as follows:
L.mon-F 3 (5’-3’)：GTCTTTTAAGTGGAGTAAACCTT
L.mon-B 3 (5’-3’)：ACAAGACTTCACCAATCCA
L.mon-FIP(5’-3’)：CCTGTGCCAAAGCATTTTTACATTTTTTAGGCAAGTCATCT TGTTCG
L.mon-BIP(5’-3’)：TAAGTCTCTTTGCAATTGACCGACTTTTACGTGTACACAGA AAAGCG
1.3 Salmonella typhi (Salmonella spp), a partial segment of the invA gene specific to Salmonella is adopted as a target sequence S3, and specific primers for amplifying S3 are as follows:
S.spp-F 3 (5’-3’)：CGGCCCGATTTTCTCTGG
S.spp-B 3 (5’-3’)：CGGCAATAGCGTCACCTT
S.spp-FIP(5’-3’)：GCGCGGCATCCGCATCAATATGCCCGGTAAACAGATGAGT
S.spp-BIP(5’-3’)：GCGAACGGCGAAGCGTACTGTCGCACCGTCAAAGGAAC
the primers are designed in 2018 in 5 months, and are synthesized and purified by Shanghai Biotechnology engineering Co., ltd.
Strains of the above-mentioned bacteria (Staphylococcus aureus ATCC6538, listeria monocytogenes ATCC19115, salmonella spp CMCC50071, abbreviated to Staphylococcus aureus, listeria monocytogenes and Salmonella, respectively) were purchased in 5 months in 2017.
2. Extraction template and target sequence singleplex LAMP amplification
(1) Extraction of bacterial DNA
Bacteria of the above different species were subjected to enrichment treatment with LB medium under aseptic conditions, and the cells obtained by enrichment treatment were subjected to genomic DNA extraction and purification, respectively, with reference to the TGuide bacterial genomic DNA extraction kit (OSR-M502).
(2) Preparation of reaction system for performing single LAMP amplification under aseptic operation
Amplification was carried out using 10. Mu.L of a reaction system comprising 10. Mu.L of 10 × Isothermal Amplification Buffer, 1.6. Mu.M each of FIP and BIP as inner primers for amplifying a target sequence of any one of the above bacteria, 0.2. Mu. M, dNTP 1.4.4 mM each of F3 and B3, 0.8M of betaine, 5mM of magnesium sulfate, and 2.0 Bst
DNA polymerase 3.2U, DNA extracted in step (1) (template, 10) 6 copies/. Mu.L) 1. Mu.L and 0.25. Mu.L of EvaGreen (20X) fluorescent dye, the remainder being made up with ultra pure water. Four sample groups of staphylococcus aureus, salmonella typhi, listeria monocytogenes and no template control are arranged, the no template control is NTC, and each sample group is repeated for 6 times.
(3) The reaction is carried out on a high-resolution real-time fluorescent PCR instrument: amplifying at 67 ℃, collecting signals every 1min, collecting signals by using an SBGR Green I channel, reacting for 50 min, and performing high-resolution melting curve analysis in a temperature range from 75 ℃ to 95 ℃, wherein the melting rate is 0.05 ℃/s.
(4) Results of the experiment
And (4) according to the step (3), adding the specific inner primers and the specific outer primers respectively by using the extracted DNA as a template, and carrying out LAMP real-time fluorescence amplification experiments. An amplification curve can be obtained through an experiment (fig. 1A), a melting curve of an amplification product is obtained after HRM analysis is performed on the amplification product (fig. 1B), a characteristic melting peak is further obtained according to the melting curve (fig. 1C), agarose gel electrophoresis is used for verifying the amplification product, and positive samples (marked as "+" in fig. 1D, namely corresponding to amplification of a bacterial DNA template) are generated with LAMP amplification product trapezoidal bands (marked as "marked lane" in fig. 1D is NTC). The results prove that the selected three target sequences can be subjected to effective LAMP amplification, and a characteristic melting curve (comprising a melting curve peak and a normalized melting curve which can be obtained by analyzing the original data of the melting curve) is generated by HRM analysis; meanwhile, melting peaks corresponding to target sequences of staphylococcus aureus and listeria monocytogenes with similar GC proportions are partially overlapped, the difference of melting temperatures is small (1.3 ℃), but the melting temperatures required by traditional melting curve analysis are 3-5 ℃, and the melting temperatures cannot be qualitatively identified generally, so that the three target sequences cannot be detected simultaneously by one-time multiple LAMP amplification.
(II) high resolution melting curve analysis of double loop-mediated isothermal nucleic acid amplification
(1) And (3) performing enrichment culture and DNA extraction and performing same single LAMP amplification.
(2) Primer design and synthesis are carried out by same single LAMP amplification.
(3) Preparing a reaction system for double LAMP amplification under aseptic operation: amplification was carried out using 10. Mu.L of a reaction system comprising 10. Mu.L of 10 × Isothermal Amplification Buffer, 0.8. Mu.M each of FIP and BIP as inner primers for simultaneously amplifying target sequences of any two of the above, 0.1. Mu. M, dNTP 1.4.4 mM each of F3 and B3, 0.8M of betaine, 5mM of magnesium sulfate, and 2.0 Bst as Bst
DNA polymerase 3.2U, DNA template 1. Mu.L (10) 6 copies/. Mu.L) and 0.25. Mu.L of EvaGreen (20X) fluorescent dye, the remainder being made up with ultra pure water. Setting staphylococcus aureus + listeria monocytogenes (template equal ratio mixing), listeria monocytogenes + salmonella (template equal ratio mixing), staphylococcus aureus+ salmonella (equal ratio mixing of templates) and four sample groups without template control, wherein the no template control is NTC, each sample group is repeated for 6 times, and an amplification control which is the same as the amplification primer but only comprises a corresponding single template (staphylococcus aureus template, salmonella template and listeria monocytogenes template) is arranged corresponding to each mixed template group.
(4) In the setting of the amplification detection program (real-time fluorescence amplification reaction, high-resolution melting curve analysis) of each sample group, the amplification reaction temperature is the result optimized according to the following principle:
amplifying two different DNA targets simultaneously, and when the melting peaks of two amplicons (namely amplification products) are observed to have larger Tm difference (> 3 ℃), selecting the reaction temperature at which the two melting peak areas are equal as the optimal amplification temperature, wherein the contents of the two amplicons are close and the amplification efficiency is close; when the Tm value difference is small (less than or equal to 3 ℃), only a single melting peak is generated, the difference can be observed from the profile of the normalized HRM curve, when the normalized high-resolution melting curve of the mixed template sample is positioned in the middle of the control of the two single template samples, the amplification of the two targets is realized, and the amplification efficiency is approximate;
(5) Results of the experiment
As shown in FIG. 2A, when the difference between the melting temperatures of the two LAMP amplification products is large, a characteristic peak is generated at the corresponding temperature in the melting peak diagram, so that the characteristic peak can be used as the identification and detection basis of the amplicon in the dual LAMP amplification. However, when the difference of melting temperatures is small, such as the sample group of staphylococcus aureus and listeria monocytogenes (1.3 ℃), the double amplicon only generates one melting peak, and cannot be identified by a method for observing characteristic peaks. In the normalized high resolution graph (fig. 2B), staphylococcus aureus and listeria monocytogenes with smaller melting temperature differences can be clearly identified easily (the overall positions of the normalization curves are distinguished from each other). The results show that the high-resolution melting analysis can be applied to accurately distinguish LAMP amplification products which cannot be distinguished by adopting the traditional melting curve analysis; and for the identification of LAMP amplification products with similar melting temperatures, the information contained in the whole high-resolution melting curve is obviously better than that only based on the Tm value. The optimized reaction temperature (66.5-67.5 ℃ in this example) for the triple loop-mediated isothermal nucleic acid amplification experiment can be determined according to the optimized amplification reaction temperature under different conditions (sample groups).
(III) high resolution melting detection of triple loop-mediated isothermal nucleic acid amplification
(1) And (3) performing enrichment culture and DNA extraction and performing same-singleplex LAMP amplification.
(2) Primer design and synthesis are carried out by same single LAMP amplification.
(3) Preparing a reaction system for triple LAMP amplification under aseptic operation: amplification was carried out using a 10. Mu.L reaction system, including 10 × Isothermal Amplification Buffer 1. Mu.L, 0.8. Mu.M each of FIP and BIP for amplifying target sequences of Listeria monocytogenes, staphylococcus aureus and Salmonella, 0.1. Mu. M, dNTP 1.4.4 mM each of outer primers F3 and B3, 0.8M of betaine, 5mM of magnesium sulfate, and 2.0 mM of Bst
DNA polymerase 3.2U, DNA template 1. Mu.L (10) 6 copies/. Mu.L) and 0.25. Mu.L of EvaGreen (20X) fluorescent dye, the remainder being made up with ultra pure water. The method comprises the steps of setting 8 sample groups including staphylococcus aureus, salmonella, listeria monocytogenes, staphylococcus aureus + listeria monocytogenes (template equal ratio mixing), staphylococcus aureus + salmonella (template equal ratio mixing), salmonella + listeria monocytogenes (template equal ratio mixing), staphylococcus aureus + salmonella + listeria monocytogenes (template equal ratio mixing) and no-template control, wherein the no-template control is NTC, and each sample group is repeated for 6 times.
(4) In the amplification detection program (real-time fluorescence amplification reaction and high-resolution melting curve analysis) setting of each sample group, the reaction temperature refers to the optimized result of the double loop-mediated isothermal nucleic acid amplification experiment, and is specifically taken as 67 ℃.
(5) Results of the experiment
Seven samples from three different targets were analyzed for high resolution melting curves after LAMP amplification. As shown in fig. 3A, seven normalized high-resolution melting curves respectively correspond to seven different samples, so as to distinguish the different samples (which can be used as a standard HRM model); as shown in fig. 3B, further analysis of HRM raw curves for the samples using Principal Component Analysis (PCA) can obtain seven distinct clusters corresponding to the seven samples, with no overlap between each sample, and clear visual differences (which can be used as a standard HRM model) observed. The normalized high-resolution melting curve is proved to be capable of carrying out effective amplification detection on the DNA of the 3 bacteria and the mixed sample thereof.
Correspondingly, when the Tm value of the peak of the conventional melting curve is used to detect the DNA of the above 3 bacteria and the mixture thereof, the mixed sample containing the DNA of staphylococcus aureus and listeria monocytogenes with a small Tm value difference is difficult to identify accurately (fig. 3C), for example, only one melting peak appears in the sample of staphylococcus aureus + listeria monocytogenes, and only two melting peaks appear in the sample of staphylococcus aureus + listeria monocytogenes + salmonella; again, the superiority and necessity of using the entire melting curve information rather than just referencing the Tm values for identification is illustrated.
(IV) sensitivity and practical application of multiplex LAMP
The detection performance of this method (triplex) was evaluated by blind testing on simulated samples. Analysis shows that the recognition accuracy rate is 100%, which indicates that the multiplex LAMP has good reproducibility.
Performing multiple LAMP amplification on DNA templates with different concentrations. Because multiple LAMP can amplify target sequences with different initial concentrations independently and reach similar platform concentration at the LAMP amplification end point, the LAMP can effectively detect target sequences with 10 copies as low as possible and has higher sensitivity.
When serum (10%) or milk (10%) is added into the detection system (referring to the amplification system), clear cluster analysis can still be carried out (the normalization curve can also be used for identification), which shows the robust applicability in the actual sample detection.
The ratio of bacteria present in the actual sample is often different, and it is necessary to analyze bacteria in different ratios, and as shown in fig. 3D, when bacteria in different ratios are present, the normalized melting curve can be used to analyze samples of bacteria in different ratios.
(V) preparation of multiplex LAMP high-resolution melting curve detection kit
And packaging the 10 × Isothermal Amplification Buffer, dNTP, betaine, magnesium sulfate, bst DNA polymerase and saturated fluorescent dye EvaGreen together to obtain the high-resolution LAMP detection kit.
When the kit is used, multiple LAMP inner and outer primers and templates are added according to the detection purpose of a sample, after amplification (referring to the condition of obtaining a standard HRM model), detection is carried out on an HRM fluorometer, then comparison is carried out according to the standard HRM model attached to the kit, and qualitative identification is carried out on a specific target detection object (such as bacteria) contained in the sample.
In a word, the invention combines the advantages of loop-mediated isothermal amplification (LAMP) and high-resolution melting, and establishes a simple, rapid, closed-tube, high-throughput and low-cost monochromatic multiplex nucleic acid isothermal amplification detection technology. The advantages are that:
(1) Compared with the traditional melting curve analysis, the Tm difference is 3-5 ℃, the Tm difference which can be distinguished by HRM is reduced to 0.2 ℃, so that the design difficulty of multiple LAMP primers is obviously reduced, and a plurality of LAMP amplification products with tiny Tm difference can be simultaneously detected; and the quantity of target DNA which can be simultaneously detected in the same reaction tube is obviously increased, and the quantity of theoretically detected targets (different target sequences) reaches 100 within the melting range of 75-95 ℃.
(2) HRM signal collection only needs single-channel fluorescent DNA binding dye, multi-color fluorescent labeling or multiple single amplification reactions carried out in parallel in space separation are avoided, and standard LAMP primers (without additional modification) are used, so that the detection cost is reduced. By analyzing the melting temperatures of different LAMP amplification products, multiple LAMP detections are carried out, and the purposes of saving reagents, being rapid, simple and convenient and improving sample flux are achieved.
(3) The identification capability of the invention is not influenced by the initial concentration of the DNA template, and the sensitivity can reach 10 copies; the method has excellent detection performance in a complex sample matrix and has high practical application value.
(4) According to the invention, a dye is added before amplification, and an amplicon is melted in a closed tube state after amplification to generate a melting curve. The melting curve is specific for the unique GC content and sequence differences between each amplicon. The melting curve can be used as the unique fingerprint for identifying the specific target by analyzing through statistical means such as normalization or principal component analysis.
<110> university of Shanxi science and technology
<120> multiple loop-mediated isothermal nucleic acid amplification detection method and kit based on high resolution melting
<160> 12
<210> 1
<211> 22
<212> DNA
<213> Artificial Synthesis
<400> 1
tttaacagct aaagagtttg gt 22
<210> 2
<211> 21
<212> DNA
<213> Artificial Synthesis
<400> 2
tttcataatc gatcactgga c 21
<210> 3
<211> 51
<212> DNA
<213> Artificial Synthesis
<400> 3
ccttcagcaa agctttaact catagttttt cagatagcat gccatacagt c 51
<210> 4
<211> 53
<212> DNA
<213> Artificial Synthesis
<400> 4
acaataataa cgaggtcatt gcagcttttc ttgaacactt tcataacagg tac 53
<210> 5
<211> 23
<212> DNA
<213> Artificial Synthesis
<400> 5
gtcttttaag tggagtaaac ctt 23
<210> 6
<211> 19
<212> DNA
<213> Artificial Synthesis
<400> 6
acaagacttc accaatcca 19
<210> 7
<211> 47
<212> DNA
<213> Artificial Synthesis
<400> 7
cctgtgccaa agcattttta cattttttag gcaagtcatc ttgttcg 47
<210> 8
<211> 47
<212> DNA
<213> Artificial Synthesis
<400> 8
taagtctctt tgcaattgac cgacttttac gtgtacacag aaaagcg 47
<210> 9
<211> 18
<212> DNA
<213> Artificial Synthesis
<400> 9
cggcccgatt ttctctgg 18
<210>10
<211> 18
<212> DNA
<213> Artificial Synthesis
<400> 10
cggcaatagc gtcacctt 18
<210> 11
<211> 40
<212> DNA
<213> Artificial Synthesis
<400> 11
gcgcggcatc cgcatcaata tgcccggtaa acagatgagt 40
<210> 12
<211> 38
<212> DNA
<213> Artificial Synthesis
<400> 12
gcgaacggcg aagcgtactg tcgcaccgtc aaaggaac 38
Claims (8)
1. A non-disease diagnosis multiple loop-mediated isothermal nucleic acid amplification detection method based on high resolution fusion is characterized in that: the method comprises the following steps:
1) Target sequence singleplex LAMP amplification
Selecting target sequences according to different target genes to be detected in each target detection sample, designing corresponding specific primers aiming at the target sequences, extracting DNA in the target detection sample, and taking the DNA as a template; carrying out single LAMP amplification reaction on the template and the corresponding primers, and determining a reaction system of the LAMP amplification reaction according to a reaction result;
2) Multiple LAMP reaction condition optimization
Combining the target detection sample related to the step 1) in pairs, then simultaneously carrying out LAMP amplification reaction on the two corresponding templates after combination, obtaining a high-resolution melting curve after amplification reaction, and then optimizing the reaction conditions of the amplification reaction according to the difference degree of melting peaks corresponding to the two amplification products; combining the optimization results of the reaction conditions corresponding to different target detection sample combinations by taking intersection to obtain the reaction conditions of the multiple LAMP amplification reaction;
in the step 2), optimizing the reaction conditions of the amplification reaction specifically includes the following steps: determining the difference of melting temperatures of amplification products obtained by simultaneously amplifying two templates, if the difference of the melting temperatures is greater than 3 ℃, selecting the reaction temperature which enables the areas of corresponding melting peaks of the two templates to be equal to each other as the optimized reaction temperature, if the difference of the melting temperatures is less than or equal to 3 ℃, selecting the reaction temperature which enables the normalized high-resolution melting curves of the amplification products of the two templates to be located between the normalized high-resolution melting curves of the amplification products of the corresponding single template as the optimized reaction temperature, and when the normalized high-resolution melting curves of the mixed template samples are located in the middle of the comparison of the two single template samples, the amplification of the two targets is realized, and the amplification efficiency is close to each other;
3) Multiplex amplification assay
After the step 2), extracting DNA in a sample to be detected, performing multiple LAMP amplification reaction by taking the DNA as a template, obtaining a high-resolution melting curve after the amplification reaction, normalizing the high-resolution melting curve, comparing the high-resolution melting curve with a standard high-resolution melting curve model which is constructed by normalization and does not overlap among different target detection samples, and identifying a single target sequence or a plurality of target sequences contained in the sample to be detected according to a comparison result; the multiple LAMP amplification reactions are selected from more than three LAMP amplification reactions.
2. The multiplex loop-mediated isothermal nucleic acid amplification method according to claim 1, wherein: the extraction of the DNA adopts a kit method.
3. The multiplex loop-mediated isothermal nucleic acid amplification detection method according to claim 1, wherein: the construction method of the standard high-resolution melting curve model specifically comprises the following steps: performing multiple LAMP amplification reactions on each template corresponding to the target detection sample related to the step 1) by using primers aiming at all target sequences, then obtaining a high-resolution melting curve, and performing feature extraction on the corresponding high-resolution melting curve contour by adopting normalization respectively.
4. The multiplex loop-mediated isothermal nucleic acid amplification detection method according to claim 1, wherein: the target sequence is selected from one or more of fem gene of Staphylococcus aureus (Staphylococcus aureus), virR gene of Listeria monocytogenes (Listeria monocytogenes), and invA gene of salmonella.
5. The multiplex loop-mediated isothermal nucleic acid amplification detection method according to claim 1, wherein: the step 3 further comprises the following steps: and (4) carrying out principal component analysis on the high-resolution melting curve.
6. A multiple loop-mediated isothermal nucleic acid amplification detection kit based on high-resolution fusion is characterized in that: the kit comprises a reagent for constructing a reaction system of LAMP amplification reaction and a standard high-resolution melting curve model for comparing target sequence amplification products of multiple target genes, wherein the target sequence amplification products are not overlapped with each other, and the model is obtained by respectively normalizing the high-resolution melting curves of the multiple LAMP amplification reaction amplification products corresponding to the target sequence of each target gene; the reagent comprises LAMP specific primers for amplifying corresponding target sequences and a single nucleic acid dye for LAMP real-time fluorescence amplification;
the multiple LAMP amplification reactions are selected from more than three LAMP amplification reactions;
the determination of the reaction temperature of the amplification reaction specifically comprises the following steps:
combining two target detection samples respectively corresponding to different target genes, simultaneously carrying out LAMP amplification reaction on the two corresponding templates after combination, and obtaining a high-resolution melting curve after the amplification reaction;
determining the difference of melting temperatures of amplification products obtained by simultaneously amplifying two templates, if the difference of the melting temperatures is greater than 3 ℃, selecting the reaction temperature which enables the areas of corresponding melting peaks of the two templates to be equal to each other as the optimized reaction temperature, if the difference of the melting temperatures is less than or equal to 3 ℃, selecting the reaction temperature which enables the normalized high-resolution melting curves of the amplification products of the two templates to be located between the normalized high-resolution melting curves of the amplification products of the corresponding single template as the optimized reaction temperature, and when the normalized high-resolution melting curves of the mixed template samples are located in the middle of the comparison of the two single template samples, the amplification of the two targets is realized, and the amplification efficiency is close to each other;
and combining the optimized results of the reaction conditions corresponding to different target detection sample combinations by taking intersection.
7. The kit for detecting the multi-loop-mediated isothermal nucleic acid amplification based on the high resolution melting according to claim 6, wherein: the reagent also comprises buffer solution, dNTP, betaine, magnesium sulfate, bst DNA polymerase and ultrapure water.
8. A method of using the kit of claim 6 for non-disease diagnosis, comprising: the method comprises the following steps:
extracting DNA in a sample to be detected, performing multiple LAMP amplification reaction by taking the DNA as a template and combining LAMP specific primers, obtaining a high-resolution melting curve after the amplification reaction, normalizing the high-resolution melting curve, comparing the high-resolution melting curve with a standard high-resolution melting curve model, and identifying a single target sequence or a plurality of target sequences contained in the sample to be detected according to a comparison result.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910033420.2A CN109504744B (en) | 2019-01-14 | 2019-01-14 | Multiplex loop-mediated isothermal nucleic acid amplification detection method and kit based on high-resolution fusion |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910033420.2A CN109504744B (en) | 2019-01-14 | 2019-01-14 | Multiplex loop-mediated isothermal nucleic acid amplification detection method and kit based on high-resolution fusion |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109504744A CN109504744A (en) | 2019-03-22 |
| CN109504744B true CN109504744B (en) | 2022-11-29 |
Family
ID=65757841
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910033420.2A Active CN109504744B (en) | 2019-01-14 | 2019-01-14 | Multiplex loop-mediated isothermal nucleic acid amplification detection method and kit based on high-resolution fusion |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109504744B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111145835A (en) * | 2019-12-26 | 2020-05-12 | 苏州天隆生物科技有限公司 | Software analysis method for multiple melting curves |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103305623A (en) * | 2013-07-01 | 2013-09-18 | 浙江省质量检测科学研究院 | Multiple rapid detection method of two food-borne pathogenic bacteria and detection primer groups as well as kit |
| CN106244726A (en) * | 2016-08-19 | 2016-12-21 | 中检国研(北京)科技有限公司 | A kind of zika virus loop-mediated isothermal amplification detection kit and using method |
| CN108368557A (en) * | 2015-12-01 | 2018-08-03 | Sd生物传感器株式会社 | Including for the reporting dyes of nucleic acid isothermal amplification, quencher bi-functional oligonucleotide based on isothermal and utilize its nucleic acid amplification and assay method |
| CN108754032A (en) * | 2018-07-19 | 2018-11-06 | 上海速创诊断产品有限公司 | It is a kind of with the isothermal nucleic acid amplification system of high specific and its application |
| CN109097449A (en) * | 2018-08-20 | 2018-12-28 | 陕西科技大学 | A kind of real-time fluorescence LAMP detection method and kit based on ruthenium complex |
-
2019
- 2019-01-14 CN CN201910033420.2A patent/CN109504744B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103305623A (en) * | 2013-07-01 | 2013-09-18 | 浙江省质量检测科学研究院 | Multiple rapid detection method of two food-borne pathogenic bacteria and detection primer groups as well as kit |
| CN108368557A (en) * | 2015-12-01 | 2018-08-03 | Sd生物传感器株式会社 | Including for the reporting dyes of nucleic acid isothermal amplification, quencher bi-functional oligonucleotide based on isothermal and utilize its nucleic acid amplification and assay method |
| CN106244726A (en) * | 2016-08-19 | 2016-12-21 | 中检国研(北京)科技有限公司 | A kind of zika virus loop-mediated isothermal amplification detection kit and using method |
| CN108754032A (en) * | 2018-07-19 | 2018-11-06 | 上海速创诊断产品有限公司 | It is a kind of with the isothermal nucleic acid amplification system of high specific and its application |
| CN109097449A (en) * | 2018-08-20 | 2018-12-28 | 陕西科技大学 | A kind of real-time fluorescence LAMP detection method and kit based on ruthenium complex |
Non-Patent Citations (1)
| Title |
|---|
| 环介导恒温扩增法检测肉制品中致病微生物;陈洵等;《肉类研究》;20111231;第25卷(第11期);29-33 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109504744A (en) | 2019-03-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106399517B (en) | Nucleic acid detection technology combining multi-cross constant-temperature amplification with gold nano biosensing | |
| CN113186313A (en) | Salmonella detection primer group, method and kit based on RPA-LbCas12a-TTECDS system | |
| CN105256048B (en) | Multiple PCR detection primer group and probe group for oral pathogenic bacteria and application thereof | |
| CN110358815B (en) | Method for simultaneously detecting multiple target nucleic acids and kit thereof | |
| CN111910017A (en) | Multiplex-time PCR (polymerase chain reaction) kit for detecting respiratory pathogens, method and application | |
| CN111926114B (en) | Multiplex real-time PCR kit, method and application for detecting parainfluenza virus | |
| CN105219772A (en) | One group of nucleotide sequence and the application in salmonella and shigella detect | |
| CN105755134B (en) | Endonuclease-mediated real-time multiple cross-displacement nucleic acid amplification technology and application | |
| CN111041130B (en) | Compositions, kits and methods for detecting pathogens | |
| CN111893215A (en) | Multiplex-time PCR kit for detecting coronavirus, method and application | |
| CN109868321B (en) | Multiple fluorescence PCR method and kit for identifying animal-derived components | |
| CN109504744B (en) | Multiplex loop-mediated isothermal nucleic acid amplification detection method and kit based on high-resolution fusion | |
| CN110878370A (en) | CPA (cross-linked immunosorbent assay) detection primer, kit and method for pseudomonas aeruginosa | |
| CN109777861A (en) | The loop-mediated isothermal amplification method of mispairing tolerance and application | |
| CN109097449B (en) | Real-time fluorescence LAMP detection method and kit based on metal ruthenium complex | |
| CN116555449A (en) | Kit for simultaneously detecting multiple key drug resistance genes based on RPA-LFD and application thereof | |
| CN115029460A (en) | Instant visual detection method for haemophilus parasuis | |
| CN110564822B (en) | LAMP technology-based transgenic corn Bt 176-related gene detection method and kit | |
| CN113215325A (en) | Reaction system, method and kit for detecting multiple HPV subtypes through two-dimensional PCR single closed tube | |
| CN112899385A (en) | Primer group and probe for identifying Brucella S2 vaccine strain and wild strain and application of primer group and probe | |
| CN105506121A (en) | Nucleotide sequence used for vibrio parahaemolyticus and vibrio vulnificus detection | |
| CN111893197B (en) | Multiplex fluorescence PCR (polymerase chain reaction) kit and method for detecting common respiratory bacteria | |
| CN111321139A (en) | Composition for cat genotyping and application thereof | |
| CN111118118B (en) | Rate type ctDNA quantitative detection method | |
| CN111944923B (en) | Multiplex fluorescence PCR kit, method and application for detecting respiratory pathogens |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20221207 Address after: D209, Floor 2, Building 1, No. 12, Shangdi Xinxi Road, Haidian District, Beijing 100089 Patentee after: BEIJING FIRE GENE DX TECHNOLOGY CO.,LTD. Address before: 710026 B49 Xindi Zhongchuang Space, 26th Street, Floor 6, Block C, Huanan City, International Port District, Baqiao District, Xi'an, Shaanxi Patentee before: Xi'an Huaqi Zhongxin Technology Development Co.,Ltd. Effective date of registration: 20221207 Address after: 710026 B49 Xindi Zhongchuang Space, 26th Street, Floor 6, Block C, Huanan City, International Port District, Baqiao District, Xi'an, Shaanxi Patentee after: Xi'an Huaqi Zhongxin Technology Development Co.,Ltd. Address before: No. 1, Weiyang District university garden, Xi'an, Shaanxi Province, Shaanxi Patentee before: SHAANXI University OF SCIENCE & TECHNOLOGY |
|
| TR01 | Transfer of patent right |