CN109504744A - The multiple ring mediated isothermal nucleic acid amplification detection method and kit melted based on high-resolution - Google Patents
The multiple ring mediated isothermal nucleic acid amplification detection method and kit melted based on high-resolution Download PDFInfo
- Publication number
- CN109504744A CN109504744A CN201910033420.2A CN201910033420A CN109504744A CN 109504744 A CN109504744 A CN 109504744A CN 201910033420 A CN201910033420 A CN 201910033420A CN 109504744 A CN109504744 A CN 109504744A
- Authority
- CN
- China
- Prior art keywords
- resolution
- reaction
- lamp
- melting curve
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of multiple ring mediated isothermal nucleic acid amplification detection methods and kit melted based on high-resolution.It using standard LAMP primer and DNA fluorescence combination dye, is directly melted, the melting curve of acquisition is normalized or principal component analysis after the completion of amplification, detection while multiple LAMP target source can be realized.Compared to traditional melting curve analysis, this method is using entire melting curve information rather than Tm value carries out identification detection；The design difficulty of multiple LAMP analysis primer is significantly reduced, so that multiple LAMP amplified productions with small Tm difference can also be detected simultaneously, multicolor fluorescence label is avoided or separation carries out multiple single amplification reactions in parallel in space；The target dna quantity that can once detect simultaneously dramatically increases, and distinguishing ability is not influenced by template initial concentration, and sensitivity shows excellent detection performance up to 10 copies in complex samples, has stronger practical application value.
Description
Technical field
The present invention relates to combine high-resolution melting curve analysis (HRM), multivariate statistics and ring mediated isothermal nucleic acid amplification
(LAMP) method that technology detects multiple DNA fragmentations simultaneously, and in particular to using high-resolution fusion curve in multiple LAMP
The method that multiple amplicons distinguish identification.
Background technique
Ring mediated isothermal nucleic acid amplification (LAMP) is due to its high sensitivity and specificity and High-Speed Amplification and to actual sample
Present in various inhibitor tolerance, be it is most widely used and research isothermal amplification technique.However, since LAMP is expanded
Product has the segment of known particular size unlike the product of polymerase chain reaction (PCR), and gel electrophoresis is ladder
Shape structure cannot observe amplified product band size and number by conventional gel electrophoresis to carry out multiple detection.
Multiple fields of the multiple isothermal duplication and detection of nucleic acid including clinical examination, food safety and environmental analysis can
To save cost and time, have a very important significance.In order to realize the Multiple detection of LAMP technology, forefathers pass through space simultaneously
Capable multiple single reactions detection is achieved, for example, DNA binding dye, nephelometry and pyrophosphate ions indicator.But
There may be false positive results for these detection means unrelated with sequence, and need for sample to be divided into several substance reactions.Phase
Than under, it can detect multiple targets simultaneously in unitary system and just truly realize multiple LAMP.For an area
Divide different amplicons, there is reported in literature to utilize and increase restrictive digestion after LAMP amplification, then carry out gel electrophoresis or coke
Phosphoric acid sequencing (Iseki, H., et al.Journal of Microbiological Methods, 2007.71.281.Liang,
C., et al.Analytical Chemistry, 2012.84.3758.) processing step, the inspection of multiple targets may be implemented
It surveys, but due to needing open pipe, there is the risk for generating Aerosol Pollution and complicated for operation, time-consuming and laborious.Multicolor fluorescence detection
The sequence-specific detection of multiple targets can be realized in stopped pipe, but the detection of used DNA chain displacement is easy to inhibit
LAMP reaction, and multicolor fluorescence label and Multi-channel optical element cause testing cost higher.
Melting curve analysis provides a kind of method for realizing multiple LAMP detection, it has, and easy to operate, detection is rapid,
Seal advantage pollution-free, at low cost.Since DNA melting temperature (that is, melting temperature, Tm) depends primarily on different amplicons
Sequence length and G/C content allow the melting curve analysis of multiple LAMP amplification in a pipe while detecting multiple DNA sequences
Column.However, the multiple melting curve analysis of tradition needs the amplicon in system in melting temperature with 3~5 DEG C of difference (ginger
It chats about, et al. modern food science and technology, 2016.32.246；Jiang Kan, et al. food and mechanical, 2015.31.87.), therefore,
It asks multiple LAMP primer design to be necessary to ensure that its specificity, avoids the interaction between primer, and generating has enough Tm poor
Different amplicon.But the complexity of design of primers and subsequent Optimization Steps limit the extensive of this kind of multiple LAMP detections
Using.
Summary of the invention
The purpose of the present invention is to provide a kind of multiple ring mediated isothermal nucleic acid amplification detections melted based on high-resolution
Method and kit.
In order to achieve the above objectives, the invention adopts the following technical scheme:
A kind of multiple ring mediated isothermal nucleic acid amplification detection method melted based on high-resolution, comprising the following steps:
1) target sequence substance LAMP is expanded
Different according to target gene to be detected in each target detection thing sample choose target sequence and for each target sequence
Corresponding primer (standard LAMP specific primer) is designed, the DNA in target detection thing sample is extracted, using the DNA as template；
Template and corresponding primer are subjected to substance LAMP amplified reaction, the reaction system of LAMP amplified reaction is determined according to reaction result
(mainly determining the validity of the primer for target sequence)；
2) multiple LAMP reaction condition optimization
The target detection thing sample that step 1) is related to is combined two-by-two, then for corresponding two templates after combination
LAMP amplified reaction is carried out simultaneously, obtains high-resolution melting curve after amplified reaction, then according to corresponding two amplified productions
The difference degree at unwinding peak optimize the reaction condition of the amplified reaction；Different target detectable substance sample combination is corresponding anti-
It answers the optimum results of condition to merge and (take intersection), obtains the reaction condition of multiple LAMP amplified reaction；
3) multiplex amplification detects
After step 2), the DNA in sample to be tested is extracted, and carry out multiple LAMP amplified reaction by template of the DNA,
High-resolution melting curve is obtained after amplified reaction, then high-resolution melting curve is normalized or molten to high-resolution
Solution curve carries out principal component analysis, then molten with the same standard high resolution constructed using normalization or principal component analysis
Solution curve model (curve set) is compared, and according to comparison result, identifies single target sequence or multiple target sequences contained by sample to be tested
Column, so as to identify target detection species contained in sample.
Preferably, the extraction of the DNA uses RNA isolation kit.
Preferably, the optimization of the reaction condition is mainly for reaction temperature (amplification needed for the amplification of LAMP real-time fluorescence
Temperature).
Preferably, in the step 2), optimize the reaction condition of the amplified reaction specifically includes the following steps: determining two
A template expands the melting temperature difference of gained amplified production simultaneously, if melting temperature difference > 3 DEG C, selection makes this two
The amplified production of template correspond to unwinding peak area it is equal when reaction temperature be optimization reaction temperature, if the melting temperature is poor
Different≤3 DEG C, choosing, which makes the normalization high-resolution melting curve of the amplified production of two templates be located at corresponding single template, expands
Reaction temperature when increasing production between the normalization high-resolution melting curve of object is the reaction temperature of optimization.
Preferably, the construction method of the standard high resolution melting curve model is specifically includes the following steps: by step
It is rapid 2) after, template corresponding to any one or any number of combination in the target detection thing sample that is related to step 1),
Multiple LAMP amplified reaction is carried out using the primer for whole target sequences respectively, then obtains high-resolution melting curve, and
Normalization or principal component analysis is respectively adopted, feature extraction is carried out to corresponding high-resolution melting curve profile.
Preferably, the target sequence be selected from staphylococcus aureus (Staphylococcus aureus) fem gene,
The invA gene of the virR genes of Listeria Monocytogenes (Listeria monocytogenes), Salmonella
One of or it is a variety of.
Preferably, in the step 3), multiple LAMP amplified reaction is selected from triple above LAMP amplified reactions.
A kind of multiple ring mediated isothermal nucleic acid amplification detection kit melted based on high-resolution, the kit include using
In the reagent of the reaction system of building LAMP amplified reaction and for the target sequence amplification for a variety of target gene of comparison
The standard high resolution melting curve model of product, the model are by one of different target sequences or any number of
The high-resolution melting curve of combined amplified production be normalized or principal component analysis obtained from；The reagent includes using
In the standard LAMP specific primer for expanding corresponding target sequence and for the single nucleic acid dyestuff (example of LAMP real-time fluorescence amplification
Such as, EvaGreen).
Preferably, the reagent further includes buffer (for example, 10 × Isothermal Amplification
Buffer), the component and ultrapure water that dNTP, glycine betaine, magnesium sulfate, Bst archaeal dna polymerase etc. are separately packed.
Preferably, the determining reference above-mentioned steps 1 of the amplification reaction system of mentioned reagent box and reaction condition) and step
2), the application method of kit refers to above-mentioned steps 3), model construction is referring to above-mentioned standard high-resolution melting curve model
Construction method.
The beneficial effects of the present invention are embodied in:
The present invention by multiple LAMP in conjunction with HRM technology, using high-resolution melting and from entire melting curve profile
It extracts and melts characteristic rather than only rely on Tm numerical value, carry out small Tm difference can also between two LAMP amplicons bright
True differentiation.And it can intuitively be identified by the way that sample melting feature to be compared with the standard HRM model established
Multiple target sources in LAMP reaction.The present invention has detection method sequence-specific, stopped pipe and cost is relatively low, easy-operating
Advantage, the multiple LAMP detection of easy realization.
Detailed description of the invention
Fig. 1 is substance LAMP amplification curve (A), original high resolution melting curve (B), unwinding peak (C) and amplified production
Gel electrophoresis (D) figure；M indicates Marker in Fig. 1 D.
Fig. 2 is that dual LAMP expands unwinding peak (A) and normalization high-resolution melting curve (B) figure.
Fig. 3 is that the normalization high-resolution melting curve (A) of triple LAMP amplification and (D), original high resolution melt song
Line clustering (B) and unwinding peak (C) figure；Fig. 3 A has seven independent normalizings for the combination of different target sequences or target sequence
Change HRM melting curve, it can be achieved that the differentiation combined to all target sequences or target sequence；In Fig. 3 B: Factor1, Factor2 difference
It indicates first principal component and Second principal component, carries out seven of analysis acquisition to HRM curved profile using principal component analysis (PCA)
Cluster circle corresponds to each specific sample, would not observe that overlapping in each sample room, shows compared with Fig. 3 A clearer
Visualize difference；In Fig. 3 D: different proportion staphylococcus aureus has with Listeria Monocytogenes mixing sample
Normalization HRM melting curve independent.
Specific embodiment
The present invention is described in further details with reference to the accompanying drawings and examples.The embodiment is only used for explaining this hair
It is bright, rather than limiting the scope of the invention.
The Tm value difference that target fragments (i.e. target sequence) is expanded the present invention is based on three kinds is different, establishes and is melted based on high-resolution
The multiple LAMP detection technique of tracing analysis (HRM) identification.
(1) multiple ring mediated isothermal nucleic acid amplification high-resolution melts the feasibility of detection
1, LAMP primer is designed
1.1 use the fem gene conserved sequence of staphylococcus aureus (Staphylococcus aureus) for target sequence
S1 expands the specific primer of S1 are as follows:
S.aur-F3(5 ' -3 '): TTTAACAGCTAAAGAGTTTGGT
S.aur-B3(5 ' -3 '): TTTCATAATCGATCACTGGAC
S.aur-FIP (5 ' -3 '): CCTTCAGCAAAGCTTTAACTCATAGTTTTTCAGATAGCATGC CATACAGTC
S.aur-BIP (5 ' -3 '): ACAATAATAACGAGGTCATTGCAGCTTTTCTTGAACACTTTC
ATAACAGGTAC
1.2 using Listeria Monocytogenes (Listeria monocytogenes) distinctive virR gene
Partial Fragment is target sequence S2, expands the specific primer of S2 are as follows:
L.mon-F3(5 ' -3 '): GTCTTTTAAGTGGAGTAAACCTT
L.mon-B3(5 ' -3 '): ACAAGACTTCACCAATCCA
L.mon-FIP (5 ' -3 '): CCTGTGCCAAAGCATTTTTACATTTTTTAGGCAAGTCATCT TGTTCG
L.mon-BIP (5 ' -3 '): TAAGTCTCTTTGCAATTGACCGACTTTTACGTGTACACAGA AAAGCG
1.3 salmonella typhis (Salmonella spp), using the part piece of the distinctive invA gene of Salmonella
Section is target sequence S3, expands the specific primer of S3 are as follows:
S.spp-F3(5 ' -3 '): CGGCCCGATTTTCTCTGG
S.spp-B3(5 ' -3 '): CGGCAATAGCGTCACCTT
S.spp-FIP (5 ' -3 '): GCGCGGCATCCGCATCAATATGCCCGGTAAACAGATGAGT
S.spp-BIP (5 ' -3 '): GCGAACGGCGAAGCGTACTGTCGCACCGTCAAAGGAAC
Above-mentioned primer is synthesized and is purified in May, 2018 complete design, and by Shanghai Sheng Gong bioengineering Co., Ltd.
Bacterial strain (the Staphylococcus aureus ATCC6538, Listeria monocytogenes of above-mentioned bacterium
ATCC19115, Salmonella spp CMCC50071, are briefly referred to as golden Portugal, Liszt, sramana) purchased in May, 2017
It can buy.
2, template and target sequence substance LAMP amplification are extracted
(1) extraction of DNA of bacteria
Under sterile working, carry out increasing bacterium processing, reference respectively using bacterium of the LB culture medium to above-mentioned different genera
TGuide bacterial genomes DNA extraction kit (OSR-M502) specification carries out genome to bacterium processing gained thallus is increased respectively
The extraction and purifying of DNA.
(2) preparation of the reaction system of substance LAMP amplification is carried out under sterile working
It is expanded using 10 μ L reaction systems, reaction system includes 10 × Isothermal Amplification
1 μ L of Buffer, the inner primer FIP and BIP for expanding a kind of target sequence of bacterium of any of the above are 1.6 μM each, outer primer F3 and B3 is each
0.2 μM, dNTP 1.4mM, glycine betaine 0.8M, magnesium sulfate 5mM, Bst 2.0Archaeal dna polymerase 3.2U, step (1)
Extraction DNA (template, 106Copies/ μ L) 1 μ L and 0.25 μ L EvaGreen (20 ×) fluorescent dye, residue mended with ultrapure water
Together.Staphylococcus aureus, salmonella typhi, four Listeria Monocytogenes, no template control samples are set
Group, no template control NTC, each sample sets do 6 repetitions.
(3) it being reacted on high-resolution real-time fluorescence PCR instrument: being expanded at 67 DEG C, every 1min collects a signal,
Signal acquisition is carried out using the channel Green I SBGR, is reacted 50 minutes, carries out high-resolution in 75 DEG C to 95 DEG C of temperature ranges
Melting curve analysis, melting rate are 0.05 DEG C/s.
(4) experimental result
It uses the DNA extracted as template according to step (3), is separately added into the inside and outside primer of specificity, it is glimmering in real time to carry out LAMP
Light amplification experiment.Amplification curve (Figure 1A) can be obtained in experiment, obtains the melting of amplified production after carrying out HRM analysis to amplified production
Curve (Figure 1B), and feature unwinding peak (Fig. 1 C) is further obtained according to melting curve, amplification is produced with agarose gel electrophoresis
Object is verified, and positive sample (label is to correspond to the amplification of DNA of bacteria template in Fig. 1 D) has LAMP amplified production
Trapezoid-shaped strips generate ("-" label swimming lane is NTC in Fig. 1 D).Result above proves that three sections of target sequences of selection can be had
The LAMP of effect is expanded, and (including can analyze to obtain by melting curve initial data by HRM analysis generation its feature melting curve
Melting curve peak and normalization melting curve)；Meanwhile staphylococcus aureus and monocyte increasing with close GC ratio
It overlaps between unwinding peak corresponding to the target sequence of raw listeria spp, melting temperature difference is smaller (1.3 DEG C), but passes
The melting curve analysis of system requires melting temperature to have 3~5 DEG C of difference, and generally can not Qualitive test, therefore, it is impossible to realize
Above-mentioned three sections of target sequences are detected simultaneously by primary multiple LAMP amplification.
(2) the high-resolution fusion curve analysis of dual ring mediated isothermal nucleic acid amplification
(1) Zengjing Granule, DNA are extracted expands with substance LAMP.
(2) design of primers, synthesis are expanded with substance LAMP.
(3) it under sterile working, carries out the preparation of the reaction system of dual LAMP amplification: being expanded using 10 μ L reaction systems
Increase, reaction system includes 10 × Isothermal Amplification Buffer, 1 μ L, expands two kinds of bacterium of any of the above simultaneously
Target sequence inner primer FIP and BIP it is 0.8 μM each, outer primer F3 and B3 is 0.1 μM each, dNTP 1.4mM, glycine betaine 0.8M, sulphur
Sour magnesium 5mM, Bst 2.0Archaeal dna polymerase 3.2U, 1 μ L (10 of DNA profiling6Copies/ μ L) and 0.25 μ L
EvaGreen (20 ×) fluorescent dye, residue ultrapure water polishing.Staphylococcus aureus+monocyte hyperplasia Liszt is set
Salmonella (template etc. is than mixing), Listeria Monocytogenes+salmonella (template etc. is than mixing), Staphylococcus aureus
Bacterium+salmonella (template etc. is than mixing) and four sample sets of no template control, no template control NTC, each sample sets do 6
It is identical as its amplimer but only include the single template of correspondence to be respectively provided with use for secondary repetition, and correspond to each hybrid guided mode board group
The amplification of (staphylococcus aureus template, salmonella template, Listeria Monocytogenes template) compares.
(4) augmentation detection program (real-time fluorescence amplified reaction, high-resolution fusion curve analysis) setting of each sample sets
In, amplified reaction temperature is the result optimized according to following principle:
Two different DNA target marks are expanded simultaneously, when two amplicon (i.e. amplified production) unwinding peaks of observation are with larger
Tm difference (> 3 DEG C) chooses reaction temperature most preferably amplification temperature when keeping the two unwindings peak area equal, at this time two kinds of amplifications
Sub- content is close, and amplification efficiency is close；When Tm value difference is different smaller (≤3 DEG C), single unwinding peak is only generated, it can be from normalization
Difference is observed in HRM curved profile, when hybrid template sample normalization high-resolution melting curve is located at corresponding two single mode plates
When sample controls middle, then two targets all realize amplification, and amplification efficiency is close；
(5) experimental result
As shown in Figure 2 A, when two kinds of LAMP amplified production melting temperatures differ greatly, in relevant temperature in unwinding peak figure
There is characteristic peak generation at place, can be used as the recognition detection foundation of amplicon in dual LAMP amplification with this.But work as melting temperature difference
When smaller, such as the sample sets (1.3 DEG C) of staphylococcus aureus and Listeria Monocytogenes, dual amplicon is only
A unwinding peak is generated, can not be identified with the method at observational characteristic peak.And at normalized high-resolution curve graph (Fig. 2 B)
In, staphylococcus aureus and Listeria Monocytogenes with smaller melting temperature difference then can be easily
Clearly identify (each normalized curve integral position is mutually distinguished).Divide the above result shows that above high-resolution melts
Analysis can be applied to accurately distinguish the LAMP amplified production indistinguishable using traditional melting curve analysis；And for melting temperature
The identification for spending similar LAMP amplified production, using whole the included information of high-resolution fusion curve be substantially better than only individually according to
According to Tm value.According to the amplified reaction temperature that (sample sets) under different situations optimize, that is, can determine for triple ring mediated isothermals
The reaction temperature of the optimization of nucleic acid amplification experiment (this example is 66.5~67.5 DEG C).
(3) high-resolution of triple ring mediated isothermal nucleic acid amplifications melts detection
(1) Zengjing Granule, DNA are extracted expands with substance LAMP.
(2) design of primers, synthesis are expanded with substance LAMP.
(3) it under sterile working, carries out the preparation of the reaction system of triple LAMP amplifications: being expanded using 10 μ L reaction systems
Increase, including 10 × Isothermal Amplification Buffer, 1 μ L, amplification Listeria Monocytogenes, gold
The inner primer FIP and BIP of staphylococcus aureus and the target sequence of salmonella are 0.8 μM each, outer primer F3 and B3 is 0.1 μM each,
DNTP 1.4mM, glycine betaine 0.8M, magnesium sulfate 5mM, Bst 2.0Archaeal dna polymerase 3.2U, 1 μ L (10 of DNA profiling6Copies/ μ L) and 0.25 μ L EvaGreen (20 ×) fluorescent dye, remainder ultrapure water polishing.Golden yellow Portugal is set
Grape coccus, salmonella, Listeria Monocytogenes, staphylococcus aureus+Listeria Monocytogenes
(template etc. is than mixing), staphylococcus aureus+salmonella (template etc. is than mixing), salmonella+monocyte hyperplasia Lee
This special Salmonella (template etc. is than mixing), staphylococcus aureus+salmonella+Listeria Monocytogenes (template etc.
Than mixing) and no template control totally 8 sample sets, no template control NTC, each sample sets do 6 repetitions.
(4) augmentation detection program (real-time fluorescence amplified reaction, high-resolution fusion curve analysis) setting of each sample sets
In, reaction temperature refers to the optimum results of double ring mediated isothermal nucleic acid amplification experiment, is specifically taken as 67 DEG C.
(5) experimental result
To seven kinds of samples from three kinds of different targets, high-resolution fusion curve analysis is carried out after LAMP amplification.Such as Fig. 3 A
Shown, seven normalization high-resolution melting curves respectively correspond seven different samples, to realize that differentiation (can to different samples
As standard HRM model)；As shown in Figure 3B, it is further carried out using HRM primitive curve of the principal component analysis (PCA) to sample
Analysis, can obtain and clearly cluster corresponding to correspondence seven of seven samples, not be overlapped in each sample room, and it is clear to observe
Visualization difference (can be used as standard HRM model).Prove that normalization high-resolution melting curve can be to above 3 kinds of bacteriums
DNA and its mixing sample carry out effective augmentation detection.
It is corresponding to be, the DNA and its mixture of above 3 kinds of bacteriums are detected using the Tm value at traditional melting curve peak
When, it include the mixing sample of the DNA of the lesser staphylococcus aureus of Tm value difference value and Listeria Monocytogenes
It is difficult to accurately identify (Fig. 3 C), as a unwinding only occurs in staphylococcus aureus+Listeria Monocytogenes sample
Only there are two unwinding peaks in peak, staphylococcus aureus+Listeria Monocytogenes+salmonella；It again illustrates
The superiority and necessity identified using entire melting curve information rather than only with reference to Tm value.
(4) sensitivity and practical application of multiple LAMP
By carrying out Blind Test to analog sample, to assess the detection performance of the method (triple).Analysis shows that its identification is quasi-
True rate is 100%, shows that multiple LAMP has good reproducibility.
Multiple LAMP amplification is carried out to the DNA profiling of various concentration.There is difference since multiple LAMP can be expanded individually
The target sequence of initial concentration reaches similar plateau concentration in the amplification terminal of LAMP, therefore can be to the target sequence copied down to 10
Column are effectively detected, and have higher sensitivity.
When serum (10%) or milk (10%) being added in detection architecture (referring to amplification system), still can clearly it be gathered
Alanysis (normalized curve is equally applicable to identify) shows the steady applicability in actual sample detection.
Ratio contained by the bacterium present in actual sample is usually different, needs to analyze the bacterium of different proportion,
As shown in Figure 3D, when there are the bacterium of different proportion, normalization melting curve can divide the sample of different proportion bacterium
Analysis.
(5) preparation of multiple LAMP high-resolution fusion curve detection kit
By 10 × Isothermal Amplification Buffer, dNTP, glycine betaine, magnesium sulfate, Bst DNA polymerization
Enzyme and saturated fluorescence dyestuff EvaGreen are packed jointly, obtain high-resolution LAMP detection kit.
Need to be added the inside and outside primer and template of multiple LAMP when use according to sample detection purpose, amplification is (referring to acquisition
The condition of standard HRM model) after, detected on HRM luminoscope, referring next to the included standard HRM model of kit into
Row compares, and carries out Qualitive test to specific objective detectable substance (such as bacterium) contained by sample.
In short, the present invention has merged loop-mediated isothermal amplification (LAMP) and high-resolution melts the advantage of the two, establish
A kind of simple, quick, stopped pipe, high throughput, low cost monochromatic multiple nucleic acid constant-temperature amplification detection technique.It is advantageous that:
(1) Tm is needed to differ 3~5 DEG C compared to traditional melting curve analysis, the distinguishable Tm difference of HRM is reduced to 0.2
DEG C, this will significantly reduce the design difficulty of multiple LAMP primer, so that multiple LAMP amplified productions with small Tm difference
It can be detected simultaneously；And the target dna quantity that can be detected simultaneously in same reaction tube dramatically increases, molten at 75~95 DEG C
It solves in range, theoretic detection target (different target sequences) number reaches 100.
(2) signal collection of HRM only needs single pass Fluorescent DNA binding dyes, avoid multicolor fluorescence label or
Separate in space and carry out multiple single amplification reactions in parallel, and (modified without additional) with standard LAMP primer, reduces detection
Cost.By analyzing the melting temperature of different LAMP amplified productions, multiple LAMP detection is carried out, realizes and saves reagent, quickly letter
Just with improve sample throughput purpose.
(3) distinguishing ability of the present invention is not influenced by DNA profiling initial concentration, and sensitivity is copied up to 10；In complexity
Sample substrate in show excellent detection performance, have stronger practical application value.
(4) present invention adds dyestuff before amplification, melts amplicon after amplification under stopped pipe state and generates melting curve.Often
The difference of unique G/C content and sequence between a amplicon, melting curve are specific.Pass through normalization or principal component
The statistics means such as analysis are analyzed, i.e., the unique fingerprint identified using melting curve as specific objective.
<110>Shaanxi Tech Univ
<120>the multiple ring mediated isothermal nucleic acid amplification detection method and kit melted based on high-resolution
<160> 12
<210> 1
<211> 22
<212> DNA
<213>artificial synthesized
<400> 1
tttaacagct aaagagtttg gt 22
<210> 2
<211> 21
<212> DNA
<213>artificial synthesized
<400> 2
tttcataatc gatcactgga c 21
<210> 3
<211> 51
<212> DNA
<213>artificial synthesized
<400> 3
ccttcagcaa agctttaact catagttttt cagatagcat gccatacagt c 51
<210> 4
<211> 53
<212> DNA
<213>artificial synthesized
<400> 4
acaataataa cgaggtcatt gcagcttttc ttgaacactt tcataacagg tac 53
<210> 5
<211> 23
<212> DNA
<213>artificial synthesized
<400> 5
gtcttttaag tggagtaaac ctt 23
<210> 6
<211> 19
<212> DNA
<213>artificial synthesized
<400> 6
acaagacttc accaatcca 19
<210> 7
<211> 47
<212> DNA
<213>artificial synthesized
<400> 7
cctgtgccaa agcattttta cattttttag gcaagtcatc ttgttcg 47
<210> 8
<211> 47
<212> DNA
<213>artificial synthesized
<400> 8
taagtctctt tgcaattgac cgacttttac gtgtacacag aaaagcg 47
<210> 9
<211> 18
<212> DNA
<213>artificial synthesized
<400> 9
cggcccgatt ttctctgg 18
<210>10
<211> 18
<212> DNA
<213>artificial synthesized
<400> 10
cggcaatagc gtcacctt 18
<210> 11
<211> 40
<212> DNA
<213>artificial synthesized
<400> 11
gcgcggcatc cgcatcaata tgcccggtaa acagatgagt 40
<210> 12
<211> 38
<212> DNA
<213>artificial synthesized
<400> 12
gcgaacggcg aagcgtactg tcgcaccgtc aaaggaac 38
Claims (10)
1. it is a kind of based on high-resolution melt multiple ring mediated isothermal nucleic acid amplification detection method, it is characterised in that: including with
Lower step:
1) target sequence substance LAMP is expanded
Different according to target gene to be detected in each target detection thing sample choose target sequence and for the design of each target sequence
Corresponding primer extracts the DNA in target detection thing sample, using the DNA as template；Template and corresponding primer are subjected to substance
LAMP amplified reaction determines the reaction system of LAMP amplified reaction according to reaction result；
2) multiple LAMP reaction condition optimization
The target detection thing sample that step 1) is related to is combined two-by-two, then simultaneously for corresponding two templates after combination
LAMP amplified reaction is carried out, obtains high-resolution melting curve after amplified reaction, then according to the solution of corresponding two amplified productions
The difference degree at chain peak optimizes the reaction condition of the amplified reaction；By the corresponding reaction item of different target detectable substance sample combination
The optimum results of part merge, and obtain the reaction condition of multiple LAMP amplified reaction；
3) multiplex amplification detects
After step 2), the DNA in sample to be tested is extracted, and carry out multiple LAMP amplified reaction, amplification by template of the DNA
High-resolution melting curve is obtained after reaction, and then high-resolution melting curve is normalized or high-resolution is melted bent
Line carries out principal component analysis, then melts with the same standard high resolution constructed using normalization or principal component analysis bent
Line model is compared, and according to comparison result, identifies single target sequence or multiple target sequences contained by sample to be tested.
2. a kind of multiple ring mediated isothermal nucleic acid amplification detection method melted based on high-resolution according to claim 1,
It is characterized by: the extraction of the DNA uses RNA isolation kit.
3. a kind of multiple ring mediated isothermal nucleic acid amplification detection method melted based on high-resolution according to claim 1,
It is characterized by: the reaction condition includes reaction temperature.
4. a kind of multiple ring mediated isothermal nucleic acid amplification detection method melted based on high-resolution according to claim 1,
It is characterized by: optimizing the reaction condition of the amplified reaction specifically includes the following steps: determining two moulds in the step 2)
Plate expands the melting temperature difference of gained amplified production simultaneously, if melting temperature difference > 3 DEG C, selection makes two templates
Reaction temperature when correspondence unwinding peak area is equal is the reaction temperature of optimization, if melting temperature difference≤3 DEG C, selection make
The normalization high-resolution melting curve of the amplified production of two templates is located at the normalization of corresponding single template amplification product
Reaction temperature when between high-resolution melting curve is the reaction temperature of optimization.
5. a kind of multiple ring mediated isothermal nucleic acid amplification detection method melted based on high-resolution according to claim 1,
It is characterized by: the construction method of the standard high resolution melting curve model is specifically includes the following steps: relate to step 1)
And target detection thing sample in any one or any number of combination corresponding to template, respectively using for whole targets
The primer of sequence carries out multiple LAMP amplified reaction, then obtains high-resolution melting curve, and normalization or master is respectively adopted
Constituent analysis carries out feature extraction to corresponding high-resolution melting curve profile.
6. a kind of multiple ring mediated isothermal nucleic acid amplification detection method melted based on high-resolution according to claim 1,
It is characterized by: the target sequence is selected from fem gene, the monokaryon of staphylococcus aureus (Staphylococcus aureus)
In the virR gene of Monocytogenes (Listeria monocytogenes), the invA gene of Salmonella
It is one or more.
7. a kind of multiple ring mediated isothermal nucleic acid amplification detection method melted based on high-resolution according to claim 1,
It is characterized by: multiple LAMP amplified reaction is selected from triple above LAMP amplified reactions in the step 3).
8. a kind of multiple ring mediated isothermal nucleic acid amplification detection kit melted based on high-resolution, it is characterised in that: the examination
Agent box include reagent for constructing the reaction system of LAMP amplified reaction and for comparison for a variety of target gene
The standard high resolution melting curve model of target sequence amplification product, the model be by one of different target sequences or
The high-resolution melting curve of any number of combined amplified production be normalized respectively or principal component analysis obtained from；
The reagent includes LAMP specific primer for expanding corresponding target sequence and for the single of LAMP real-time fluorescence amplification
Nucleic acid dye.
9. a kind of multiple ring mediated isothermal nucleic acid amplification detection reagent melted based on high-resolution according to claim 8
Box, it is characterised in that: the reagent further includes buffer, dNTP, glycine betaine, magnesium sulfate, Bst archaeal dna polymerase and ultrapure water.
10. a kind of application method of kit as claimed in claim 8, it is characterised in that: the following steps are included:
The DNA in sample to be tested is extracted, and multiple LAMP is carried out as template combination LAMP specific primer using the DNA and is expanded instead
It answers, high-resolution melting curve is obtained after amplified reaction, then high-resolution melting curve is normalized or to high-resolution
Rate melting curve carry out principal component analysis, be then compared with corresponding standard high resolution melting curve model, according to than
Pair as a result, identifying single target sequence or multiple target sequences contained by sample to be tested.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910033420.2A CN109504744B (en) | 2019-01-14 | 2019-01-14 | Multiplex loop-mediated isothermal nucleic acid amplification detection method and kit based on high-resolution fusion |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910033420.2A CN109504744B (en) | 2019-01-14 | 2019-01-14 | Multiplex loop-mediated isothermal nucleic acid amplification detection method and kit based on high-resolution fusion |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109504744A true CN109504744A (en) | 2019-03-22 |
| CN109504744B CN109504744B (en) | 2022-11-29 |
Family
ID=65757841
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910033420.2A Active CN109504744B (en) | 2019-01-14 | 2019-01-14 | Multiplex loop-mediated isothermal nucleic acid amplification detection method and kit based on high-resolution fusion |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109504744B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111145835A (en) * | 2019-12-26 | 2020-05-12 | 苏州天隆生物科技有限公司 | Software analysis method for multiple melting curves |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103305623A (en) * | 2013-07-01 | 2013-09-18 | 浙江省质量检测科学研究院 | Multiple rapid detection method of two food-borne pathogenic bacteria and detection primer groups as well as kit |
| CN106244726A (en) * | 2016-08-19 | 2016-12-21 | 中检国研(北京)科技有限公司 | A kind of zika virus loop-mediated isothermal amplification detection kit and using method |
| CN108368557A (en) * | 2015-12-01 | 2018-08-03 | Sd生物传感器株式会社 | Including for the reporting dyes of nucleic acid isothermal amplification, quencher bi-functional oligonucleotide based on isothermal and utilize its nucleic acid amplification and assay method |
| CN108754032A (en) * | 2018-07-19 | 2018-11-06 | 上海速创诊断产品有限公司 | It is a kind of with the isothermal nucleic acid amplification system of high specific and its application |
| CN109097449A (en) * | 2018-08-20 | 2018-12-28 | 陕西科技大学 | A kind of real-time fluorescence LAMP detection method and kit based on ruthenium complex |
-
2019
- 2019-01-14 CN CN201910033420.2A patent/CN109504744B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103305623A (en) * | 2013-07-01 | 2013-09-18 | 浙江省质量检测科学研究院 | Multiple rapid detection method of two food-borne pathogenic bacteria and detection primer groups as well as kit |
| CN108368557A (en) * | 2015-12-01 | 2018-08-03 | Sd生物传感器株式会社 | Including for the reporting dyes of nucleic acid isothermal amplification, quencher bi-functional oligonucleotide based on isothermal and utilize its nucleic acid amplification and assay method |
| CN106244726A (en) * | 2016-08-19 | 2016-12-21 | 中检国研(北京)科技有限公司 | A kind of zika virus loop-mediated isothermal amplification detection kit and using method |
| CN108754032A (en) * | 2018-07-19 | 2018-11-06 | 上海速创诊断产品有限公司 | It is a kind of with the isothermal nucleic acid amplification system of high specific and its application |
| CN109097449A (en) * | 2018-08-20 | 2018-12-28 | 陕西科技大学 | A kind of real-time fluorescence LAMP detection method and kit based on ruthenium complex |
Non-Patent Citations (3)
| Title |
|---|
| 周国华主编: "《SNP检测技术与个体化药物治疗》", 28 February 2015, 苏州大学出版社 * |
| 王和勇: "《面向大数据的高维数据挖掘技术》", 31 March 2018, 西安电子科技大学出版社 * |
| 陈洵等: "环介导恒温扩增法检测肉制品中致病微生物", 《肉类研究》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111145835A (en) * | 2019-12-26 | 2020-05-12 | 苏州天隆生物科技有限公司 | Software analysis method for multiple melting curves |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109504744B (en) | 2022-11-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106399517B (en) | Nucleic acid detection technology combining multi-cross constant-temperature amplification with gold nano biosensing | |
| CN106011246B (en) | 5 kinds of root-knot nematode isothermal duplication detection primer sequences and its application based on microfluidic chip technology | |
| CN110358815B (en) | Method for simultaneously detecting multiple target nucleic acids and kit thereof | |
| CN113186313A (en) | Salmonella detection primer group, method and kit based on RPA-LbCas12a-TTECDS system | |
| CN110317861B (en) | Kit for detecting pathogen | |
| CN108103164B (en) | Method for detecting copy number variation by using multiple fluorescent competitive PCR | |
| CN106868140B (en) | Multiplex fluorescent quantitative PCR method | |
| CN105755134B (en) | Endonuclease-mediated real-time multiple cross-displacement nucleic acid amplification technology and application | |
| CN108753933B (en) | Real-time fluorescent quantitative PCR detection method and kit based on metal ruthenium complex | |
| CN110184334A (en) | Multi-PCR detection method and kit based on high-resolution fusion curve shape | |
| CN109504744A (en) | The multiple ring mediated isothermal nucleic acid amplification detection method and kit melted based on high-resolution | |
| CN109097449B (en) | Real-time fluorescence LAMP detection method and kit based on metal ruthenium complex | |
| JPH05509000A (en) | DNA sequence determination method | |
| CN111793717A (en) | Specific primer pair, probe and kit for detecting novel coronavirus | |
| CN114480700B (en) | PCR primer, method and application for detecting and identifying banana fusarium wilt bacteria No.1 and No. 4 physiological race | |
| CN110129482A (en) | Detect LAMP primer group, kit and the detection method of African swine fever virus | |
| CN116555449A (en) | Kit for simultaneously detecting multiple key drug resistance genes based on RPA-LFD and application thereof | |
| CN112280839A (en) | Real-time PCR technology for detecting more target points than fluorescent channels and application thereof | |
| CN113215325A (en) | Reaction system, method and kit for detecting multiple HPV subtypes through two-dimensional PCR single closed tube | |
| CN108642190B (en) | Forensic medicine composite detection kit based on 14 autosomal SNP genetic markers | |
| CN112481390A (en) | Transgenic lysozyme sheep strain specific micro-drop type digital PCR (polymerase chain reaction) primer and detection method based on primer | |
| CN110577985A (en) | Method for detecting DNA methylation | |
| Zhang et al. | A label-free strategy for visual genotyping based on phosphate induced coloration reaction | |
| CN109609668B (en) | Detection primer group and kit for MLVA typing of salmonella typhimurium and application of detection primer group and kit | |
| CN106676101A (en) | Molecular beacon modified with locked nucleic acid and for diagnosis of breast cancer and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20221207 Address after: D209, Floor 2, Building 1, No. 12, Shangdi Xinxi Road, Haidian District, Beijing 100089 Patentee after: BEIJING FIRE GENE DX TECHNOLOGY CO.,LTD. Address before: 710026 B49 Xindi Zhongchuang Space, 26th Street, Floor 6, Block C, Huanan City, International Port District, Baqiao District, Xi'an, Shaanxi Patentee before: Xi'an Huaqi Zhongxin Technology Development Co.,Ltd. Effective date of registration: 20221207 Address after: 710026 B49 Xindi Zhongchuang Space, 26th Street, Floor 6, Block C, Huanan City, International Port District, Baqiao District, Xi'an, Shaanxi Patentee after: Xi'an Huaqi Zhongxin Technology Development Co.,Ltd. Address before: No. 1, Weiyang District university garden, Xi'an, Shaanxi Province, Shaanxi Patentee before: SHAANXI University OF SCIENCE & TECHNOLOGY |
|
| TR01 | Transfer of patent right |