CN109371012B

CN109371012B - Lysate and method for extracting meat nucleic acid

Info

Publication number: CN109371012B
Application number: CN201811423651.6A
Authority: CN
Inventors: 吴坚; 伍辉; 章贤骏
Original assignee: Hangzhou Anyu Xinqiao Education Technology Co ltd
Current assignee: Hangzhou Anyu Xinqiao Education Technology Co ltd
Priority date: 2018-11-27
Filing date: 2018-11-27
Publication date: 2021-02-09
Anticipated expiration: 2038-11-27
Also published as: CN109371012A

Abstract

The invention discloses a lysis solution and a method for extracting meat nucleic acid. The lysis solution is obtained by dissolving sodium chloride, sodium dodecyl sulfate, ethyl phenyl polyethylene glycol and polyvinylpyrrolidone in water and mixing; the concentration of each component in the mixed solution is respectively as follows: sodium chloride: 0.2-1.5M, sodium dodecyl sulfate: 0.01-1 g/ml, ethyl phenyl polyethylene glycol: 0.01-0.5 g/ml, polyvinylpyrrolidone: 0.01-0.1 g/ml. The method comprises the following steps: mixing the chopped meat sample with the lysate uniformly at normal temperature, and standing for a period of time; and centrifuging to obtain supernatant to obtain nucleic acid extract. The lysate of the invention has low cost and no toxicity, the extraction method can realize the rapid extraction of the meat nucleic acid, the operation process is simple and easy, and the lysate can be applied to a PCR or LAMP amplification system for detection.

Description

Lysate and method for extracting meat nucleic acid

Technical Field

The invention belongs to the technical field of food safety monitoring, and particularly relates to a lysate and a method for extracting meat nucleic acid.

Background

At present, in order to obtain economic benefits, many bad merchants on the market often replace high-price meat with cheap meat, and the rights of consumers are seriously damaged. Since the difference between the appearance of some similar meats (such as pork and beef, mutton and beef) is not large, ordinary consumers can hardly distinguish the meats by naked eyes. In order to identify the type of meat, a method of amplifying and detecting a nucleic acid sequence specific to meat by using PCR or LAMP reaction is commonly used. However, before amplification, extraction of nucleic acids from meat is required.

The traditional methods for extracting nucleic acid from meat include phenol-trichloromethane method, CTAB method, PVP method, silica method, guanidine-trichloromethane method, etc. Some methods need heating, some methods have long operation time, more operation steps and more complicated processes, greatly reduce the nucleic acid extraction efficiency, and are not beneficial to realizing the rapid extraction and the rapid detection of nucleic acid.

In order to accelerate the extraction of nucleic acid from meat, some reports have been made about the extraction method of nucleic acid from meat, such as the method of Tris-EDTA, the improved CTAB method, the strong alkali method, the urea method, etc., which, although the operation steps and procedures are simplified compared with the traditional detection method, still have long operation time, and some reagents have certain toxicity and certain harm to human body. There are many meat nucleic acid extraction kits (centrifugal column type) on the market, but generally the meat is cracked for more than 1 hour by heating, and the required reagents and operation steps are more, and the cost is higher. Therefore, the development of a simple, normal-temperature, non-toxic and rapid meat nucleic acid extraction method and the application of the method in rapid detection of meat nucleic acid are of great significance.

In conclusion, based on the defects and actual requirements of the prior art, the lysis solution and the method for extracting the meat nucleic acid are developed, the lysis solution is non-toxic and low in cost, and the method for extracting the meat by using the lysis solution has the advantages of simplicity in operation, rapidness in extraction process and the like.

Disclosure of Invention

The invention aims to provide a lysis solution and a method for extracting meat nucleic acid. The lysate of the invention has low cost and no toxicity, the extraction method can realize the rapid extraction of the meat nucleic acid, the operation process is simple and easy, and the lysate can be applied to a PCR or LAMP amplification system for detection.

In order to achieve the purpose, the invention adopts the following technical scheme:

a lysate for extracting nucleic acid from meat is prepared by dissolving sodium chloride, sodium dodecyl sulfate, ethyl phenyl polyethylene glycol and polyvinylpyrrolidone in water and mixing; the concentration of each component in the mixed solution is respectively as follows:

sodium chloride: 0.2 to 1.5M,

sodium dodecyl sulfate: 0.01 to 1g/ml,

ethyl phenyl polyethylene glycol: 0.01 to 0.5g/ml,

polyvinylpyrrolidone: 0.01g/ml to 0.1 g/ml.

Further, in the above lysis solution, it is preferable that the concentration of sodium chloride is 0.3 to 1M; more preferably, the concentration of sodium chloride is 0.4-0.6M.

Further, in the lysate, the concentration of sodium dodecyl sulfate is preferably 0.1 to 0.8g/ml, and more preferably 0.3 to 0.6 g/ml.

Further, in the lysis solution, preferably, the concentration of ethylphenylpolyethylene glycol is 0.05-0.2 g/ml; more preferably, the concentration of the ethyl phenyl polyethylene glycol is 0.08-0.1 g/ml.

Further, in the above lysis solution, it is preferable that the concentration of polyvinylpyrrolidone is 0.03 to 0.08 g/ml; more preferably, the concentration of polyvinylpyrrolidone is 0.05g/ml to 0.06 g/ml.

The lysis solution of the invention uses sodium chloride with higher concentration, so that the animal histiocyte loses water in the environment of high-concentration salt, and releases nucleic acid in the cell. Meanwhile, in order to promote the rupture of cell membranes, the invention uses two surfactants with certain concentrations: sodium dodecyl sulfate and ethyl phenyl polyethylene glycol are used for cracking cell membranes and promoting the release of nucleic acid. After the membrane is broken, impurities such as protein and fat in meat can be released, so that the yield of nucleic acid is influenced, and important influence is generated on subsequent amplification. Therefore, polyvinylpyrrolidone with a certain concentration is added into the lysis solution, which is a cross-linking agent and can precipitate impurities such as protein, fat and the like.

A method for extracting nucleic acid from meat comprises the following steps:

(1) mixing the chopped meat sample with the lysate at normal temperature, and standing for a period of time;

(2) centrifuging, and collecting supernatant to obtain nucleic acid extract.

Further, the mass-volume ratio of the meat sample to the lysate is 2: 2-2: 6 g/ml; more preferably, the mass volume ratio of the sample to the lysis solution is 2: 3-2: 5 g/ml; most preferably, the mass-to-volume ratio of the sample to the lysis solution is 2: 3-2: 4 g/ml.

Further, the standing time in the step (1) is 1-5 min; more preferably, the standing time is 2-4 min; most preferably, the standing time is 2-3 min.

Further, the centrifugal rotating speed is 8000-15000 rpm; more preferably, the rotating speed is 9000rpm to 12000 rpm; most preferably, the rotation speed is 10000rpm to 11000 rpm.

Further, the centrifugation time was 1 min.

The nucleic acid extract was diluted with TE buffer (10 mM Tris, 1mM EDTA, pH 8.0). Preferably, the nucleic acid extract is diluted 20 to 100 times with TE buffer; more preferably, the nucleic acid extract is diluted 30 to 80-fold with TE buffer; most preferably, the nucleic acid extract is diluted 40 to 60 fold with TE buffer.

The invention has the following advantages:

(1) according to the invention, through the synergistic effect of sodium chloride, sodium dodecyl sulfate, ethyl phenyl polyethylene glycol and polyvinylpyrrolidone, the rupture of meat cell membranes can be promoted, the release of nucleic acid is ensured, impurities are effectively precipitated, and the extraction of meat nucleic acid can be rapidly realized.

(2) The lysis solution has low raw material source cost and no toxic or side effect.

(3) The method for extracting the nucleic acid from the meat is simple to operate, can be completed within about 5 minutes at normal temperature, and has extremely important significance for detecting the nucleic acid from the meat.

Drawings

FIG. 1 shows the PCR amplification results of example 3, wherein 1 represents a positive sample, 2 represents a negative sample, and Rn represents the fluorescence value of background signal eliminated.

FIG. 2 shows the LAMP amplification results of example 4, in which 1 represents a positive sample, 2 represents a negative sample, and Rn represents the fluorescence value for eliminating the background signal.

FIG. 3 shows the PCR amplification results of example 5, in which 1 represents a positive sample, 2 represents a negative sample, and Rn represents the fluorescence value of background signal eliminated.

FIG. 4 shows the LAMP amplification results of example 6, in which 1 represents a positive sample, 2 represents a negative sample, and Rn represents the fluorescence value for eliminating the background signal.

FIG. 5 shows the PCR amplification results of example 7, in which 1 represents a positive sample, 2 represents a negative sample, and Rn represents the fluorescence value of background signal eliminated.

FIG. 6 shows the LAMP amplification results of example 8, in which 1 represents a positive sample, 2 represents a negative sample, and Rn represents the fluorescence value for eliminating the background signal.

FIG. 7 shows the PCR amplification results of example 9, in which 1 represents a positive sample, 2 represents a negative sample, and Rn represents the fluorescence value of background signal eliminated.

FIG. 8 shows the LAMP amplification results of example 10, in which 1 represents a positive sample, 2 represents a negative sample, and Rn represents the fluorescence value for eliminating the background signal.

FIG. 9 shows the result of amplification of PCRP in example 11, in which 1 represents a positive sample, 2 represents a negative sample, and Rn represents a fluorescence value obtained by eliminating a background signal.

FIG. 10 shows the LAMP amplification results of example 12, in which 1 represents a positive sample, 2 represents a negative sample, and Rn represents the fluorescence value for eliminating the background signal.

FIG. 11 shows the results of PCR amplification in example 13, in which 1 represents a positive sample, 2 represents a negative sample, and Rn represents the fluorescence value of background signal eliminated.

FIG. 12 shows the LAMP amplification results of example 14, in which 1 represents a positive sample, 2 represents a negative sample, and Rn represents the fluorescence value for eliminating the background signal.

Detailed Description

The following specific examples are further illustrative of the methods and techniques provided by the present invention and should not be construed as limiting the invention thereto.

Example 1

In order to determine the optimum concentration of the four components (sodium chloride, sodium dodecyl sulfate, ethylphenyl polyethylene glycol, polyvinylpyrrolidone) in the lysate, it was decided to use L₉(3⁴) The orthogonal table of (a) sets up an experimental scheme and utilizes a range analysis method to obtain the optimal concentration of the four components in the lysate. Their factor levels are shown in table 1.

TABLE 1

In the experiment, the orthogonal experiment was performed using pork as a sample, and the pork was fixed toThe mass volume ratio of the lysis solution is 2:3g/ml, the sample and the lysis solution are mixed uniformly and then are kept stand for 1min, and then the fixed rotation speed is 8000rpm and the centrifugation is carried out for 1 min. Finally, the mixture was diluted 50-fold in TE buffer to obtain a nucleic acid extract. C according to real-time fluorescent PCR reaction_tThe nucleic acid extraction effect was judged by the magnitude of the value (number of initial cycles at which a fluorescent signal was detectable in PCR reaction), C_tSmaller values indicate greater nucleic acid acquisition. The experimental protocol design and results are shown in table 2. C in Table 2_t(j1) C representing the first level of each factor_tThe sum of the values; c_t(j2) C representing the second level of each factor_tThe sum of the values; c_t(j3) C representing the third level of each factor_tThe sum of the values; rj represents each factor C_tThe difference between the maximum and minimum of the sum of values.

The PCR amplification system of pork is as follows:

and (3) PCR system: the PCR reaction was carried out in a 25. mu.L system containing 0.8. mu.M SYTO9, TaKaRa Taq HS polymerase 0.625U, 10 XPCR Buffer (Mg)²⁺Plus), dNTPs 0.2mM each (purchased from Baori physician technology, Beijing, Ltd.), and a primer concentration of 0.4. mu.M (purchased from Biotechnology engineering, Shanghai, Ltd.).

PCR amplification procedure: the hot start at 94 ℃ was carried out for 5min in 40 cycles, each cycle comprising a reaction at 94 ℃ for 30s, a reaction at 60 ℃ for 30s and a reaction at 72 ℃ for 30 s.

The primer sequences used were:

F(SEQ ID NO.1)：5’GAAGGTTCAGGTTTACTCACG 3’

R(SEQ ID NO.2)：5’TCAGCAAATCAATTTCAATCTGG 3’

amplified template sequence (SEQ ID NO. 3):

5’GAAGGTTCAGGTTTACTCACGCCACCCAGCGGAAAACGGAAAGCCAAATTACCTGAACTGCTATGTATCTGGGTTCCATCCGCCCCAGATTGAAATTGATTTGCTGA3’(GeneBank:NC_010443.5)

TABLE 2

According to the table2, the Rj values are in descending order: sodium chloride, ethyl phenyl polyethylene glycol, sodium dodecyl sulfate and polyvinylpyrrolidone. The concentration of sodium chloride in the lysate is shown to have the greatest effect on nucleic acid extraction, followed by ethylphenylpolyethylene glycol, followed by sodium dodecyl sulfate, and finally polyvinylpyrrolidone. At the same time according to C_tThe smaller the value, the larger the nucleic acid extraction amount, and it was found that: the optimum concentration of sodium chloride is 0.6M; the optimal concentration of the sodium dodecyl sulfate is 0.6 g/ml; the optimum concentration of ethylphenylpolyethylene glycol is 0.1 g/ml; the optimum concentration of polyvinylpyrrolidone is 0.05 g/ml. In the following examples, the lysates were therefore tested using this optimal concentration combination.

Example 2

After the optimal concentration of the four components in the lysate is determined, three factors such as the mass-volume ratio (unit: g/ml) of the sample to the lysate, the standing time after the sample and the lysate are mixed uniformly, the optimal rotating speed for separating nucleic acid from impurities and the like are determined (the dilution times of the nucleic acid extract are finally determined). In order to minimize the number of trials, it was still decided to use L₉(3⁴) The orthogonal table of (a) sets up an experimental scheme and utilizes a range analysis method to obtain the optimal conditions of the three factors. Their factor levels are shown in table 3. The mass to volume ratio of sample to lysate, the standing time, and the centrifuge speed are indicated by the letters A, B, C in the table.

TABLE 3

In the experiment, an orthogonal experiment was performed using pork as a sample, and the components in the lysate were each at the optimum concentration in example 1, and the mass of the sample was fixed at 100 mg. Mixing pork and lysate, standing for a period of time, centrifuging at a certain rotation speed for 1min, and diluting with TE buffer solution by 50 times to obtain nucleic acid extract. C according to real-time fluorescent PCR reaction_tThe nucleic acid extraction effect is judged by the magnitude of the value (the number of initial cycles at which the fluorescence signal can be detected), C_tSmaller values indicate greater nucleic acid acquisition. The experimental protocol design and results are shown in table 4. C in Table 4_t(j1) C representing the first level of each factor_tThe sum of the values; c_t(j2) C representing the second level of each factor_tThe sum of the values; c_t(j3) C representing the third level of each factor_tThe sum of the values; rj represents each factor C_tThe difference between the maximum and minimum of the sum of values.

The PCR amplification system, amplification procedure and amplification sequence of pork were the same as in example 1.

TABLE 4

From the results in table 4, it can be seen that the Rj values are in descending order: mass-volume ratio of sample to lysate, centrifugal speed, and standing time. The mass-volume ratio of the sample to the lysate shows the greatest influence on the nucleic acid extraction, followed by the centrifugation speed and finally the standing time. At the same time according to C_tThe smaller the value, the larger the nucleic acid extraction amount, and it was found that: the optimal mass volume ratio of the sample to the lysate is 2:3g/ml, the optimal standing time after the sample and the lysate are uniformly mixed is 2min, and the optimal centrifugal rotation speed is 10000 rpm. In the following examples, experiments were carried out using the above-described optimum conditions.

Example 3

Firstly, 100mg of fresh pork is uniformly mixed with 150 mu L of lysis solution (0.6M sodium chloride, 0.6g/ml sodium dodecyl sulfate, 0.1g/ml ethyl phenyl polyethylene glycol and 0.05g/ml polyvinylpyrrolidone) and kept stand for 2 minutes at normal temperature; then, centrifugation was carried out at 10000rpm for 1 minute, and the supernatant was aspirated to obtain a nucleic acid extract, and the effect of nucleic acid extraction was determined by PCR.

The pork PCR amplification system, the amplification procedure and the amplification sequence were the same as in example 1.

The nucleic acid extract was diluted 20-fold with TE buffer solution and used as a template for PCR amplification, yielding a fluorescence amplification curve 1.

The results show that: the positive sample in FIG. 1 produced an amplification curve, and the negative sample did not produce amplification, indicating that the nucleic acid extraction method can effectively extract nucleic acid from pork and can perform detection by PCR reaction.

Example 4

Firstly, 100mg of fresh pork is uniformly mixed with 150 mu L of lysis solution (0.6M sodium chloride, 0.6g/ml sodium dodecyl sulfate, 0.1g/ml ethyl phenyl polyethylene glycol and 0.05g/ml polyvinylpyrrolidone) and kept stand for 2 minutes at normal temperature; then, the mixture was centrifuged at 10000rpm for 1 minute, and the supernatant was aspirated to obtain a nucleic acid extract, and the effect of nucleic acid extraction was determined by LAMP.

And (3) pork LAMP system: LAMP Reaction was performed in a 25. mu.L system containing 0.4. mu.M SYTO9, Bst DNA polymerase (large fragment) 16U, 10xThermoPol Reaction, Betaine (Betaine) 0.8M, MgCl₂2mM, 0.35mM each of dNTPs, 0.2. mu.M each of primers F3/B3, 1.6mM each of primers FIP/BIP, and 0.4. mu.M each of primers LF/LB (purchased from Biotechnology, Shanghai, Ltd.).

LAMP amplification program: the samples were heated at 63 ℃ for 45 minutes at constant temperature for 90 cycles, and fluorescence values were read every 30 seconds.

The primer sequences used were:

F3(SEQ ID NO.4)：5’AGACTATGAAGACCTCACCTT 3’

B3(SEQ ID NO.5)：5’AGTGCTGACTAGCTTCTCA 3’

FIP(SEQ ID NO.6)：

5’AGGGATGGGACGGCTCATGACAATCGAGTTGTTCTACCA 3’

BIP(SEQ ID NO.7)：

5’ACAGATGCTATCCCAGGACGATCTGAGCACTGTCCGTAA 3’

LF(SEQ ID NO.8)：5’GCAGTACGTCTTCAGAGGATAC 3’

LB(SEQ ID NO.9)：5’CTCTAATATCCACACGACCTGG 3’

amplified template sequence (SEQ ID NO. 10):

5’AGACTATGAAGACCTCACCTTTGACTCATATATAATCCCCACATCAGATCTTAAACCTGGAGAAATACGACTACTAGAAGTAGACAATCGAGTTGTTCTGCCAATAGAAATAACAATCCGAATATTAGTGTCCTCTGAAGACGTACTACACTCATGAGCTGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACCAAACAACTCTAATATCCACACGACCTGGCCTTTATTACGGACAGTGCTCAGAAATCTGTGGATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTAAAGTACTTCGAAAAATGGTCAACATCAATATTAACAGGTTCATTGAGAAGCTAGTCAGCACT3’(GeneBank:KC469586.1)

the nucleic acid extract was diluted 20-fold with TE buffer solution and used as a LAMP reaction template for amplification, yielding a fluorescence amplification curve 2.

The results show that: the positive sample in FIG. 2 produced an amplification curve, and the negative sample did not produce amplification, indicating that the nucleic acid extraction method can effectively extract nucleic acid from pork and can perform detection by LAMP reaction.

Example 5

And (3) diluting the nucleic acid extract by 50 times by using TE buffer solution as a PCR reaction template for amplification to obtain a fluorescence amplification curve chart 3.

The results show that: FIG. 3 shows that the positive sample produced an amplification curve and the negative sample did not produce amplification, and that the positive sample showed a fluorescence amplification curve C as compared with the amplification result in example 3_tThe former indicates that the effect of diluting the nucleic acid extract 50 times is better than that of diluting it 20 times.

Example 6

The LAMP amplification system, the amplification procedure and the amplification sequence of pork were the same as those in example 4.

The nucleic acid extract is diluted by 50 times by TE buffer solution to be used as a LAMP reaction template for amplification, and a fluorescence amplification curve chart 4 is obtained.

The results show that: in FIG. 4, the positive sample produced an amplification curve, the negative sample did not produce amplification, and the positive sample exhibited a fluorescence amplification curve T comparable to the amplification result in example 4_tThe higher the value (initial time at which a fluorescent signal is detectable in the LAMP reaction), the better the effect of diluting the nucleic acid extract 50 times than 20 times.

Example 7

And (3) diluting the nucleic acid extract by 80 times by using TE buffer solution as a PCR reaction template for amplification to obtain a fluorescence amplification curve chart 5.

The results show that: FIG. 5 shows the result of amplification in the positive sample, in which no amplification occurred in the negative sample, and the result of fluorescence amplification in the positive sample, in comparison with the result of amplification in example 5, shows the result of amplification in the positive sample_tThe latter point indicates that the effect of diluting the nucleic acid extract 80-fold is inferior to that of 50-fold.

Example 8

The nucleic acid extract was diluted 80-fold with TE buffer solution and used as a LAMP reaction template for amplification, yielding a fluorescence amplification curve 6.

The results show that: in FIG. 6, the positive sample produced an amplification curve, the negative sample produced no amplification, and the positive sample exhibited a fluorescence amplification curve T comparable to the amplification result in example 4_tThe latter point indicates that the effect of diluting the nucleic acid extract 80-fold is inferior to that of 50-fold.

Example 9

Firstly, 100mg of fresh beef is mixed with 150 mu L of lysis solution (0.6M sodium chloride, 0.6g/ml sodium dodecyl sulfate, 0.1g/ml ethyl phenyl polyethylene glycol and 0.05g/ml polyvinylpyrrolidone) uniformly, and the mixture is kept stand for 2 minutes at normal temperature; then, centrifugation was carried out at 10000rpm for 1 minute, and the supernatant was aspirated to obtain a nucleic acid extract, and the effect of nucleic acid extraction was determined by PCR.

Beef PCR System: the PCR reaction was carried out in a 25. mu.L system containing 0.8. mu.M SYTO9, TaKaRa Taq HS polymerase 0.625U, 10 XPCR Buffer (Mg)²⁺Plus), dNTPs 0.2mM each (purchased from Baori physician technology, Beijing, Ltd.), and a primer concentration of 0.4. mu.M (purchased from Biotechnology engineering, Shanghai, Ltd.).

The primer sequences used were:

F(SEQ ID NO.11)：5’CTGCTATGTGTATGGGTTCC 3’

R(SEQ ID NO.12)：5’GTAGAAAGACCAGTCCTTGC 3’

amplified template sequence (SEQ ID NO. 13):

5’CTGCTATGTGTATGGGTTCCATCCACCCCAGATTGAAATCGATTTGCTGAAGAATGGGGAGAAGATTAAATCGGAGCAGTCAGACCTGTCTTTCAGCAAGGACTGGTCTTTCTAC3’(GeneBank:NC_037337.1)

the nucleic acid extract was diluted 20-fold with TE buffer solution and used as a template for PCR reaction for amplification, yielding a fluorescence amplification curve 7.

The results show that: the positive sample in FIG. 7 produced an amplification curve, and the negative sample did not produce amplification, indicating that the nucleic acid extraction method can effectively extract nucleic acid from beef and can utilize PCR reaction for detection.

Example 10

Firstly, 100mg of fresh beef is mixed with 150 mu L of lysis solution (0.6M sodium chloride, 0.6g/ml sodium dodecyl sulfate, 0.1g/ml ethyl phenyl polyethylene glycol and 0.05g/ml polyvinylpyrrolidone) uniformly, and the mixture is kept stand for 2 minutes at normal temperature; then, the mixture was centrifuged at 10000rpm for 1 minute, and the supernatant was aspirated to obtain a nucleic acid extract, and the effect of nucleic acid extraction was determined by LAMP.

Beef LAMP system: LAMP Reaction was performed in a 25. mu.L system containing 0.4. mu.M SYTO9, Bst DNA polymerase (large fragment) 16U, 10xThermoPol Reaction, Betaine (Betaine) 0.8M, MgCl₂2mM, 0.35mM each of dNTPs, 0.2. mu.M each of primers F3/B3, 1.6mM each of primers FIP/BIP, and 0.4. mu.M each of primers LF/LB (purchased from Biotechnology, Shanghai, Ltd.).

The primer sequences used were:

F3(SEQ ID NO.14)：5’GCTAATCAGCCCATGCTC 3’

B3(SEQ ID NO.15)：5’TTGACTTTGTTTGGAGTGCT 3’

FIP(SEQ ID NO.16)：

5’TCCAGCTACAATAGATGCTCCGACACATAACTGTGCTGTCAT 3’

BIP(SEQ ID NO.17)：

5’GCATCTTGAGCACCAGCATAAAGTGGTGGTAGATATTTAAGGG 3’

LF(SEQ ID NO.18)：5’ATAGCTGAGTCCAAGCATCC 3’

LB(SEQ ID NO.19)：5’CAGTCAATGGTCACAGGACA 3’

amplified template sequence (SEQ ID NO. 20):

5’GCTAATCAGCCCATGCTCACACATAACTGTGCTGTCATACATTTGGTATTTTTTTATTTTGGGGGATGCTTGGACTCAGCTATGGCCGTCAAAGGCCCTGACCCGGAGCATCTATTGTAGCTGGACTTAACTGCATCTTGAGCACCAGCATAATGATAAGCATGGACATTACAGTCAATGGTCACAGGACATAAATTATATTATATATCCCCCCTTCATAAAAATTTCCCCCTTAAATATCTACCACCACTTTTAACAGACTTTTCCCTAGATACTTATTTAAATTTTTCACGCTTTCAATACTCAATTTAGCACTCCAAACAAAGTCAA3’(GeneBank:AY526085.1)

the nucleic acid extract was diluted 20-fold with TE buffer solution and used as a LAMP reaction template for amplification, yielding a fluorescence amplification curve 8.

The results show that: the positive sample in FIG. 8 produced an amplification curve, and the negative sample did not produce amplification, indicating that the nucleic acid extraction method can effectively extract nucleic acid from beef and can perform detection by LAMP reaction.

Example 11

The beef PCR amplification system, the amplification procedure and the amplification sequence were the same as in example 9.

The nucleic acid extract was diluted 50-fold with TE buffer solution and used as a template for PCR reaction for amplification, resulting in a fluorescence amplification curve 9.

The results show that: FIG. 9 shows the result of amplification in the positive sample, in which no amplification occurred in the negative sample, and the result of fluorescence amplification in the positive sample, in comparison with the result of amplification in example 9, shows the result of amplification in the positive sample_tThe former indicates that the effect of diluting the nucleic acid extract 50 times is better than that of diluting it 20 times.

Example 12

The LAMP amplification system, the amplification procedure and the amplification sequence of pork were the same as those in example 10.

The nucleic acid extract is diluted by 50 times by TE buffer solution to be used as a LAMP reaction template for amplification, and a fluorescence amplification curve chart 10 is obtained.

The results show that: FIG. 10 shows that the positive sample produced an amplification curve, the negative sample produced no amplification, and the positive sample exhibited a fluorescence amplification curve T comparable to the amplification result in example 10_tThe former indicates that the effect of diluting the nucleic acid extract 50 times is better than that of diluting it 20 times.

Example 13

The nucleic acid extract was diluted 80-fold with TE buffer solution and used as a template for PCR reaction for amplification, resulting in a fluorescence amplification curve 11.

The results show that: FIG. 11 shows the result of amplification in the positive sample, in which no amplification occurred in the negative sample, and the result of fluorescence amplification in the positive sample, in comparison with the result of amplification in example 9, shows the result of amplification in the positive sample_tThe latter point indicates that the effect of diluting the nucleic acid extract 80-fold is inferior to that of 50-fold.

Example 14

The nucleic acid extract was diluted 80-fold with TE buffer solution and used as a LAMP reaction template for amplification, yielding a fluorescence amplification curve 12.

The results show that: FIG. 12 shows that the positive sample produced an amplification curve, the negative sample produced no amplification, and the positive sample exhibited a fluorescence amplification curve T comparable to the amplification result in example 10_tThe latter point indicates that the effect of diluting the nucleic acid extract 80-fold is inferior to that of 50-fold.

Comparative example 1

Firstly, uniformly mixing 100mg of fresh pork and 150 mu L of lysate, and standing for 2 minutes at normal temperature; then, centrifugation was carried out at 10000rpm for 1 minute, and the supernatant was aspirated to obtain a nucleic acid extract, and the effect of nucleic acid extraction was determined by PCR.

Five lysates with different component contents were used in the experiment, and the five different lysates were labeled E, F, G, H, I.

E: 0.6M sodium chloride;

f: 0.6M sodium chloride, 0.6g/ml sodium dodecyl sulfate;

g: 0.6M sodium chloride, 0.6g/ml sodium dodecyl sulfate, 0.1g/ml ethyl phenyl polyethylene glycol;

h: 0.6M sodium chloride, 0.6g/ml sodium dodecyl sulfate, 0.1g/ml ethyl phenyl polyethylene glycol, 0.05g/ml polyvinylpyrrolidone.

I: 0.6g/ml of sodium dodecyl sulfate, 0.1g/ml of ethylphenyl polyethylene glycol and 0.05g/ml of polyvinylpyrrolidone.

Diluting the nucleic acid extract 20 times with TE buffer solution as PCR reaction template for amplification according to C of real-time fluorescence PCR reaction_tThe nucleic acid extraction effect is judged by the magnitude of the value (the number of initial cycles at which the fluorescence signal can be detected), C_tSmaller values indicate greater nucleic acid acquisition. The experimental protocol design and results are shown in table 5.

TABLE 5

Lysis solution	C_t
		E	31.0
F	29.7
		G	28.1
H	27.3
		I	32.9

From the results, pork was cracked using sodium chloride alone, C_tThe value is very large, which indicates that the cracking effect is poor by using sodium chloride only; when sodium dodecylsulfonate is added, C_tThe value is obviously reduced, which shows that the sodium dodecyl sulfate can assist the sodium chloride to accelerate the cracking of the sample; when ethyl phenyl polyethylene glycol is added continuously, C_tThe value continues to decrease, which indicates that the ethyl phenyl polyethylene glycol can assist in accelerating the sample cracking; when polyvinylpyrrolidone is added further, C_tThe value is still getting smaller, but the variation range is not very large, which shows that the polyvinylpyrrolidone can also accelerate the sample cracking to a certain extent, but the effect may not be that the sodium dodecyl sulfate and the ethyl phenyl polyethylene glycol are usedThe effect is obvious; when no sodium chloride was added, C was found_tThe value is greatly increased, which indicates that the sodium chloride plays an important role in the sample cracking process.

The above description of the embodiments is only intended to facilitate the understanding of the method of the invention and its core ideas. It should be noted that, for those skilled in the art, it is possible to make various improvements and modifications to the present invention without departing from the principle of the present invention, and those improvements and modifications also fall within the scope of the claims of the present invention.

Sequence listing

<110> Hangzhou reputation New bridge education technology Co Ltd

<120> lysis solution and method for extracting meat nucleic acid

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400> 1

gaaggttcag gtttactcac g 21

<210> 2

<211> 23

<212> DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400> 2

tcagcaaatc aatttcaatc tgg 23

<210> 3

<211> 107

<212> DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400> 3

gaaggttcag gtttactcac gccacccagc ggaaaacgga aagccaaatt acctgaactg 60

ctatgtatct gggttccatc cgccccagat tgaaattgat ttgctga 107

<210> 4

<211> 21

<212> DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400> 4

agactatgaa gacctcacct t 21

<210> 5

<211> 19

<212> DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400> 5

agtgctgact agcttctca 19

<210> 6

<211> 39

<212> DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400> 6

agggatggga cggctcatga caatcgagtt gttctacca 39

<210> 7

<211> 39

<212> DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400> 7

acagatgcta tcccaggacg atctgagcac tgtccgtaa 39

<210> 8

<211> 22

<212> DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400> 8

gcagtacgtc ttcagaggat ac 22

<210> 9

<211> 22

<212> DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400> 9

ctctaatatc cacacgacct gg 22

<210> 10

<211> 378

<212> DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400> 10

agactatgaa gacctcacct ttgactcata tataatcccc acatcagatc ttaaacctgg 60

agaaatacga ctactagaag tagacaatcg agttgttctg ccaatagaaa taacaatccg 120

aatattagtg tcctctgaag acgtactaca ctcatgagct gtcccatccc tcggtttaaa 180

aacagatgct atcccaggac gactaaacca aacaactcta atatccacac gacctggcct 240

ttattacgga cagtgctcag aaatctgtgg atcaaaccac agcttcatgc ccattgtact 300

tgaacttgtc ccattaaagt acttcgaaaa atggtcaaca tcaatattaa caggttcatt 360

gagaagctag tcagcact 378

<210> 11

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400> 11

ctgctatgtg tatgggttcc 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400> 12

gtagaaagac cagtccttgc 20

<210> 13

<211> 115

<212> DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400> 13

ctgctatgtg tatgggttcc atccacccca gattgaaatc gatttgctga agaatgggga 60

gaagattaaa tcggagcagt cagacctgtc tttcagcaag gactggtctt tctac 115

<210> 14

<211> 18

<212> DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400> 14

gctaatcagc ccatgctc 18

<210> 15

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400> 15

ttgactttgt ttggagtgct 20

<210> 16

<211> 42

<212> DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400> 16

tccagctaca atagatgctc cgacacataa ctgtgctgtc at 42

<210> 17

<211> 43

<212> DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400> 17

gcatcttgag caccagcata aagtggtggt agatatttaa ggg 43

<210> 18

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400> 18

atagctgagt ccaagcatcc 20

<210> 19

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400> 19

cagtcaatgg tcacaggaca 20

<210> 20

<211> 330

<212> DNA

<213> Artificial Synthesis (Artificial Synthesis)

<400> 20

gctaatcagc ccatgctcac acataactgt gctgtcatac atttggtatt tttttatttt 60

gggggatgct tggactcagc tatggccgtc aaaggccctg acccggagca tctattgtag 120

ctggacttaa ctgcatcttg agcaccagca taatgataag catggacatt acagtcaatg 180

gtcacaggac ataaattata ttatatatcc ccccttcata aaaatttccc ccttaaatat 240

ctaccaccac ttttaacaga cttttcccta gatacttatt taaatttttc acgctttcaa 300

tactcaattt agcactccaa acaaagtcaa 330

Claims

1. A lysate for extracting meat nucleic acid is characterized in that the lysate is obtained by dissolving sodium chloride, sodium dodecyl sulfate, ethyl phenyl polyethylene glycol and polyvinylpyrrolidone in water and mixing; the concentration of each component in the mixed solution is respectively as follows:

sodium chloride: 0.2 to 1.5M,

sodium dodecyl sulfate: 0.01 to 1g/ml,

ethyl phenyl polyethylene glycol: 0.01 to 0.5g/ml,

polyvinylpyrrolidone: 0.01g/ml to 0.1 g/ml.

2. The lysis solution according to claim 1, wherein the concentration of the sodium chloride in the mixed solution is 0.3 to 1M.

3. The lysis solution according to claim 1, wherein the concentration of the sodium dodecyl sulfate in the mixed solution is 0.1-0.8 g/ml.

4. The lysis solution according to claim 1, wherein the concentration of the ethylphenylpolyethylene glycol in the mixed solution is 0.05 to 0.2 g/ml.

5. The lysis solution according to claim 1, wherein the concentration of polyvinylpyrrolidone in the mixed solution is 0.03 to 0.08 g/ml.

6. A method for extracting nucleic acid from meat is characterized by comprising the following steps:

(1) mixing the minced meat sample with the lysis solution of any one of claims 1-5 at room temperature, and standing for a period of time;

(2) centrifuging, and collecting supernatant to obtain nucleic acid extract.

7. The method according to claim 6, wherein the mass-to-volume ratio of the meat sample to the lysate is 2:2 to 2:6 g/ml.

8. The method according to claim 6, wherein the standing time of the step (1) is 1-5 min.

9. The method of claim 6, wherein the centrifugation speed is 8000rpm to 15000 rpm.

10. The method of claim 6, wherein the centrifugation time is 1 min.