WO2019017452A1 - Method for detecting presence or absence of non-enveloped rna virus - Google Patents

Abstract

The present invention relates to a method for detecting the presence or absence of a non-enveloped RNA virus in a sample derived from a specimen discharged by a living organism. According to the present invention, the time and cost required for separating and purifying a nucleic acid before a nucleic acid amplification reaction can be reduced, and the risk of sample loss and carry-over can be lowered. The benefits exhibited by the present invention are particularly significant in tests processing several specimens of feces samples.

Description

Method for detecting the presence or absence of non-enveloped RNA virus

The present invention relates to a method for detecting RNA virus. The present invention can also be used for life science research, clinical diagnosis, food hygiene inspection, environmental inspection and the like.

Nucleic acid amplification is a technology that amplifies several copies of a target nucleic acid to detectable levels, that is, hundreds of millions of copies, and is not only in the field of life science research, but also in the medical field such as gene diagnosis and clinical examination, or in food and the environment. Are also widely used in the field of microbial testing and the like.

The samples to be tested using the nucleic acid amplification method vary depending on the purpose. In the case of detection of infectious disease-causing bacteria, specimens in which the causative bacteria are present, that is, urine, sputum, feces, blood, nasal fluid, vaginal fluid and the like. In the case of food hygiene inspection, it is food or feces and urine collected from a food handler, and in environmental hygiene inspection it is soil, river water, rain water, environmental water such as seawater, wipes from manufacturing facilities, etc. With regard to food poisoning caused by microorganisms, which have a latent period before the occurrence of characteristic symptoms, a rapid test method is required to prevent the spread of damage. It becomes a thing etc.

However, depending on the sample, a large amount of substances other than nucleic acids are contained, and in particular, separation and purification of the nucleic acid in the sample is usually required in order to efficiently perform a nucleic acid amplification reaction using an enzyme. Although there are various methods for separating and purifying the nucleic acid, basically, it comprises a step of separating the nucleic acid and other substances into a solid phase and a liquid phase and performing solid-liquid separation. For example, there is a method of separating nucleic acid into solid phase by ethanol precipitation and separating it by centrifugation, or a method of hybridizing target nucleic acid to nucleic acid on solid phase (for example, beads) and separating it by centrifugation or magnetizing agent. However, these purification methods involving separation of components in the sample are complicated and time-consuming to operate, and there is a risk of decomposition or contamination during the operation. In addition, when the nucleic acid content in the sample is low, it may not be possible to recover the amount necessary for the amplification reaction. Furthermore, although the time required for the nucleic acid amplification method is at most about several hours, if this sample nucleic acid preparation requires time, the rapidity until obtaining the result may be lost. Therefore, there has been a need for a method of amplifying a target nucleic acid by bringing a sample into a reaction solution without passing through a purification step involving separation operation into another container.

As such a method, for example, Patent Document 1 discloses a method in which an alkali-containing solution is added to a suspension supernatant of stool and a heat-treated sample is directly added to a reaction solution to carry out a nucleic acid amplification reaction. Further, Patent Document 2 discloses a method of performing a nucleic acid amplification reaction by directly adding a heat-treated sample to a reaction solution by subjecting a feces suspension supernatant solution to pectinase treatment.

In Examples of Patent Documents 1 and 2 and Non-patent Documents 1 and 2, RT-PCR is performed as a nucleic acid amplification method to detect RNA in a sample. However, in the RNA sample preparation of the above method, heat treatment is performed. Patent Document 2 describes the danger of hydrolysis of RNA due to heat treatment, but the need for heat treatment is described. Thus, in the conventional methods, the heating step has been considered essential for nucleic acid extraction and reaction inhibitor inactivation in any method.

WO2007 / 052765 Japanese Patent Application Publication No. 2015-119656

An object of the present invention is to enable detection of a target nucleic acid by a nucleic acid amplification reaction in which purification of nucleic acid from a sample is particularly unnecessary.

As a result of intensive studies, the present inventors have found a method that does not require a heat treatment step and that the nucleic acid in the sample can be subjected to an amplification reaction without purification with separation into another container. The present invention has been completed.

The representative present invention is as follows.
[1] A method for detecting the presence or absence of non-enveloped RNA virus in a sample derived from a sample to be excreted, comprising:
(A) preparing an alkaline mixture comprising a sample that may contain RNA virus;
(B) leaving the mixed solution obtained in step (a) without heating, and (c) applying the mixed solution after leaving in step (b) to a cDNA synthesis reaction,
Methods of detecting RNA viruses, including
[2] The step (a) is a step of preparing an alkaline mixed solution by adding a solution containing a strongly alkaline hydroxide to a sample possibly containing RNA virus, [1] Method described.
[3] An alkaline mixed solution by adding a solution containing a strongly alkaline hydroxide after step (a) suspends a sample possibly containing RNA virus with a solution containing a chelating agent The method according to [1] above, which is a step of preparing
[4] The method according to the above [2] or [3], wherein the strongly alkaline hydroxide is one or more selected from the group consisting of sodium hydroxide, potassium hydroxide, lithium hydroxide and calcium hydroxide .
[5] The method according to any one of the above [1] to [4], wherein the alkaline mixed solution in the step (a) contains sodium hydroxide, and the concentration of the sodium hydroxide is 20 to 70 mM. .
[6] The process according to any one of the above [1] to [5], which further comprises a step of nucleic acid amplification using the cDNA obtained in step (c) as a template as the step (d). the method of.
[7] The method according to [6] above, wherein the nucleic acid amplification in step (d) is performed by PCR.
[8] The method according to the above [6] or [7], wherein the step (c) and the step (d) are carried out in the same reaction solution.
[9] The method according to any one of the above [1] to [8], wherein the step (b) is carried out by leaving at room temperature.
[10] The method according to any one of the above [1] to [9], wherein the step (b) is carried out by leaving at 30 ° C. or less.

[11] The method according to any one of the above [1] to [10], wherein the biological elimination sample is feces.
[12] The sample according to any one of [1] to [11] above, wherein the sample possibly containing an RNA virus in step (a) is fecal suspension supernatant. Method.
[13] The method according to [12], wherein the stool suspension supernatant is prepared by suspending stool in sterile water, saline or PBS.
[14] The method according to any one of the above [1] to [13], which comprises contacting the alkaline mixture with a neutralizeable substance.
[15] The method of the above-mentioned [14], wherein the neutralizeable substance is contained in the reaction solution for carrying out the cDNA synthesis reaction in the step (c).
[16] A method for detecting the presence or absence of a non-enveloped RNA virus in a sample derived from a biological excretion sample, comprising:
(A) preparing an alkaline mixture containing a sample possibly containing RNA virus; and (b ') subjecting the mixture obtained in step (a) to a cDNA synthesis reaction without heating. ,
Methods of detecting RNA viruses, including
[17] An alkaline mixed solution by adding a solution containing a strongly alkaline hydroxide after step (a) suspends a sample possibly containing RNA virus with a solution containing a chelating agent The method according to the above [16], which is a step of preparing
[18] A kit for the method according to [1] or [16],
(I) solutions containing strongly alkaline hydroxides,
(Ii) reverse transcriptase,
(Iii) Reagent for reverse transcription reaction,
A kit comprising (iv) a thermostable DNA polymerase, and (v) a reagent for DNA polymerase chain reaction.
[19] The kit according to the above [18], further comprising (vi) a solution containing a chelating agent.

According to the present invention, the time and cost for separating and purifying nucleic acids prior to nucleic acid amplification reaction can be reduced. Furthermore, the risk that may occur when separating and purifying nucleic acids, that is, the risk of sample loss and carryover can be reduced. The effect becomes remarkable especially in the test which processes many specimens which make feces sample.

It is a figure which shows the result of pretreatment concentration and RT-PCR. In FIG. 1 to FIG. 5, the vertical axis of the graph is the Ct value. It is a figure which shows the result of pretreatment time and RT-PCR. It is a figure which shows the result of pretreatment temperature and RT-PCR. It is a figure which shows the result of RT-PCR at the time of adding a chelating agent at the time of pre-processing. It is a figure which shows the result of RT-PCR at the time of adding pretreatment temperature and a chelating agent.

Hereinafter, the present invention will be described in more detail while showing embodiments of the present invention.

The detection method of the present invention includes the step of leaving the sample rendered alkaline without heating, for example, treating it at room temperature and adding it directly to the reaction solution.

The sample to which the detection method of the present invention is applied is not particularly limited as long as it is a sample that may contain an RNA virus, but examples include samples derived from a biological excretion sample. The excremented samples include feces, urine, vomits, nasal discharge, nasal smear, saliva, saliva smear, etc. Furthermore, these excremented samples may be water (sterile water etc.), physiological saline, (PBS etc.) And the like, those suspended in a buffer solution, an organic solvent, a liquid medium, or a gel medium (for example, Calibra's medium), or a supernatant prepared from the above suspension, or the like. Examples of the living body include humans, pets, livestock, wild animals, insects and any other animals.

The stool is composed of intestinal bacteria, intestinal epithelial cells, food-derived substances and the like, and is suitable as a sample of the present invention. In addition, the biological excretion sample may be collected from the environment. Environments include any and all places where RNA viruses such as Norovirus may be present, but are not limited to the natural environment. In particular, the facility itself such as a manufacturing facility or a cooking facility, or the equipment of the facility, etc., is exemplified by the surface of any material on which RNA virus may be present. For collecting samples from these environments, wiping operations and other known methods are used.

Moreover, the sample that may contain RNA virus applied to the method of the present invention may be a biological discharge sample itself, or may be prepared by performing virus concentration, separation or other operations from a biological discharge sample. It may be a sample. Examples of concentration, separation, and other operations include monosaccharide addition, polysaccharide addition, virus adsorption substance addition, virus adsorption bacteria addition, centrifugation, dilution, precipitation, filtration, agitation, ultrasonic disruption / dispersion and the like. For example, as an example of precipitation operation, it can carry out using alcohols, such as ethanol and isopropanol.

The sample subjected to the separation operation may be, for example, in the case of stool, suspended in water (sterile water or the like), physiological saline, buffer solution or the like, and a supernatant obtained by removing solids by centrifugation.

Examples of RNA viruses to be detected by the detection method of the present invention include non-enveloped RNA viruses. Examples of non-enveloped RNA viruses include viruses belonging to the calicivirus family (Norovirus (NoV), Sapovirus (SV), feline calicivirus (FCV), etc.), group A rotavirus (RotaA), echovirus (E), Enterovirus (EV) etc. are mentioned. In addition, the feline calicivirus (FCV) mentioned above is a substitute virus widely used for evaluation of a disinfectant, a cleaning agent, etc. instead of the human norovirus (HuNoV) which can not be culture | cultivated easily.

In the present invention, a strong alkali is also referred to as a strong base, and refers to a base having a large base dissociation constant, and in a narrow sense, the degree of ionization is nearly 1 in aqueous solution to quantitatively generate hydroxide ions, The dissociation constant is about pK _b <0 (K _b > 1). Those which are water soluble and which are strong bases in aqueous solution are particularly strong alkalis. For example, the pH is 11 or more, preferably 12 or more, and more preferably 13 or more.

The strongly alkaline hydroxide used in the present invention is not particularly limited, but exemplified is a Group 1 element hydroxide or a Group 2 element hydroxide, or a mixture thereof. Alternatively, it may be a hydroxide of tetraalkylammonium. Although not particularly limited, hydroxides of lithium, sodium, potassium, rubidium or cesium, beryllium, magnesium, calcium, strontium, barium or radium hydroxide, europium, thallium hydroxide and the like are exemplified. Preferably, potassium hydroxide (KOH), sodium hydroxide (NaOH), lithium hydroxide (LiOH), or calcium hydroxide (Ca (OH) ₂ ), or a combination thereof is included. More preferably, it is NaOH.

The method of the present invention for detecting RNA virus comprises the step of contacting a sample with a solution containing, for example, a strongly alkaline hydroxide. According to the above-mentioned process, the nucleic acid contained in the RNA virus in the sample becomes detectable without heat treatment.

Step (a) is a step of preparing an alkaline mixture containing a sample that may contain RNA virus.
As a specific method for preparing an alkaline mixed solution, for example, a method of adding a solution containing a strongly alkaline hydroxide to a sample possibly containing an RNA virus can be mentioned. The concentration of the hydroxide in the strongly alkaline hydroxide solution in this case may be appropriately adjusted according to the mixing ratio with the sample, but as the final concentration of the hydroxide in the “alkaline mixed liquid” after mixing, Preferably, it is 10 mM to 100 mM, more preferably 20 mM to 70 mM, still more preferably 30 mM to 60 mM, still more preferably 30 to 40 mM. When two or more strongly alkaline hydroxides are used, it is preferable that the total concentration of the respective hydroxides satisfies the above range.

For example, when the alkaline mixture in step (a) contains sodium hydroxide, the concentration of sodium hydroxide is preferably 20 to 70 mM, more preferably 30 to 40 mM.

The mixing ratio of the sample and the strongly alkaline hydroxide solution is also not particularly limited, but the mixing ratio of the sample and the strongly alkaline hydroxide solution is preferably 1: 9 to 1: 3, more preferably 1: 6 to 1: 4. , Particularly preferably 1: 5.

In the present specification, "solution" means "aqueous solution" unless otherwise noted.

In the method of the present invention, means for preventing RNA degradation may be added upon contact with a strongly alkaline hydroxide. The means for preventing RNA degradation is not particularly limited, and includes means for inhibiting ribonuclease (RNase) activity, and examples include RNase inhibitor and chelating agents for metal ions necessary for activation of RNase. Specific examples of RNase inhibitor include Recombinant RNase Inhibitor (2313A manufactured by Takara Bio Inc.). The chelating agent and RNase inhibitor can be added as an aqueous solution or a solution of a known buffer.

As the chelating agent, those which are multidentately coordinated around a target metal ion are preferable. For example, those which are hexadentately coordinated can be suitably used, and examples thereof include aminocarboxylic acid type and phosphonic acid type. As chelating agents of aminocarboxylic acid type, ethylenediaminetetraacetic acid (EDTA), cyclohexanediaminetetraacetic acid (CDTA), glycol ether diamine tetraacetic acid (EGTA), nitrilotriacetic acid (NTA), diethylenetriaminepentaacetic acid (DTPA), hydroxyethyl There are ethylenediaminetriacetic acid (HEDTA), triethylenetetraamine hexaacetic acid (TTHA), glutamic acid diacetic acid (GLDA), dihydroxyethyl glycine (DHEG) and the like. Examples of phosphonic acid chelating agents include hydroxyethane diphosphonic acid (HEDP), methylene phosphonic acid (NTMP), phosphonobutane tricarboxylic acid (PBTC), ethylene diamine tetramethylene phosphonic acid (EDTMP) and the like. In addition, any chelating agent that inhibits ribonuclease activity such as citric acid, oxalic acid, phytic acid, gluconic acid and the like can be used in the present invention. Also, a plurality of chelating agents may be used in combination.

The concentration when using RNase inhibitor can be a known concentration applied to inhibit ribonuclease activity.

The concentration when using a chelating agent is not particularly limited as long as it is an effective concentration for inhibition of ribonuclease activity in a sample or detection of RNA in a sample. For example, in the alkaline mixed solution, the final concentration of the chelating agent is preferably 1 mM or more, more preferably 2 mM or more, still more preferably 3 mM or more, still more preferably 4 mM or more. On the other hand, from the viewpoint of cost effectiveness, the final concentration of the chelating agent in the alkaline mixed solution is preferably 20 mM or less, more preferably 15 mM or less, and still more preferably 10 mM or less. It is also possible to use a plurality of types of chelating agents, in which case it is preferable that the total concentration of each chelating agent satisfies the above upper limit value or lower limit value.

For example, when a stool suspension containing 10% (w / v) stool is treated with a strongly alkaline hydroxide and EGTA, the final concentration of EGTA in the alkaline mixture is 2 mM to 50 mM, preferably 4 mM to 40 mM More preferably, 6 mM to 30 mM, still more preferably 8 mM to 20 mM, particularly preferably 9 to 15 mM. The concentration of EGTA in the alkaline mixture may be adjusted appropriately according to the concentration of the stool suspension. For example, when the concentration of the stool suspension is 20% (w / v), it is desirable to make the final concentration of EGTA twice the concentration described above.

In addition, when EDTA is used as a chelating agent in the treatment of the above fecal suspension, the final concentration of EDTA in the alkaline mixture containing the sample is 1 mM to 45 mM, preferably 2 mM to 35 mM, more preferably Is 3 mM to 25 mM, more preferably 4 mM to 15 mM. The concentration of EDTA in the alkaline mixture may be appropriately adjusted depending on the concentration of the stool suspension. When the concentration of the stool suspension is 20% (w / v), it is desirable to make the final concentration of EDTA twice the concentration described above.

The RNA virus of the present invention can be prepared by preparing in advance a solution containing the above-mentioned strongly alkaline hydroxide and, if desired, a means for inhibiting ribonuclease activity (herein also referred to as “pretreatment solution”). In the detection method, the treatment of “a sample possibly containing RNA virus”, in other words, pretreatment of complementary DNA (cDNA) synthesis of viral genomic RNA can be conveniently performed. The concentration of the strongly alkaline hydroxide or ribonuclease activity inhibiting means in the pretreatment solution may be determined in consideration of the mixing ratio between the pretreatment solution and the sample.

The shape of the "sample possibly containing RNA virus" applied to the method of the present invention is not particularly limited, but in the case of a solid sample like feces or in the case of a biodischarge sample accompanied by viscosity, It is preferable to handle the prepared suspension of biological excretion sample as a sample. As the suspension, one containing a biological excretion sample of 20% (w / v) or less is preferable. More preferably, it is 1% (w / v) to 20% (w / v), more preferably 1% (w / v) to 10% (w / v). Furthermore, the above-mentioned suspension, for example, the supernatant of fecal suspension may be used as a sample.

In the present invention, a sample prepared from a single sample or a sample prepared from a single sample may also be a sample prepared from a mixture of X type (X represents an integer of 2 or more) samples. For example, when the sample is feces, the sample of type X may be stool from an individual of type X or stool of type X excreted by the same individual. The type of X is not particularly limited. For example, in the case of inspection of three bacterial species (enterohemorrhagic E. coli, salmonella and Shigella), it is common in the food inspection industry to mix 50 specimens. , Can be helpful. However, when the purpose of detection is norovirus, there is a virus epidemic period, and mixing too many samples will return cost and increase the number of tests. For this reason, it is preferable to appropriately adjust the number of samples to be mixed, for example, by referring to the past positive rate. For example, 40 or less, preferably, 30 or less, more preferably, 20 or less, still more preferably, 10 or less, particularly preferably, a mixture of 5 or less samples, or prepared from the mixed sample The sample is subjected to the method of the present invention.

For mixing of the sample and the pretreatment liquid, stirring, spin down, inversion mixing, pipetting and the like are used, but the method and container used are not limited.

The pretreatment liquid may contain a known substance added for the purpose of improving the reactivity and the like. Examples of the substance to be added include a protein such as bovine serum albumin (BSA), a surfactant such as Tween-20, betaine, an acidic polymer, and the like, but are not limited thereto.

The reducing agent may or may not be contained in the alkaline mixture.

Thus, one of the preferred embodiments of step (a) is by suspending a sample possibly containing RNA virus in a solution containing a chelating agent and then adding a solution containing a strongly alkaline hydroxide. It is a process of preparing an alkaline mixed solution.

The step (b) is a step of leaving the mixed solution obtained in the step (a) without heating and also referred to as "pretreatment".
Unlike the prior art, the alkaline mixed solution obtained by mixing the sample and the pretreatment solution can obtain sufficiently accurate results even if it is left without heating.
In the present invention, it is possible to carry out at room temperature with either only the alkaline solution or the combination of the above-mentioned chelating agent and the alkaline solution. Thus, one of the preferred embodiments of step (b) is to carry out step (b) by standing at room temperature. Here, room temperature refers to the ambient temperature at which workers can easily work. The temperature at which the mixed solution is allowed to stand is preferably 30 ° C. or less, more preferably 25 ° C. or less. The treatment time, ie, the standing time is not particularly limited, and after adding the alkaline mixed solution, it may be immediately subjected to RT-PCR, or may be held for 2 to 60 minutes before being subjected to RT-PCR, the number of samples It can adjust suitably according to. There is no big difference in the reaction depending on the retention time.

Further, working at a low temperature using a cooling block, crush ice or the like is effective in enhancing the reproducibility of the test since the temperature conditions of the standing step can be made the same. Moreover, you may implement a process (b) by leaving a liquid mixture in a refrigerator or a refrigerator compartment. Therefore, the preferable temperature range in this step is about 0 ° C. to 30 ° C. The temperature range in this step is more preferably 0 ° C. to 25 ° C., still more preferably 0 ° C. to 20 ° C., still more preferably 0 ° C. to 15 ° C., still more preferably 0 ° C. to 10 ° C., more preferably 0 ° C. ~ 5 ° C. The treatment time is not particularly limited, and after adding the alkaline mixed solution, it may be immediately subjected to RT-PCR, or may be held for 2 to 60 minutes before being subjected to RT-PCR, depending on the number of samples. It can be adjusted appropriately. In addition, when the alkaline mixed solution containing the sample contains a chelating agent, sufficiently accurate results can be obtained without the cooling.

As described above, when the standing time in step (b) is 0, that is, immediately after adding the alkaline mixed solution to the cDNA synthesis reaction, step (b) and step (c) are integrated. become. In this embodiment, (a) preparing an alkaline mixture containing a sample possibly containing RNA virus, and (b ') cDNA obtained without heating the mixture obtained in step (a) Also included in the method of the present invention is a method for detecting an RNA virus, which comprises the step of subjecting to a synthesis reaction. In this case, the step (c) can be carried out by adding a component such as a reverse transcriptase described later to the mixed solution obtained in the step (a).

One of the preferred embodiments of the method including the step (a) and the step (b ') is that the step (a) is carried out after suspending a sample possibly containing RNA virus in a solution containing a chelating agent. This is a step of preparing an alkaline mixed solution by adding a solution containing a strongly alkaline hydroxide.

Step (c) is a step of subjecting the mixture after leaving in step (b) to a cDNA synthesis reaction.
The alkaline mixed solution containing the sample treated in step (b) as described above (herein also described as “sample after pretreatment”) is subjected to reverse transcription reaction and contained in the mixed solution. DNA (cDNA) complementary to the RNA can be synthesized. In a preferred embodiment of the present invention, it is not necessary to perform an operation or heat treatment for removing a specific component from the sample after the pretreatment before preparing a reverse transcription reaction solution containing the sample after the pretreatment.

In the method of the present invention, the addition ratio of the sample after the pretreatment is not limited when it is used for reverse transcription, and it may be a rate at which reverse transcription can be appropriately performed. For example, the sample after pretreatment is added to the reverse transcription reaction solution in the range of 1 to 30% (v / v). For example, when One-Step RT-PCR is performed in a reaction solution with a volume of 25 μL, 0.5 to 6 μL of the sample after pretreatment is added.

An example of the reaction solution composition of the reverse transcription reaction includes one containing a reverse transcription primer having a sequence complementary to the RNA to be detected, salts, deoxyribonucleotides (dNTP), reverse transcriptase, and a buffer. As the salts, MgCl ₂ , KCl, etc. are used, but divalent metal ions (generally, Mg ²⁺ ions) are essential for reverse transcriptase activity. Adjustment of the final concentration of salts or change to other salts may be performed as appropriate. When the alkaline mixture contains a chelating agent, metal ions consumed by the chelating agent may be supplemented to the reverse transcription reaction solution. For example, in the case of EDTA which is bound to a divalent metal ion at a molar ratio of 1 to 1, Mg ²⁺ ion may be added to the reverse transcription reaction liquid in consideration of the amount of EDTA carried into the reverse transcription reaction liquid. Furthermore, other components capable of coexisting in the reverse transcription reaction may be added.

The reverse transcriptase used in this step is not particularly limited, and any known reverse transcriptase can be used. Specific examples of reverse transcriptase include Tth DNA polymerase from Thermus thermophilus; reverse transcriptase from mouse retrovirus such as Moloney murine leukemia virus (MMLV); and Rous associated virus (RAV) and Avian myeloblastosis virus (AMV) And reverse transcriptases from avian retroviruses.

When the sample after pretreatment is added to an enzyme reaction solution (for example, a reverse transcription reaction solution), the sample is directly added to the enzyme reaction solution if the buffer capacity of the enzyme reaction solution is an effective range. Can. When there is a concern that the pH of the enzyme reaction solution shifts to the alkaline side and the enzyme activity is reduced, the neutralization step of strongly alkaline hydroxide by contact with a neutralizeable substance, ie, mixing of alkalinity It may include contacting the liquid with a neutralizeable substance. The sample after pretreatment may be neutralized by bringing it into contact with a neutralizeable substance, but it is more preferable to add a neutralizeable substance to the enzyme reaction solution in terms of simplification of the procedure.

The neutralizable substance used here is not particularly limited as long as it is an acidic substance which does not inhibit the enzyme reaction, and, for example, any organic acid or inorganic acid can be used. Specific examples of the substance that can be neutralized include, for example, formic acid, acetic acid, citric acid, oxalic acid, succinic acid, lactic acid, sulfuric acid, hydrochloric acid, nitric acid, phosphoric acid, boric acid and the like. The range of the pH of the mixture after contact with the neutralizeable substance is preferably 6.0 to 8.0, more preferably 6.5 to 7.5.

The reverse transcription reaction solution may contain a known substance added for the purpose of improving the reactivity and the like. Examples of the substance to be added include a protein such as bovine serum albumin (BSA), a surfactant such as Tween-20, betaine, an acidic polymer, and the like, but are not limited thereto. In addition, although dNTP is normally used in four types of dATP, dGTP, dCTP and dTTP, dUTP may be further added to the reaction solution in order to prevent contamination of the PCR amplification product as a template for other nucleic acid amplification reactions. . The nucleic acid amplification product obtained in this reaction will be incorporated with dUTP, and the aforementioned nucleic acid amplification can be carried out by causing Uracil-N-glycosyrase (UNG) having the activity of degrading uracil-containing DNA to act before the nucleic acid amplification reaction. It can disassemble things. In this way, it is possible to prevent contamination resulting from the amplification product obtained in the previously performed reaction from being mixed into the later reaction.

Step (d) is a step of nucleic acid amplification using the cDNA obtained in step (c) as a template.
In the method of the present invention, nucleic acid amplification using the obtained cDNA as a template can be used to detect a trace amount of viral genomic RNA. Therefore, in the present invention, it is more preferable to further include the step (d).

Although the nucleic acid amplification method used in step (d) is not particularly limited, a method of synthesizing complementary DNA (cDNA) of RNA by reverse transcription reaction (RT) to amplify the cDNA, such as RT-LAMP method or the like RT-PCR can be used. There is also a two-step method in which the reverse transcription reaction and the DNA amplification reaction are carried out with independent reaction solutions, but in the present invention, the reaction composition of one reaction solution, ie, the reverse transcription reaction and the DNA amplification reaction, is simplified in terms of simplification of work. The One-Step method which is possible with the same reaction solution is preferred. That is, in the one-step method, it is one of the features that the step (c) and the step (d) proceed in the same reaction solution.

In the method of the present invention, the addition ratio of the sample after the pretreatment or the solution obtained through the step (c) is not limited when used for nucleic acid amplification, as long as nucleic acid synthesis can be appropriately performed. good. For example, the sample after pretreatment or the solution obtained through step (c) is added in the range of 1 to 30% (v / v) in the reaction solution. For example, when One-Step RT-PCR is performed with a reaction solution having a volume of 25 μL, 0.5 to 6 μL of the sample after pretreatment or the solution obtained through step (c) is added.

As an example of the reaction composition of PCR, one primer is a pair of two pairs of PCR primer pairs complementary to each other to the DNA extension product of the other primer, salts, deoxyribonucleotides, thermostable DNA polymerase and buffer There is a solution containing a solution. As the above-mentioned salts, MgCl ₂ , KCl and the like are used, but a bivalent metal ion (generally Mg ²⁺ ion) is essential for DNA polymerase activity. Adjustment of the final concentration of salts or change to other salts may be performed as appropriate. When an alkali treatment step with a pretreatment solution to which a chelating agent has been added is carried out, the metal ion consumed by the chelating agent may be replenished. For example, in the case of EDTA which is bound to a divalent metal ion at a molar ratio of 1 to 1, the amount of Mg ²⁺ ion may be adjusted in consideration of the amount of EDTA carried into the PCR reaction solution. Furthermore, other components that can be made to coexist in PCR may be added.

An oligonucleotide complementary to a nucleotide sequence possessed by the virus to be detected is preferable as the pair of PCR primer pairs. Specifically, when it is intended to detect feline calicivirus (FCV), as an example, the base sequence described in SEQ ID NO: 1 in the sequence listing and the base sequence described in SEQ ID NO: 2 It can be used as a primer pair. Alternatively, when detecting norovirus (NoV), as an example, the base sequence described in SEQ ID NO: 4 in the sequence listing and the base sequence described in SEQ ID NO: 5 are used as a pair of two pairs of PCR primers. Alternatively, the nucleotide sequence of SEQ ID NO: 7 in the sequence listing and the nucleotide sequence of SEQ ID NO: 8 can be used as a pair of PCR primer pairs. In the base sequences defined in these SEQ ID NOs, those in which one or more (preferably 2 to 5) bases are deleted, substituted or added can also be used as a primer.

The thermostable DNA polymerase is not particularly limited, and known ones can be used. For example, Taq DNA polymerase or Tth DNA polymerase belonging to family A (Pol I type), KOD DNA polymerase belonging to family B (alpha type), Pfu DNA polymerase, Pwo DNA polymerase, Ultima DNA polymerase, PrimeSTAR (registered trademark) DNA polymerase Series (HS, GXL, Max) etc. are mentioned. Two or more of these may be used in combination.

The nucleic acid amplification reaction solution may contain a known substance to be added for the purpose of improving the reactivity and the like. Examples of the substance to be added include a protein such as bovine serum albumin (BSA), a surfactant such as Tween-20, betaine, an acidic polymer, and the like, but are not limited thereto. In addition, although dNTP is normally used in four types of dATP, dGTP, dCTP and dTTP, dUTP may be further added to the reaction solution in order to prevent contamination of the PCR amplification product as a template for other nucleic acid amplification reactions. . The nucleic acid amplification product obtained in this reaction will be incorporated with dUTP, and the aforementioned nucleic acid amplification can be carried out by causing Uracil-N-glycosyrase (UNG) having the activity of degrading uracil-containing DNA to act before the nucleic acid amplification reaction. It can disassemble things. In this way, it is possible to prevent contamination resulting from the amplification product obtained in the previously performed reaction from being mixed into the later reaction.

An example of the “embodiment in which step (c) and step (d) are performed in the same reaction solution”, which is a preferred embodiment of the method of the present invention, includes RT-PCR. In the RT-PCR method, a cDNA synthesis primer can double as one primer of a PCR primer pair. There is also a case called Multiplex RT-PCR, which is a reaction including a plurality of primers for cDNA synthesis and a primer pair for PCR so as to obtain plural kinds of amplification products in one reaction.

In the RT-PCR method, a probe for detecting an amplification product may be used. For example, when detecting feline calicivirus (FCV), an oligonucleotide having the base sequence shown in SEQ ID NO: 1 in the sequence listing can be used as an example. Alternatively, when it is intended to detect norovirus (NoV), as an example, an oligonucleotide having the base sequence shown in SEQ ID NO: 6 in the sequence listing or an oligonucleotide having the base sequence shown in SEQ ID NO: 9 in the sequence listing Can be mentioned. In the base sequences defined in these SEQ ID NOs, those in which one or more (preferably 2 to 5) bases are deleted, substituted or added can also be used as a probe. Such a probe may be labeled with a known fluorescent substance and / or a fluorescence suppressing substance.

When the RT-PCR method is employed, a reaction solution for RT-PCR is prepared using the sample after pretreatment and a reverse transcriptase and the like, and steps (c) and (d) are performed using a known thermal cycler. And in the same reaction solution. The reaction solution for RT-PCR includes various components as described above, for example, a sample after pretreatment, a buffer solution, a reverse transcriptase, a PCR enzyme, a divalent metal salt, dNTPs, a reducing agent, an appropriate primer, an appropriate probe, and sterilization. Water and the like are appropriately selected and combined and prepared.

The cDNA obtained from the RNA contained in the sample, and the DNA fragment amplified and generated using the cDNA as a template are obtained by electrophoresis, melting curve method, various probe methods (Q probe, scorpion probe, hybrid probe etc.) It can be detected and identified. In addition, if it is a device equipped with a temperature raising / lowering function and a fluorescence measurement function, using TaqMan (registered trademark) probes, intercalating dyes, etc., DNA fragments generated during the reaction can be detected and identified in real time. it can. Here, by using a primer and / or a probe for reverse transcription reaction or nucleic acid amplification reaction according to the type of non-enveloped RNA virus to be detected, the non-enveloped RNA virus to be detected is specifically determined. It can be detected.

The present invention provides a kit for a method of detecting the presence or absence of the aforementioned non-enveloped RNA virus. The kit of the present invention is characterized in that it contains the strongly alkaline hydroxide as a component for processing a sample to be subjected to detection of RNA virus. Said strongly alkaline hydroxide is contained in the kit as a solution, preferably as an aqueous solution (e.g. as said pretreatment liquid). The concentration of the strongly alkaline hydroxide may be adjusted to a final concentration suitable for the method of the present invention when added to the sample, and is not particularly limited.

In addition to the solution containing a strongly alkaline hydroxide, it may be a kit containing a solution containing a means for inhibiting ribonuclease activity (eg, a chelating agent and / or RNase inhibitor). The solution containing the means for inhibiting the ribonuclease activity may be an independent component of the kit, or the solution containing the strongly alkaline hydroxide may be the component containing the means for inhibiting the ribonuclease activity. Furthermore, the kit of the present invention may contain a solution for diluting or suspending samples and various reagents.

As the kit of the present invention, one further containing a reagent for detecting RNA from the target RNA virus is suitable. As the above-mentioned reagent, a reagent for reverse transcription reaction (for example, reverse transcriptase and reverse transcription reagent) for synthesizing cDNA using RNA from the target RNA virus as a template (for example, nucleic acid for amplifying the cDNA or a part thereof) Examples of reagents for amplification reactions (eg, thermostable DNA polymerase and reagents for DNA polymerase chain reaction) are illustrated. Preferably, reagents for detecting amplified nucleic acid fragments are also exemplified. As these reagents, in addition to the above-mentioned reagents described for the method of the present invention, those used for known RNA detection techniques can be used.

More preferably, the kit of the present invention contains primers and probes for specifically detecting the target RNA virus. These primers and probes can be synthesized based on the sequence of the genomic RNA of the RNA virus.

A preferred example of the kit of the present invention is a sample pretreatment solution (eg, a solution containing a strongly alkaline hydroxide, and optionally a chelating agent and / or RNase inhibitor) and a One-Step RT-PCR reaction solution. Those containing components for preparation (eg, reaction buffer, reverse transcriptase, DNA polymerase, dNTP mixture, primers, probes etc. prepared at appropriate concentrations) are exemplified. For example, a kit in which some of the components described above are mixed can easily prepare a reaction solution.

The present invention will be specifically described by way of the following examples. The present invention is not limited to the following examples.

Example 1 Examination of basic substance concentration at alkaline treatment VR-782, Feline calicivirus purchased from American Type Culture Collection (ATCC), F-9 (Caliciviridae), feline calicivirus (FCV) with physiological saline so as to be 20 times The dilution was made into a virus suspension. Separate FCV Primer / Probe Mix was created to detect FCV. 4 μL each of 6.25, 12.5, 25, 100 mM NaOH solution was added to 1 μL of the suspension to prepare an alkaline mixed solution of NaOH at a final concentration of 5 mM, 10 mM, 20 mM, 40 mM and 80 mM. The mixture was allowed to stand at room temperature (27 ° C.) for 5 minutes and then used as a sample after pretreatment.

A reaction solution for RT-PCR of the following composition is prepared using the sample after this pretreatment and components of the TaKaRa norovirus GI / GII detection kit (for high-speed detection) (RR296A manufactured by Takara Bio Inc.). The reaction solution was immediately subjected to RT-PCR under the following reaction conditions, and quantification by Ct value was performed according to the operation manual. Two experiments were performed per NaOH solution of one concentration, and the average value of Ct values was shown in the results. The Ct value is the cycle number at which a specific fluorescence value is reached, and indicates the quantitative ratio of amplification products. That is, the smaller the Ct value, the larger the amplification amount. The product Code No. TP-990 ThermalCycler Dice (registered trademark) RealTime System III (manufactured by Takara Bio Inc.) was used as the nucleic acid amplification apparatus.

(FCV Primer / Probe Mix)
2 μM FCV detection primer CCATTGGTGCTAATAGGGAAAGG (SEQ ID NO: 1)
2 μM FCV detection primer CCACCACGAGCACCAGTTT (SEQ ID NO: 2)
2 μM FCV detection probe FAM-TGCGCATCAGCACGCTTTCCC-BHQ1 (SEQ ID NO: 3)

(Reaction solution for RT-PCR)
5.0 μL pretreated sample 12.0 μL PCR Buffer (NV) 4
2.5 μL FCV Primer / Probe Mix
1.5 μL Enzyme Mix (NV) 4
4.0 μL sterile water

(Reaction conditions)
The reaction liquid (25 μL) was reacted in the following temperature cycle.
42 ° C 5min,
95 ° C 30 sec,
95 ° C 5sec-54 ° C 30sec 45 cycles (FAM, ROX, Cy5 fluorescence detection)

The results are shown in Table 1. Although the amplification product was detected under any conditions, it showed the lowest Ct value particularly when coexisting with a final concentration of 40 mM NaOH, and good results could be obtained.

Example 2 Examination of storage time at room temperature 4 μL of 50 mM NaOH solution was added to 1 μL of the FCV suspension prepared in Example 1 to prepare 5 μL of an alkaline mixed solution of NaOH final concentration 40 mM and left at room temperature (27 ° C.) . The mixture was used as a pretreated sample.
A reaction solution for RT-PCR of the same composition as in Example 1 was prepared using the sample after this pretreatment, subjected to RT-PCR under the same reaction conditions as in Example 1, and the Ct value was determined. The following tests 1 to 6 were conducted as examination of the room temperature standing time.

In Test No. 1, after adding NaOH, PCR Buffer (NV) 4 etc. was immediately added and mixed to prepare a reaction solution for RT-PCR. Test No. 2 was left at room temperature for 1 minute after addition of NaOH, and a reaction solution for RT-PCR was similarly prepared. Test No. 3 was left at room temperature for 2 minutes after addition of NaOH, and a reaction solution for RT-PCR was similarly prepared. Test No. 4 was left at room temperature for 5 minutes after addition of NaOH, and a reaction solution for RT-PCR was similarly prepared. Test No. 5 was left at room temperature for 30 minutes after addition of NaOH, and a reaction solution for RT-PCR was similarly prepared. Test No. 6 was left at room temperature for 60 minutes after addition of NaOH, and a reaction solution for RT-PCR was similarly prepared. Under the same conditions as in Example 1, each reaction solution for RT-PCR was immediately subjected to RT-PCR, and the Ct value was determined. The experiment was performed twice per one test number, and the average value of the Ct value was shown in the result.

The results are shown in Table 2. In Tests 1 to 6, no increase in Ct value was observed even if the standing time at room temperature was increased.

Example 3 Confirmation of Reactivity by Environmental Temperature To 1 μL of the FCV suspension prepared in Example 1, 5 μL of 42 mM NaOH solution was added to prepare an alkaline mixed solution of NaOH with a final concentration of 35 mM. The mixture was allowed to stand on ice at room temperature (27 ° C.), 37 ° C., and 50 ° C. for 10 minutes, respectively, to obtain a sample after pretreatment.

A reaction solution for RT-PCR having the same composition as in Example 1 was prepared using the sample after this pretreatment and the components of the TaKaRa norovirus GI / GII detection kit (for high-speed detection) (RR296A manufactured by Takara Bio Inc.). The reaction solution was immediately prepared for RT-PCR under the same conditions as in Example 1 to obtain a Ct value. The experiment was performed twice per one temperature condition, and the average value of the Ct value was shown in the result.

The results are shown in Table 3. Particularly good results have been shown on ice at room temperature. There was no significant increase in Ct value on ice, at room temperature, at 37 ° C., or at 50 ° C.

Example 4 Detection of Viral RNA Using a Fecal Sample A norovirus positive fecal sample was suspended in PBS so as to be 5-10% (w / v), and then centrifuged at 15,000 rpm for 5 minutes. 12, 24, 42, 66, and 5 mM each of a 96 mM NaOH solution were added to 1 μL of the supernatant to prepare an alkaline mixed solution with a final NaOH concentration of 10, 20, 35, 55, 80 mM. The mixture was allowed to stand at room temperature (27 ° C.) for 5 minutes, and used as a sample after pretreatment. In addition, an NV Primer / Probe Mix was separately prepared to detect norovirus.

A reaction solution for RT-PCR of the following composition was prepared using the sample after this pretreatment and the components of the TaKaRa norovirus GI / GII detection kit (for high-speed detection) (RR296A manufactured by Takara Bio Inc.), The product was subjected to RT-PCR under the following reaction conditions to determine the Ct value.

As specimens for the test, four specimens of Norovirus GII positive specimens # 8 (GII), # 27 (GII), # 28 (GII) and Norovirus GI positive specimens # 360 (GI) were prepared and shown in the results. The product Code No. TP-990 ThermalCycler Dice (registered trademark) RealTime System III was used for nucleic acid amplification.

(NV Primer / Probe Mix)
4 μM NV detection primer CGYTGGATGCGNTTYCATGA (SEQ ID NO: 4)
4μM NV detection primer CTTAGACGCCATCATCATTYAC (SEQ ID NO: 5)
2 μM NV detection probe FAM-AGATYGCGATCYCCTGTCCA-BHQ1 (SEQ ID NO: 6)
4 μM NV detection primer CARGARBCNATGTYAAGRTGGATGAG (SEQ ID NO: 7)
4 μM NV detection primer TCGACGCCATCTTCATTCACA (SEQ ID NO: 8)
2 μM NV detection probe ROX-TGGGAGGGGSGATCGCRACTT-BHQ2 (SEQ ID NO: 9)
Norovirus GI can be detected by the combination of the primer and the probe shown in the above SEQ ID NO: 4 to 6, and norovirus GII can be detected by the combination of the primer and the probe shown above SEQ ID NO: 7 to 9 it can.
The “N” in the above-mentioned SEQ ID NO: 4 and SEQ ID NO: 7 is a symbol indicating that the base is adenine, guanine, cytosine or thymine.

(Reaction solution for RT-PCR)
6.0 μL pretreated sample 12.0 μL PCR Buffer (NV) 4
2.5 μL NV Primer / Probe Mix 4
1.5 μL Enzyme Mix (NV) 4
3.0 μL sterile water

(Reaction conditions)
The reaction liquid (25 μL) was reacted in the following temperature cycle. In addition, since fluorescence detection was not performed for the first 5 cycles, the result described Ct value which added 5 cycles.
42 ° C 5min,
95 ° C 30 sec,
95 ° C 5sec-56 ° C 40sec 5 cycles 90 ° C 5sec-56 ° C 40sec 35 cycles (FAM, ROX, Cy5 fluorescence detection)

The results are shown in FIG. Detection of the amplification product was observed in all of the samples after the pretreatment with a final concentration of 10, 20, 35, 55, 80 mM of NaOH, and a final concentration of 20 to 55 mM was found to be suitable.

Example 5 Examination of the room temperature standing time using a stool sample To 1 μL of the supernatant of the norovirus positive suspension prepared in the same manner as in Example 4, 5 μL of 42 mM NaOH solution was added to prepare an alkaline mixed solution. The mixture was allowed to stand at room temperature (27 ° C.) for 2, 5, 10, 20, and 30 minutes, respectively, to obtain a sample after pretreatment.

A reaction solution for RT-PCR having the same composition as in Example 4 was prepared using the sample after this pretreatment and components of the TaKaRa norovirus GI / GII detection kit (for high-speed detection) (RR296A manufactured by Takara Bio Inc.). It was prepared and subjected to RT-PCR under the same reaction conditions as in Example 4, and the Ct value was determined.

As samples for the test, 4 samples of Norovirus GI positive sample # 362 (GI), Norovirus GII positive samples # 8 (GII), # 27 (GII) and # 336 (GII) were prepared and shown in the results.

The results are shown in FIG. It was found that amplification was observed in all of the samples after pre-treatment after standing for 2, 5, 10, 20, 30 minutes, with 2, 5 minutes being most preferable. Also, no significant difference was found in the Ct value in 2 to 30 minutes.

Example 6 Confirmation of reactivity by environmental temperature using a fecal sample: 5 μL of 42 mM NaOH solution is added to 1 μL of the supernatant of the norovirus positive suspension prepared in the same manner as in Example 4 and alkaline mixed with a final concentration of 35 mM of NaOH The solution was prepared. The mixture was allowed to stand on ice for 2, 5, 10, 20, 30 minutes, and used as a sample after pretreatment.

A reaction solution for RT-PCR having the same composition as in Example 4 was prepared using the sample after this pretreatment and components of the TaKaRa norovirus GI / GII detection kit (for high-speed detection) (RR296A manufactured by Takara Bio Inc.). It was prepared and subjected to RT-PCR under the same reaction conditions as in Example 4, and the Ct value was determined.

As test samples, 5 samples of Norovirus GI positive sample # 360 (GI), Norovirus GII positive sample # 8 (GII), # 27 (GII), # 91 (GII) and # 360 (GII) are prepared, The results are shown.

The results are shown in FIG. Amplification was observed in all of the samples after the pretreatment after leaving at 2, 5, 10, 20 and 30 minutes, and no change in Ct due to the leaving time was observed.

Example 7 Confirm the reactivity in the case of adding a chelating agent to the method of pretreatment at room temperature and the method of pretreatment at room temperature 42 mM NaOH solution for 1 μL of the supernatant of norovirus positive suspension prepared as in Example 4 An alkaline mixture (final volume 6 μL) was prepared by adding 5 μL (final concentration of NaOH is 35 mM). On the other hand, 1 μL of 60 mM EGTA (final concentration 10 mM) is added to 1 μL of the supernatant of norovirus positive suspension and stirred to obtain a suspension, to which 4 μL of 52.5 mM NaOH solution is then added ( An alkaline mixture (final volume 6 μL) was prepared by final concentration of NaOH 35 mM). These alkaline mixed solutions were allowed to stand at room temperature (27 ° C.) for 30 minutes and then used as samples after pretreatment.

A reaction for RT-PCR having the same composition as that of Example 4 using the entire amount of the sample after this pretreatment and components of the TaKaRa norovirus GI / GII detection kit (for high-speed detection) (RR296A manufactured by Takara Bio Inc.) The solution was prepared, subjected to RT-PCR under the same reaction conditions as in Example 4, and the Ct value was determined.

In addition, it was thought that by adding a chelating agent to the pretreatment step of step (b), it acts on Mg ²⁺ ions in the RT-PCR reaction solution to affect RT-PCR. The addition amount of Mg ²⁺ ion in RT-PCR reaction solution using Norovirus GI, GII positive control and internal control included in the above kit, which confirmed no reaction inhibition. It was investigated. As a result, it was found that, under the current RT-PCR reaction conditions, the reaction was improved by adding 1 mM Mg ²⁺ ion. Therefore, when using a chelating agent in this example and subsequent examples, it was decided to add 1 mM Mg ²⁺ ion to the RT-PCR reaction solution. The other reaction conditions are the same as in Example 4.

In addition, 10 samples of Norovirus GII positive samples # 28, # 288, # 173, # 289, # 91, # 248, # 220, # 139, # 87, and # 251 are prepared as test samples, and are used as results. Indicated. The product Code No. TP-990 ThermalCycler Dice (registered trademark) RealTime System III was used for nucleic acid amplification.

The results are shown in FIG. In the figure, the white bar is the result of pretreatment with an alkaline mixture containing EGTA at room temperature and subsequent Mg ²⁺ ion replenishment in the RT-PCR reaction. The black bars are the results of pretreatment with an alkaline mixed solution containing no EGTA at room temperature. In all of the above 10 samples used in this experiment, a decrease in Ct value was observed by the addition of a chelating agent. Thus, it has been found that when EGTA is added to the pretreatment step and subjected to normal temperature treatment, the effect of reaction improvement is shown.

Example 8 Confirm the reactivity when adding a chelating agent to the method of pre-treating on ice and the method of pre-treating at room temperature 42 μM of the supernatant on 1 μL of the supernatant of the norovirus positive suspension prepared as in Example 4 5 μL of aqueous NaOH solution (final concentration 35 mM) was added to prepare an alkaline mixture (final volume 6 μL). The mixture was left on ice for 30 minutes.

On the other hand, 1 μL of 30 mM EDTA (final concentration 5 mM) is added to 1 μL of the supernatant of norovirus positive suspension at room temperature (27 ° C.) and stirred to obtain a suspension, which is then 52.5 mM 4 μL of NaOH solution was added (final concentration 35 mM) to prepare an alkaline mixture (final volume 6 μL), and the mixture was allowed to stand at room temperature (27 ° C.) for 30 minutes.

The total amount of samples after pretreatment prepared in this way and left to stand for 30 minutes under each temperature condition, and components of TaKaRa Norovirus GI / GII detection kit (for high-speed detection) (RR296A manufactured by Takara Bio Inc.) A reaction solution for RT-PCR having the same composition as in Example 4 was prepared using the above, and subjected to RT-PCR under the same reaction conditions as in Example 4 to obtain a Ct value.

When preparing an RT-PCR reaction solution with a sample after pretreatment containing EDTA, the addition amount of Mg ²⁺ ion was previously examined in the same manner as in Example 7, and 1 mM Mg ²⁺ was added to the RT-PCR reaction solution. Ions were added. The other reaction conditions are the same as in Example 4.

In addition, two types of samples, a Norovirus GII-positive specimen # 91 and a # 360 Norovirus GI / GII co-infection model, were prepared as test specimens. Two experiments were performed per sample to determine the average Ct value. The product Code No. TP-990 ThermalCycler Dice (registered trademark) RealTime System III was used for nucleic acid amplification.

The results are shown in FIG. In the figure, the white bar graph is the result of performing step (b) on ice. Black bars are the result of carrying out step (b) in the presence of EDTA at room temperature and subsequent Mg ²⁺ ion supplementation in the RT-PCR reaction. When a chelating agent was added to the method for treating on ice and the method for treating at room temperature, the results of RT-PCR showed similar reactivity.

Example 9 Timing of Chelating Agent Addition Norovirus-positive stool samples were suspended in 100 mM EGTA disodium solution to be a 10% (w / v) stool suspension. At this time, the EGTA concentration is 60 mM at the final concentration. Next, 5 μL of NaOH solution was added to 1 μL of the stool suspension. At this time, the NaOH concentration is 35 mM at the final concentration. Ct value when subjecting 6 μL of the alkaline mixture immediately to RT-PCR and Ct value when subjecting to RT-PCR after holding on room temperature (27 ° C.) or ice for 5 minutes, 15 minutes or 30 minutes respectively Compared.

The reaction solution for RT-PCR is the same as that of Example 4. Also in this example, as in Example 8, Mg ²⁺ ion was added to the RT-PCR solution so that the Mg ²⁺ ion concentration became 1 mM plus.
Four types of real samples, namely fecal samples 18-016 and 18-017 of Norovirus GI collected from subjects, and GII positive samples 18-077 and 18-078 were used as test samples.
The reaction conditions were as follows. The thermal cycler is the same as in Example 4.

42 ° C 5 min
95 ° C 30 sec (one cycle)
95 ° C 5sec-56 ° C 40sec (5 cycles)
90 ° C 5sec-56 ° C 40sec (35 cycles)
(FAM, ROX, Cy5 fluorescence detection)

The Ct values of RT-PCR were compared after they were kept for 5 minutes, 15 minutes or 30 minutes at room temperature or on ice, respectively, based on the Ct value when subjected to RT-PCR immediately after preparation of the alkaline mixed solution. Regardless of the temperature and the holding time, it was confirmed that the Ct values were almost the same as the reference Ct values. From this, even if the fecal sample is suspended in a solution containing a chelating agent first and then treated with alkali, the target non-enveloped virus can be efficiently detected regardless of the room temperature or the time of keeping on ice.

The present invention is used for food hygiene inspection, environmental inspection, clinical diagnosis and the like.

SEQ ID No: 1; PCR Forward Primer FCV gp2-F.
SEQ ID No: 2; PCR Reverse Primer FCV gp2-R.
SEQ ID No: 3; Probe FCVGP2-P. 5'-end is labeled FAM and 3'-end is labeled BHQ1.
SEQ ID No: 4; PCR Forward Primer COG1F.
SEQ ID No: 5; PCR Reverse Primer COG1R.
SEQ ID No: 6; Probe RING 1-TP (a). 5'-end is labeled FAM and 3'-end is labeled BHQ1.
SEQ ID No: 7; PCR Forward Primer COG2F.
SEQ ID No: 8; PCR Reverse Primer COG2R.
SEQ ID No: 9; Probe RING 2 AL-TP. 5 'end is labeled ROX and 3'-end is labeled BHQ2.

Claims (19)

1. A method for detecting the presence or absence of a non-enveloped RNA virus in a sample derived from a sample to be excreted, comprising:
   (A) preparing an alkaline mixture comprising a sample that may contain RNA virus;
   (B) leaving the mixed solution obtained in step (a) without heating, and (c) applying the mixed solution after leaving in step (b) to a cDNA synthesis reaction,
   Methods of detecting RNA viruses, including
2. The method according to claim 1, wherein the step (a) is a step of preparing an alkaline mixed solution by adding a solution containing a strongly alkaline hydroxide to a sample possibly containing RNA virus.
3. Step (a) prepares an alkaline mixture by adding a solution containing a strongly alkaline hydroxide after suspending a sample possibly containing RNA virus in a solution containing a chelating agent The method according to claim 1, which is a step.
4. The method according to claim 2 or 3, wherein the strongly alkaline hydroxide is one or more selected from the group consisting of sodium hydroxide, potassium hydroxide, lithium hydroxide and calcium hydroxide.
5. The method according to any one of claims 1 to 4, wherein the alkaline mixture in step (a) contains sodium hydroxide, and the concentration of sodium hydroxide is 20 to 70 mM.
6. The method according to any one of claims 1 to 5, further comprising the step of nucleic acid amplification using the cDNA obtained in step (c) as a template as step (d).
7. 7. The method of claim 6, wherein the nucleic acid amplification in step (d) is performed by PCR.
8. The method according to claim 6 or 7, wherein step (c) and step (d) are performed in the same reaction solution.
9. A method according to any one of the preceding claims, characterized in that step (b) is carried out by standing at room temperature.
10. The method according to any one of claims 1 to 9, characterized in that step (b) is carried out by leaving at 30 属 C or less.
11. The method according to any one of claims 1 to 10, wherein the biological excretion sample is feces.
12. A method according to any one of the preceding claims, characterized in that the sample potentially containing the RNA virus in step (a) is a fecal suspension supernatant.
13. 13. The method according to claim 12, wherein the stool suspension supernatant is prepared by suspending stool in sterile water, saline or PBS.
14. A method according to any one of the preceding claims, characterized in that the alkaline mixture is brought into contact with a neutralizeable substance.
15. The method according to claim 14, wherein the neutralizeable substance is contained in a reaction solution for carrying out the cDNA synthesis reaction in step (c).
16. A method for detecting the presence or absence of a non-enveloped RNA virus in a sample derived from a biological excretion sample, comprising:
    (A) preparing an alkaline mixture containing a sample possibly containing RNA virus; and (b ') subjecting the mixture obtained in step (a) to a cDNA synthesis reaction without heating. ,
    Methods of detecting RNA viruses, including
17. Step (a) prepares an alkaline mixture by adding a solution containing a strongly alkaline hydroxide after suspending a sample possibly containing RNA virus in a solution containing a chelating agent The method according to claim 16, which is a step.
18. 17. A kit for the method of claim 1 or 16 wherein
    (I) solutions containing strongly alkaline hydroxides,
    (Ii) reverse transcriptase,
    (Iii) Reagent for reverse transcription reaction,
    A kit comprising (iv) a thermostable DNA polymerase, and (v) a reagent for DNA polymerase chain reaction.
19. The kit according to claim 18, further comprising (vi) a solution containing a chelating agent.

Images