CN109280668B

CN109280668B - Tobacco amino acid transporter gene NtTAT and application thereof

Info

Publication number: CN109280668B
Application number: CN201811196540.6A
Authority: CN
Inventors: 雷波; 赵会纳; 蔡凯; 丁福章; 潘文杰
Original assignee: Guizhou Institute of Tobacco Science
Current assignee: Guizhou Institute of Tobacco Science
Priority date: 2018-10-15
Filing date: 2018-10-15
Publication date: 2021-11-23
Anticipated expiration: 2038-10-15
Also published as: CN109280668A

Abstract

The invention belongs to the technical field of plant genetic engineering, and discloses a tobacco amino acid transporter gene NtTAT and application thereof, wherein the tobacco amino acid transporter gene NtTAT comprises the following components: cloning an amino acid transporter gene NtTAT; constructing an NtTAT gene interference vector; expression characteristics of the interfered NtTAT gene and influence on the amino acid content of the tobacco leaves; and (4) determining the amino acid content of homozygous transgenic offspring. In the NtTAT interference homozygous strain, the amino acid content is obviously increased by 5 (valine, proline, threonine, phenylalanine and the like), wherein the proline is changed maximally and is increased by 13 times, and the content of the valine, the threonine and the phenylalanine is increased; the NtTAT influences the metabolic genes of the amino acids through the change of the amino acid transport capacity, so that the content of the amino acids such as valine, proline, threonine and phenylalanine in the tobacco leaves is improved, and the quality of the tobacco leaves is further influenced.

Description

Tobacco amino acid transporter gene NtTAT and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a tobacco amino acid transporter gene NtTAT and application thereof.

Background

Currently, the current state of the art commonly used in the industry is such that: nicotiana, family Solanaceae, an annual or limited perennial herbaceous plant with a slightly lignified base. The inflorescence grows at the top, is conical and has a plurality of flowers; the shape of the capsule is egg-shaped or rectangular, and the length is approximately equal to the length of the persistent calyx. Blossoming and bearing fruit in summer and autumn. Tobacco prefers warm and sunny environment and fertile loose soil, and is drought-resistant and cold-resistant. They are warm and warm in the yang environment, and are not cold-resistant and heat-resistant. Mainly distributed in south america, south asia and china. Amino acids are important chemical substances in tobacco, enzymatic and non-enzymatic browning reactions can occur between free amino acids and reducing sugars in the processes of tobacco modulation, alcoholization or fermentation, processing and combustion to generate various pyran, pyrazine, pyrrole, pyridine and other heterocyclic compounds with the characteristics of cooking, roasting and popcorn flavor, and certain amino acids such as phenylalanine can be self-decomposed into flavor compounds such as benzyl alcohol, phenethyl alcohol and the like. The amino acid content has a close relationship with the taste of tobacco products, the amino acid generally forms a nitrogen-containing compound with irritation in the combustion and cracking process, the nitrogen-containing compound has adverse effects on the taste of smoke fragrance, and individual amino acid also generates HCN and other smoke components harmful to health. Generally, the amino acid content is too high, and the smoke is spicy, bitter and strong in irritation; when the content is too low, the smoke is flat, tasteless and lack of fullness. Although the unknown functional gene can be predicted by bioinformatics method, the final function of the gene is still determined by biology. With the development of molecular biology, methods such as gene transduction, antisense technology, RNA interference, gene interference technology, etc. are used for identifying plant gene functions. Therefore, how to develop a gene capable of regulating the content of amino acids in tobacco leaves is a technical problem to be solved urgently by those skilled in the art.

In summary, the problems of the prior art are as follows: how to develop a gene capable of regulating the content of amino acids in tobacco leaves is a technical problem to be solved urgently by the technical personnel in the field. The gene of the present invention is not currently available.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a tobacco amino acid transporter gene NtTAT and application thereof.

The tobacco amino acid transporter gene NtTAT has the nucleotide sequence of SEQ ID NO. 1.

Another object of the present invention is to provide a protein encoded by the tobacco amino acid transporter gene NtTAT, the amino acid sequence of the protein is SEQ ID NO. 2.

The invention also aims to provide an application of the tobacco amino acid transporter gene NtTAT in regulating the amino acid content composition of tobacco leaves.

In summary, the advantages and positive effects of the invention are: successfully amplifying cDNA of the NtTAT gene; the NtTAT cDNA positive clone is subjected to sample sequencing, and the coding region (including a stop codon) of the cDNA gene of the NtTAT is 1278bp in total and completely consistent with the predicted splicing mode. The physicochemical properties of the NtTAT protein show that the NtTAT gene codes 425 amino acid residues, the molecular weight of the coded protein is 46.56kD, the theoretical isoelectric point pI is 8.26, and in all the amino acid residues, 30 basic amino acids account for 7.00 percent of the whole coded protein, 27 acidic amino acids account for 6.3 percent of the whole coded protein, 194 hydrophobic amino acids account for 45.6 percent of the whole coded protein, and 95 polar amino acids account for 22.3 percent of the whole coded protein. From the amino acid composition, leucine content was highest (14.12%), followed by valine (10.12%) glycine (8.94%) and serine (8.00%) in the entire encoded protein. The NtTAT protein can be subjected to posttranslational modification and subcellular localization, and can be phosphorylated by the kinases, so that the function of the NtTAT protein can be regulated. The protein has 7 possible glycosylation modification sites of lysine epsilon amino group (K2, K114, K233, K344, K469), and NetNGlyc 1.0 predicts that the NtTAT protein has 2N-glycosylation sites (N-glycosylation sites) at amino acid 146 (NLSI) and amino acid 151 (NPSP). The transmembrane region and the topological structure of the NtTAT are predicted, and analysis by different methods proves that the NtTAT is a transmembrane protein. Protein secondary structure prediction, calculating the composition of the NtTAT secondary structure, wherein the alpha-helix accounts for 49.65% at most, and the random coil accounts for 29.18% at the second time; the extended strand and β -sheet were only 18.12% and 3.06%, respectively. The result of the analysis and function prediction of the conserved domain of the NtTAT protein shows that the protein has a transmembrane amino acid transporter superfamily functional domain; the Interpro scan results show that the NtTAT protein has a functional domain of the amino acid transporter superfamily. Constructing an NtTAT gene interference vector, amplifying left and right arms of an NtTAT interference fragment by using an ITATLF + ITATLR primer and an ITATRF + ITATRR primer respectively, and obtaining a target fragment with an expected size by electrophoretic display. Then, carrying out gel recovery on the specific fragment; and loading the target fragment into an interference vector, sequencing and identifying the positive plasmid, and obtaining the interference vector pSVM-iTAT with correct sequence. Transgenic and offspring breeding are carried out, and T0 generation seeds are finally obtained. Detecting positive strains of transgenic T1 generation and identifying homozygous strains, and detecting by using a primer HF/R to obtain 12 strains of NtTAT interference positive strains; antibiotic screening is carried out on the 12 seeds to obtain 6 homozygote plants in total; the control group K326 died in the screening medium, and all the offspring of the detected positive homozygote can grow normally. RT-qPCR analysis of the homozygous transgenic progeny target gene shows that the target gene in all 6 homozygous plants is down-regulated, wherein the homozygous plant with the number of 1 has the lowest expression, and only 1/10 of the expression quantity of the corresponding gene in the wild K326 is needed, thereby indicating successful interference on the target gene. The content of amino acids in homozygous transgenic offspring is measured, in the NtTAT interference homozygous strain, the measured amino acids have 5 types (valine, proline, threonine, phenylalanine and the like) with the content obviously increased (more than 1.5 times of the reference), wherein the proline changes the most and is increased by nearly 13 times, and the other content changes are not large, so that the interference of the NtTAT gene improves the content of the amino acids such as valine, proline, threonine, phenylalanine and the like in the tobacco leaves, and the metabolism of the amino acids can be influenced through the change of the amino acid transport capacity, and the quality of the tobacco leaves is influenced.

Drawings

FIG. 1 is a flow chart of a method for determining the function of the tobacco amino acid transporter NtTAT provided in the embodiments of the present invention.

FIG. 2 is a schematic diagram of a full-length cDNA amplified fragment of the NtTAT gene provided in an embodiment of the invention.

FIG. 3 is a schematic diagram of the phosphorylation site analysis of serine, threonine and tyrosine kinases for NtTAT provided by the embodiments of the present invention.

FIG. 4 is a schematic diagram of the glycosylation site analysis of NtTAT provided in the examples of the present invention.

Fig. 5 is a schematic diagram of a transmembrane region prediction of the TMpred prediction NtTAT according to an embodiment of the present invention.

Fig. 6 is a schematic diagram of prediction of the secondary structure of NtTAT according to an embodiment of the present invention.

FIG. 7 is a schematic diagram of the NtTAT protein Domain Search (NCBI Conserved Domain Search) provided in the examples of the present invention.

FIG. 8 is a schematic diagram of an Interpro scan search for the NtTAT protein domain provided by an embodiment of the invention.

FIG. 9 is a schematic diagram of left and right amplification of NtTAT provided by an embodiment of the invention.

Fig. 10 is a schematic diagram of left arm loading enzyme digestion detection of NtTAT according to an embodiment of the present invention.

FIG. 11 is a schematic diagram of RT-qPCR analysis of NtTAT interference homozygous strains provided by the embodiments of the present invention.

FIG. 12 is a schematic representation of the amino acid content of intervening progeny of NtTAT provided by embodiments of the invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

The following detailed description of the principles of the invention is provided in connection with the accompanying drawings.

As shown in fig. 1, the method for determining the function of the tobacco amino acid transporter NtTAT provided by the embodiment of the present invention comprises the following steps:

s101: cloning an amino acid transporter gene NtTAT;

s102: constructing an NtTAT gene interference vector;

s103: expression characteristics of the interfered NtTAT gene and influence on the amino acid content of the tobacco leaves.

In a preferred embodiment of the present invention, in step S101, a specific method for cloning the amino acid transporter gene NtTAT provided in the embodiments of the present invention includes:

1) extraction of total RNA from tobacco leaves

Taking K326 young leaves as a material, and extracting total RNA by using a method provided by a small-amount plant tissue RNA extraction kit;

2) obtaining of tobacco leaf Total cDNA

Taking 1 mu g of a K326 young leaf total RNA sample as a template, and carrying out reverse transcription by adopting an Oligo dT-adapter Primer, wherein a product after the reverse transcription is total cDNA;

the reverse transcription conditions were: 40min at 42 ℃, 30min at 50 ℃, 5min at 99 ℃ and 5min at 5 ℃;

extraction of total DNA from tobacco genome Using the EasyPure Plant Genomic DNA Kit reference manual.

3) Cloning of tobacco NtTAT Gene

Designing primer TAT-F (5' -gc) for amplifying full-length cDNA sequence of NtTAT gene according to cDNA predicted sequence of SGN-U427096TCTAGAatggggtttgagaaagacaaggcaag-3', XbaI cleavage site underlined, 2 lowercase letters as protecting bases) and

TAT-R(acGAGCTCTCAAGCTTTGACTCCAAAGATCTG, the SacI cleavage site is underlined, 2 lowercase letters are the protecting bases);

amplifying TAT full-length cDNA by using 1 mu L of a first chain of tobacco young leaf cDNA as a template and adopting a standard 50 mu L Taq PCR reaction system;

the parameters for PCR amplification of cDNA were as follows: pre-denaturation at 94 deg.C for 4min, 35 cycles (denaturation at 94 deg.C for 1min, annealing at 58 deg.C for 1min, and extension at 72 deg.C for 2min), and keeping the temperature at 72 deg.C for 10 min; recovering the obtained PCR product gel, and sequencing;

4) bioinformatics analysis

The assembly of sequencing sequences, sequence multiple alignment, ORF (open reading frame) search and translation, basic properties of proteins and the like are analyzed on vector NTI Advance 9.0 software;

BLAST analysis of nucleic acids and proteins and Conserved Domain (Conserved Domain) search of protein sequences were performed at the NCBI (http:// www.ncbi.nlm.nih.gov) website;

the post-transcriptional modification prediction, the secondary structure prediction and the tertiary structure prediction of the protein are mainly carried out by bioinformatics online analysis software provided by an Expasy (http:// www.expasy.org) website;

in order to obtain more comprehensive bioinformatics analysis results, supplementary analysis was also performed through websites such as http:// www.cbs.dtu.dk/services/, and SoftBerry (http:// www.softberry.com).

In a preferred embodiment of the present invention, in step S102, the construction of the NtTAT gene interference vector provided in the embodiment of the present invention specifically includes:

(1) extraction of total DNA from tobacco leaves

Taking K326 young leaves as a material, and extracting total DNA according to a method provided by a small-amount plant tissue DNA extraction kit;

(2) construction of interference vectors

Taking tobacco young leaf DNA as a template, and adopting a standard 50 mu L Taq PCR reaction system to amplify corresponding target fragments of each gene; the parameters for PCR amplification of cDNA were as follows: pre-denaturation at 94 ℃ for 4min, 35 cycles (denaturation at 94 ℃ for 1min, annealing at 58 ℃ for 1min, extension at 72 ℃ for 2min), and heat preservation at 72 ℃ for 10 min. After the PCR gel is digested and the product and related plasmids are recovered, connecting and converting escherichia coli, selecting positive bacterial plaque, and carrying out digestion and sequencing verification; the sequences of all primers for gene interference vector construction are shown in Table 1;

table 1: primer for amplification of hairpin structure

(3) Functional verification of NtTAT gene

The measured sequence is correctly assembled and is compared with the actual sequence to finally determine the target bacterial plaque, and plasmids are extracted and transferred into agrobacterium tumefaciens GV3101 for later use.

(1) The transgenic method comprises the following steps:

preparing a tobacco sterile seedling: sterilizing tobacco seeds and putting the tobacco seeds into 1/2MS culture bottles for germination; then transplanting 2-3 plants into a new 1/2MS culture bottle according to each bottle to grow under the normal tissue culture light temperature condition;

a transgenic step:

a10 mL YEB (YEP) shake overnight (Agrobacterium strain GV 3101);

b, centrifugally collecting bacterial liquid;

c suspending with 25mL of activation medium (liquid);

d shaking at 28 deg.C for 3-5 h;

e, transferring the cells into a culture dish;

f, putting the tobacco leaves on a culture dish (an activation culture medium containing bacterial liquid);

cutting the tobacco sterile seedling leaf into 0.2-0.5cm square by using a scalpel;

h, soaking in an activation culture medium for about 10 min;

i, taking out the leaves, and placing the leaves on sterilized paper to suck dry bacterial liquid;

j placing the leaves on a co-culture medium for dark culture for 3 days; then washing the leaves with 50mL of sterile water (containing one drop of Tween and 40 mu L of cephalosporin) for 4-6 times, and finally washing the leaves with pure sterile water (without Tween and cephalosporin) for the last time;

k, transferring the leaves to a screening culture medium (a flat plate or a culture bottle) and culturing under a conventional light-temperature condition;

l typically shoots (plantlets) appear after 2 weeks; when the plantlets have grown, the cut plantlets are transferred to a rooting medium (culture flask) for cultivation.

(2) The positive plant detection method comprises the following steps:

transgenic plants were treated with HF gctctagaatgaagtatagatagcagcagaggtg and

HR cggggatctcttatgatgatcatagaagcctgg combination is subjected to PCR identification, and a 598bp target fragment is regarded as a positive strain;

(3) and (3) gene expression detection:

extracting the 20 th leaf RNA of the K326 and the transgenic positive strain by using an RNA kit, carrying out reverse transcription, and then designing a primer (UbiF: aagacctacaccaagcccaa, UbiR: aagtgagcccacacttacca) of a control gene ACTIN and a self-detection primer (TAT-qF: caggatgggtaatgggtactctcat, TAT-qR: cctacagatccacacacagcatatc) for Q-PCR detection, wherein PCR is carried out on a StrataGene Mx3000p quantitative PCR instrument;

(4) and (3) measuring the metabolic components:

taking K326 and the 20 th leaf fluid of the transgenic positive strain, quickly freezing by nitrogen, and respectively using GC-MS, UPLC-Q-TOF and the like to measure amino acid, sugar and the like;

in a preferred embodiment of the present invention, in step S101, the plant material provided by the embodiment of the present invention is selected from high-quality tobacco cultivar K326, and the vector and the strain are selected from Escherichia coli (Escherichia coli) strain DH5 α;

in a preferred embodiment of the present invention, in step S102, the plant material provided by the embodiment of the present invention is selected from high-quality tobacco cultivar K326, the vector and strain are selected from Escherichia coli (Escherichia coli) strain DH5 α, and the vectors VRI1 and VRI2 are original storage vectors in the laboratory;

in a preferred embodiment of the present invention, in step S103, the plant material provided by the embodiment of the present invention is the interference progeny of the recipient cultivar K326, NtTAT; the plasmid is TAT overexpression vector pSVM-iTAT.

The effect of the present invention will be described in detail with reference to the experiments.

1. Cloning of amino acid Transporter Gene NtTAT

1) Cloning of NtTATcDNA and nucleotide sequence parameter analysis

As shown in fig. 2, the primers were designed to successfully amplify cDNA of NtTAT gene; the sequencing result shows that the coding region (including a stop codon) of the cDNA gene of TAT is 1278bp in total.

2) Physicochemical Properties of NtTAT protein

The results showed that the NtTAT gene encodes 425 amino acid residues, the molecular weight of the encoded protein is 46.56kD, the theoretical isoelectric point pI is 8.26, and of all the amino acid residues, 30 basic amino acids account for 7.00% of the entire encoded protein, 27 acidic amino acids account for 6.3% of the entire encoded protein, 194 hydrophobic amino acids account for 45.6% of the entire encoded protein, and 95 polar amino acids account for 22.3% of the entire encoded protein. From the amino acid composition, leucine content was highest (14.12%), followed by valine (10.12%), glycine (8.94%) and serine (8.00%) in the whole encoded protein

3) Possible post-translational modification and subcellular localization of NtTAT proteins

SignalP 3.0 predicts that NtTAT has both a signal peptide and a signal anchor with a probability of 0 or with a minimal probability, so they do not have a signal peptide. TargetP 1.1 (tusndy et al, 2001) TAT protein is not a secreted protein, its subcellular localization is not a chloroplast protein (probability 0.057) or a mitochondrial protein (probability 0.279), most likely at other locations with a probability of 0.807. The WoLFPSORT prediction showed TAT protein localization to the cytoplasm (score 8.0). The results of the Softberry-ProtComp9.0(http:// www.softberry.com /) prediction suggest that the NtTAT protein is localized to the plasma membrane with a probability of 9.6. Netphos 2.0(http://www.cbs.dtu.dk/services/NetPhos/) Multiple phosphorylation sites are predicted for the NtTAT proteins.

As shown in FIG. 3, the serine kinase activity of NtTAT was measured by NetPhos,The phosphorylation sites of threonine kinase and tyrosine kinase were analyzed, and NtTAT was found to contain 8 serine kinase phosphorylation sites (S)₉、S₁₀、S₁₂、S₃₃、S₈₆、S₁₀₁、S₁₅₃And S₁₅₃) And 3 tyrosine kinase phosphorylation sites (Y)₁₀₇、Y₃₂₄、Y₃₃₆) And 1 threonine kinase phosphorylation site (T)₂₂)；

The results indicate that the NtTAT protein can be phosphorylated by these kinases, thereby achieving regulation of its function.

As shown in FIG. 4, the sequence of the NtTAT protein was analyzed by glycosylation using NetGlycate, and it was found that the protein had 7 possible glycosylation modification sites (K) for the epsilon amino group of lysine₂、K₁₁₄、K₂₃₃、K₃₄₄、K₄₆₉NetNGlyc 1.0 predicts that the NtTAT protein has 2N-glycosylation sites (N-glycosylation site) at amino acid 146 (NLSI) and 151 (NPSP).

4) Transmembrane domain and topological structure prediction of NtTAT

As shown in fig. 5, SOSUI predicted that the NtTAT protein is a membrane white with 11 transmembrane helical structures. TMpred was used to predict the transmembrane structure of TAT. The software predicted the presence of 11 inside-out transmembrane domains for NtTAT. And 11 outside-in transmembrane helices, indicating that analysis by different methods all demonstrated that NtTAT is a transmembrane protein.

5) Protein secondary structure prediction

As shown in fig. 6, the secondary structure prediction was analyzed by the main SOPMA software. The composition of the NtTAT secondary structure was calculated by SOPMA, with a maximum of 49.65% alpha-helices followed by 29.18% random coils; the extended strand and β -sheet were only 18.12% and 3.06%, respectively.

6) Conserved region analysis and function prediction of NtTAT protein

As shown in FIG. 7, the functional Domain prediction of NtTAT was performed in the Conserved Domain (CCD) database at NCBI, and as a result, it was found that the protein has a transmembrane amino acid transporter superfamily Domain.

As shown in fig. 8, Interpro scan results indicate that the NtTAT protein has functional domains of the amino acid transporter superfamily.

2. Construction of NtTAT Gene interference vector

1) Amplification of target fragments

As shown in FIG. 9, the left and right arms of the NtTAT interference fragment were amplified with ITATLF + ITATLR primer and ITATRF + ITATRR primer, respectively, and electrophoresis showed that the desired size of the target fragment was obtained. The specific fragments are then recovered by gel.

2) Loading of target fragments into an interference vector

As shown in FIG. 10, the NtTAT left-arm amplification product and the vector VIR2 were simultaneously double-digested with EcoR I and BglII, the target fragment and the backbone were recovered and ligated overnight; performing double enzyme digestion on the TAT right arm amplification product and a vector VIR2 by using SbfI and BstEII, recovering a target fragment and a skeleton, and connecting overnight; transferring the ligation product into escherichia coli, picking and shaking the bacillus to extract plasmids, and then carrying out enzyme digestion detection. And (3) carrying out Huada sequencing identification on the positive plasmid, and obtaining an interference vector pSVM-iTAT with a correct sequence.

3. Expression characteristics of interfered NtTAT gene and influence on amino acid content of tobacco leaves

1) Transgenic and progeny breeding

The sterile leaves of the tobacco K326 are impregnated by agrobacterium EHA105 containing NtTAT gene interference vector pSVM-iTAT, and T0 generation seeds are finally obtained through the steps of screening, differentiation, rooting, transplanting, cultivation and the like.

2) Transgenic T1 generation positive strain detection and homozygous strain identification

In order to accurately measure the expression change of related genes and the influence on the amino acid content, positive strains in T1 generations are detected by PCR, and positive strains are taken for later use; after mature seeds are collected, the seeds are paved on a screening culture medium containing antibiotics, and a homozygous transgenic plant is found out; the corresponding homozygote was subjected to metabolite determination.

Detecting by using a primer HF/R to obtain 12 TAT interference positive strains in total;

antibiotic screening is carried out on the 12 seeds to obtain 6 homozygote plants in total; the control group K326 died in the screening medium, and all the offspring of the detected positive homozygote can grow normally.

3) RT-qPCR analysis of homozygous transgenic progeny target genes

As shown in FIG. 11, RT-qPCR was used to detect the expression change of TAT gene in the super-expression homozygous strains, and the results showed that the target gene in all 6 homozygous strains was down-regulated, wherein the homozygous strain numbered 1 had the lowest expression, and only 1/10 indicating the expression level of the corresponding gene in wild type K326, indicating successful intervention on the target gene.

4) Determination of amino acid content of homozygous transgenic offspring: GC-MS gas chromatography-mass spectrometry

As shown in FIG. 12, in TAT interfering homozygous strains, 5 kinds (valine, proline, threonine, phenylalanine, and the like) of the amino acids were detected with a significant increase in the content (1.5 times or more than that of the control), wherein the change in proline was the greatest and increased by nearly 13 times, and the changes in the other contents were small.

The result shows that the content of amino acids such as valine, proline, threonine and phenylalanine in the tobacco leaves is increased by the interference of the NtTAT gene, and the metabolism of the amino acids is influenced by the change of the amino acid transport capacity, so that the quality of the tobacco leaves is influenced.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Sequence listing

<110> Guizhou province tobacco science research institute

<120> tobacco amino acid transporter gene NtTAT and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1278

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggggtttg agaaagacaa ggcaagttca tcatcccata ttctgcaaat cccaagagaa 60

gatacaccac ttttagccaa cacccaacat ctttcttcac cttccaaaac ttttgctaat 120

gttttcatag cagtagtagg agctggagtt cttggtcttc cttatagttt caagaaaaca 180

ggatgggtaa tgggtactct catgctttta tcagtagcaa ctcttacttg ctattgtatg 240

atgcttcttg tttattcaag gagaaagcta gaatcccatt tcaaagttgc caagatttca 300

tcttttggtg atttgggata tgctgtgtgt ggatctgtag gtagatgtac agtagatgct 360

atgattgtta tgtctcaagc tggtttttgt ataagttact tgattttcat agccaataca 420

ttagcacact tattcaatta ttctgttaca aatccaagtc ctaaaatctt ggggttgtca 480

cctaaaaaag tgtatatttg gagttgtttc ccatttcagt tggggttgaa ttcaatccct 540

acactcactc acttagcccc tttgagtata tttgctgatg ttgttgattt aggtgctatg 600

ggggtagtta tggctgagga tgtgttgatt tttctaaaga atagacctgt tcttgaaaca 660

tttggtgggt tcagtgtttt cttctatggt cttggtgtat ctgtttatgc ttttgaaggt 720

gttgggatgg tcttaccttt agaagcagag atgaaagaca aggaaaaatt tgggaaaatc 780

ttgggtttgt caatggcttt catttctttg atgtatggtt cttttggagt attggggtac 840

tttgcctttg gggaagagac caaagatata atcacaacca atcttgggag aggattgctt 900

agcacattag tgcaaattgg actttgcata aaccttttct ttactttccc attaatgatg 960

aatcctgttt atgaagtgat ggaaaggaga ttttgtgaag ggagatactg cttttggttg 1020

agatggattg tggttttggt agtcacttta gtggcattaa tggtgccaaa ttttgctgat 1080

ttcttgtcac tagttgggag cagtgtgtgc attgttttgg ggtttgtgct acctgctttg 1140

tttcacttaa ttgtattcaa gaaagaacta ggatggcttg gtttggcttt ggattctgca 1200

cttgttttaa tgggtgcagt tttggctatc tatggaactt attcttccat gctggagatc 1260

tttggagtca aagcttga 1278

<210> 2

<211> 425

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Gly Phe Glu Lys Asp Lys Ala Ser Ser Ser Ser His Ile Leu Gln

1 5 10 15

Ile Pro Arg Glu Asp Thr Pro Leu Leu Ala Asn Thr Gln His Leu Ser

20 25 30

Ser Pro Ser Lys Thr Phe Ala Asn Val Phe Ile Ala Val Val Gly Ala

35 40 45

Gly Val Leu Gly Leu Pro Tyr Ser Phe Lys Lys Thr Gly Trp Val Met

50 55 60

Gly Thr Leu Met Leu Leu Ser Val Ala Thr Leu Thr Cys Tyr Cys Met

65 70 75 80

Met Leu Leu Val Tyr Ser Arg Arg Lys Leu Glu Ser His Phe Lys Val

85 90 95

Ala Lys Ile Ser Ser Phe Gly Asp Leu Gly Tyr Ala Val Cys Gly Ser

100 105 110

Val Gly Arg Cys Thr Val Asp Ala Met Ile Val Met Ser Gln Ala Gly

115 120 125

Phe Cys Ile Ser Tyr Leu Ile Phe Ile Ala Asn Thr Leu Ala His Leu

130 135 140

Phe Asn Tyr Ser Val Thr Asn Pro Ser Pro Lys Ile Leu Gly Leu Ser

145 150 155 160

Pro Lys Lys Val Tyr Ile Trp Ser Cys Phe Pro Phe Gln Leu Gly Leu

165 170 175

Asn Ser Ile Pro Thr Leu Thr His Leu Ala Pro Leu Ser Ile Phe Ala

180 185 190

Asp Val Val Asp Leu Gly Ala Met Gly Val Val Met Ala Glu Asp Val

195 200 205

Leu Ile Phe Leu Lys Asn Arg Pro Val Leu Glu Thr Phe Gly Gly Phe

210 215 220

Ser Val Phe Phe Tyr Gly Leu Gly Val Ser Val Tyr Ala Phe Glu Gly

225 230 235 240

Val Gly Met Val Leu Pro Leu Glu Ala Glu Met Lys Asp Lys Glu Lys

245 250 255

Phe Gly Lys Ile Leu Gly Leu Ser Met Ala Phe Ile Ser Leu Met Tyr

260 265 270

Gly Ser Phe Gly Val Leu Gly Tyr Phe Ala Phe Gly Glu Glu Thr Lys

275 280 285

Asp Ile Ile Thr Thr Asn Leu Gly Arg Gly Leu Leu Ser Thr Leu Val

290 295 300

Gln Ile Gly Leu Cys Ile Asn Leu Phe Phe Thr Phe Pro Leu Met Met

305 310 315 320

Asn Pro Val Tyr Glu Val Met Glu Arg Arg Phe Cys Glu Gly Arg Tyr

325 330 335

Cys Phe Trp Leu Arg Trp Ile Val Val Leu Val Val Thr Leu Val Ala

340 345 350

Leu Met Val Pro Asn Phe Ala Asp Phe Leu Ser Leu Val Gly Ser Ser

355 360 365

Val Cys Ile Val Leu Gly Phe Val Leu Pro Ala Leu Phe His Leu Ile

370 375 380

Val Phe Lys Lys Glu Leu Gly Trp Leu Gly Leu Ala Leu Asp Ser Ala

385 390 395 400

Leu Val Leu Met Gly Ala Val Leu Ala Ile Tyr Gly Thr Tyr Ser Ser

405 410 415

Met Leu Glu Ile Phe Gly Val Lys Ala

420 425

Claims

1. The application of the interference of the tobacco amino acid transporter gene NtTAT in improving the amino acid content composition of tobacco leaves is characterized in that the nucleotide sequence of the tobacco amino acid transporter gene NtTAT is SEQ ID NO. 1; the amino acids are valine, proline, threonine and phenylalanine.