CN109280668A - A kind of tobacco amino acid transporter gene NtTAT and application thereof - Google Patents

A kind of tobacco amino acid transporter gene NtTAT and application thereof Download PDF

Info

Publication number
CN109280668A
CN109280668A CN201811196540.6A CN201811196540A CN109280668A CN 109280668 A CN109280668 A CN 109280668A CN 201811196540 A CN201811196540 A CN 201811196540A CN 109280668 A CN109280668 A CN 109280668A
Authority
CN
China
Prior art keywords
nttat
amino acid
gene
tobacco
leu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201811196540.6A
Other languages
Chinese (zh)
Other versions
CN109280668B (en
Inventor
雷波
赵会纳
蔡凯
丁福章
潘文杰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guizhou Institute of Tobacco Science
Original Assignee
Guizhou Institute of Tobacco Science
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guizhou Institute of Tobacco Science filed Critical Guizhou Institute of Tobacco Science
Priority to CN201811196540.6A priority Critical patent/CN109280668B/en
Publication of CN109280668A publication Critical patent/CN109280668A/en
Application granted granted Critical
Publication of CN109280668B publication Critical patent/CN109280668B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8251—Amino acid content, e.g. synthetic storage proteins, altering amino acid biosynthesis

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Nutrition Science (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to field of plant genetic project technology, a kind of tobacco amino acid transporter gene NtTAT and application thereof is disclosed, comprising: amino acid transporter gene NtTAT clone；The building of NtTAT gene interference vector；Expression characteristic after NtTAT gene interference and the influence to tobacco leaf amino acid content；Homozygous transgenic offspring's Contents of Amino Acids.What amino acid content obviously rose in NtTAT interference homozygous strain has 5 kinds (valine, proline, threonine and phenylalanines etc.), and wherein proline variation is maximum, increases nearly 13 times, valine, and the content of threonine and phenylalanine increased；NtTAT influences the metabolic gene of amino acid by the change of amino acid transport ability, improves valine in tobacco leaf, proline, the content of the amino acid such as threonine and phenylalanine, and then influence the quality of tobacco leaf.

Description

A kind of tobacco amino acid transporter gene NtTAT and application thereof
Technical field
The invention belongs to field of plant genetic project technology more particularly to a kind of tobacco amino acid transporter genes NtTAT and application thereof.
Background technique
Currently, the prior art commonly used in the trade is such that Nicotiana tubular flower subject, Solanaceae is annual or limited many years Raw herbaceous plant, base portion slightly lignifying.Inflorescence basidixed, it is coniform, it spends more；Capsule ovate or square round shape, length are approximately equal to persistent calyx. Summer and autumn yields positive results.Tobacco likes environment and fertile loose soil warm, on the sunny side, drought-enduring, can not resist cold.Like it is warm, on the sunny side Environment can not resist cold, more heat-resisting.It is distributed mainly on South America, South Asia, China.Amino acid is the important chemicals of one kind in tobacco Matter can occur enzyme and urge in tobacco modulation, alcoholization or fermentation, processing until in combustion process between free amino acid and reduced sugar Change and non-enzymatic browning reaction, generation are a variety of with boiling, roasting perfume, the pyrans of puffed rice fragrance characteristic, pyrazine, pyrrole Cough up, heterocyclic compounds, certain amino acid such as phenylalanine such as pyridines also itself can resolve into perfume compound, as benzyl alcohol, Benzyl carbinol etc..Amino acid content and the jealous of tobacco product have close relationship, and amino acid is general in burning cracking process Being formed has irritating nitrogenous compound, generates adverse effect to flue gas flavor and taste, Individual amino acids also generate the harm such as HCN The smoke components of health.It is, in general, that amino acid content is too high, flue gas is pungent, bitter, irritation are strong；Cigarette when content is too low Gas is then insipid to lack richness.Although can be predicted genes with unknown function using bioinformatics method, base The final function of cause still will lean on Biology identification.With the development of molecular biology, gene transfer, antisense technology, RNA are dry It disturbs, the methods of gene interference technology is used for the identification of plant gene function.Therefore, tobacco tobacco leaf can be adjusted by how developing one kind The gene of middle amino acid content is those skilled in the art's technical problem urgently to be resolved.
In conclusion problem of the existing technology is: how to develop one kind and can adjust amino acid in tobacco tobacco leaf and contain The gene of amount is those skilled in the art's technical problem urgently to be resolved.Gene of the invention currently without.
Summary of the invention
In view of the problems of the existing technology, the present invention provides a kind of tobacco amino acid transporter gene NtTAT and Its purposes.
The invention is realized in this way a kind of tobacco amino acid transporter gene NtTAT, the tobacco amino acid transport The nucleotides sequence of protein gene NtTAT is classified as SEQ ID NO:1.
Another object of the present invention is to provide a kind of eggs encoded by the tobacco amino acid transporter gene NtTAT White matter, the amino acid sequence of the protein are SEQ ID NO:2.
Another object of the present invention is to provide a kind of tobacco amino acid transporter gene NtTAT to adjust tobacco Application in the amino acid content composition of blade.
In conclusion advantages of the present invention and good effect are as follows: Successful amplification goes out the cDNA of NtTAT gene；It is right The sequencing of NtTATcDNA positive clone molecule sample presentation is it is found that the code area (including terminator codon) of the cDNA gene of NtTAT is total 1278bp, it is completely the same with the montage mode of prediction.The physicochemical property of NtTAT albumen shows that NtTAT gene encodes 425 ammonia Base acid residue, molecular weight of the encoded protein 46.56kD, theoretical isoelectric point pI are 8.26, in all amino acid residues, alkalinity 30, amino acid, the 7.00% of entire coding albumen is accounted for, acidic amino acid 27, accounts for the 6.3% of entire coding albumen, hydrophobic ammonia Base acid 194 accounts for the 45.6% of entire coding albumen, and polar amino acid 95 account for the 22.3% of entire coding albumen.From amino It is entire to encode in albumen from the point of view of the composition of acid, leucine content highest (14.12%), followed by valine (10.12%) sweet ammonia Sour (8.94%) and serine (8.00%).The possible posttranslational modification of NtTAT albumen and subcellular localization, NtTAT albumen energy Enough by these kinases institute phosphorylations, to realize the regulation of its function.There are 7 possible lysine ε amino groups for the albumen Glycosylation modified site (K2, K114, K233, K344, K469), NetNGlyc 1.0 predict NtTAT albumen have 2 N- glycosyls Change site (N-glycosylation site) and is located at (NPSP) at (NLSI) and 151 amino acid at 146 amino acid. The trans-membrane region and topological structure of NtTAT is predicted, proves that NtTAT is transmembrane protein by distinct methods analysis.Protein secondary Structure prediction calculates the composition of NtTAT secondary structure, and wherein alpha-helix is most, accounts for 49.65%, followed by random volume Song accounts for 29.18%；Extended chain and beta sheet only have 18.12% and 3.06% respectively.The analysis of NtTAT albumen conservative region and function It can predict, as a result, it has been found that albumen has cross-film amino acid transporter superfamily functional domain；Interpro scan is as the result is shown NtTAT albumen has the functional domain of amino acid transporter superfamily.The building of NtTAT gene interference vector, uses ITATLF+ ITATLR primer and ITATRF+ITATRR amplify the left and right arms of NtTAT interference segment respectively, and it is big that electrophoresis showed obtains expectation Small target fragment.Then glue recycling is carried out to specific fragment；Target fragment is loaded into interference vector, is sequenced and reflects to positive plasmid It is fixed, as a result obtain the correct interference vector pSVM-iTAT of sequence.Transgenosis and offspring cultivate, and are finally obtained T0 for seed.Turn Gene T1 is detected for positive strain and homozygous strain is identified, is detected through primer HF/R, is obtained NtTAT altogether and is interfered 12 plants of positive strain；To this 12 plants of seeds carry out antibiotic-screening, obtain 6 plants of homozygous strains altogether；Control group K326 all dies in screening and culturing medium, and examines The positive homozygous strain offspring measured all can normal growth.The RT-qPCR of homozygous transgenic offspring's target gene is analyzed, and whole 6 Target gene lowers expression in strain homozygous strain, wherein the homozygous strain expression that number is 1 is minimum, it is corresponding in only wild type K326 The 1/10 of the expression quantity of gene illustrates the interference success to target gene.Homozygous transgenic offspring's amino acid content is surveyed, NtTAT interferes in homozygous strain, and in surveyed amino acid, what content obviously rose (be control 1.5 times or more) has 5 kinds of (valine, dried meat Propylhomoserin, threonine and phenylalanine etc.), wherein proline variation is maximum, increases nearly 13 times, other changes of contents are little, Illustrate that the interference of NtTAT gene improves valine in tobacco leaf, proline, the content of the amino acid such as threonine and phenylalanine, It may be by the change of amino acid transport ability and influence the metabolism of amino acid, influence the quality of tobacco leaf.
Detailed description of the invention
Fig. 1 is the functional examination method flow diagram of tobacco amino acid transporter NtTAT provided in an embodiment of the present invention.
Fig. 2 is the full-length cDNA amplification fragmentary views of NtTAT gene provided in an embodiment of the present invention.
Fig. 3 is the phosphorylation site point of the serine of NtTAT provided in an embodiment of the present invention, threonine and tyrosine kinase Analyse schematic diagram.
Fig. 4 is the glycosylation site analysis schematic diagram of NtTAT provided in an embodiment of the present invention.
Fig. 5 is the trans-membrane region prediction schematic diagram of TMpred prediction NtTAT provided in an embodiment of the present invention.
Fig. 6 is the secondary structure prediction schematic diagram of NtTAT provided in an embodiment of the present invention.
Fig. 7 is NtTAT protein structure domain search (NCBI Conserved Domain provided in an embodiment of the present invention Search) schematic diagram.
Fig. 8 is NtTAT protein structure domain Interpro scan search schematic diagram provided in an embodiment of the present invention.
Fig. 9 is NtTAT left and right arms amplification schematic diagram provided in an embodiment of the present invention.
Figure 10 is that NtTAT left arm provided in an embodiment of the present invention is loaded into digestion detection schematic diagram.
Figure 11 is NtTAT interference homozygous strain RT-qPCR analysis schematic diagram provided in an embodiment of the present invention.
Figure 12 is NtTAT interference offspring's amino acid content schematic diagram provided in an embodiment of the present invention.
Specific embodiment
In order to make the objectives, technical solutions, and advantages of the present invention clearer, with reference to embodiments, to the present invention It is further elaborated.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, it is not used to Limit the present invention.
Application principle of the invention is explained in detail with reference to the accompanying drawing.
As shown in Figure 1, the functional examination method of tobacco amino acid transporter NtTAT provided in an embodiment of the present invention includes Following steps:
S101: amino acid transporter gene NtTAT clone；
The building of S102:NtTAT gene interference vector；
Expression characteristic after S103:NtTAT gene interference and the influence to tobacco leaf amino acid content.
In a preferred embodiment of the invention, in step S101, amino acid transporter base provided in an embodiment of the present invention Because the specific method of NtTAT clone includes:
1) extraction of Tobacco Leaf total serum IgE
Using K326 spire as material, total serum IgE is extracted using the method that a small amount of plant tissue RNA extraction agent boxes provide；
2) acquisition of the total cDNA of Tobacco Leaf
Using 1 μ g of K326 spire total serum IgE sample as template, reverse transcription is carried out using Oligo dT-Adaptor Primer, instead Product is total cDNA after transcription；
Reverse transcription condition are as follows: 42 DEG C of 40min, 50 DEG C of 30min, 99 DEG C of 5min, 5 DEG C of 5min；
The extraction of tobacco gene group total DNA is carried out using EasyPure Plant Genomic DNA Kit referring to specification It extracts.
3) clone of tobacco NtTAT gene
According to the cDNA forecasting sequence of SGN-U427096, the primer of NtTAT full length gene cDNA sequence amplification is designed TAT-F(5′-gcTCTAGAAtggggtttgagaaagacaaggcaag-3 ', underscore are XbaI enzyme cutting site, 2 small letters Mother is protection base) and
TAT-R(acGAGCTCTCAAGCTTTGACTCCAAAGATCTG, underscore are SacI restriction enzyme site, 2 small letters Mother is protection base)；
Using 1 μ L of the first chain of tobacco spire cDNA as template, using 50 μ L Taq PCR reaction systems of standard, TAT is expanded Full-length cDNA；
The parameter of PCR amplification cDNA is as follows: 94 DEG C of initial denaturation 4min, 35 circulations (94 DEG C of denaturation 1min, 58 DEG C of annealing 1min, 72 DEG C of extension 2min), 72 DEG C of heat preservation 10min；After the PCR product glue of acquisition is recycled, sequencing；
4) bioinformatic analysis
The assembling of sequencing sequence, multiple sequence compare, ORF (Open reading frame) is searched and translation, protein Fundamental property etc. is analyzed on 9.0 software of VectorNTI Advance；
The BLAST of nucleic acid and protein analysis and and the conserved domain (Conserved Domain) of protein sequence search Rope carries out on the website NCBI (http://www.ncbi.nlm.nih.gov)；
Posttranscriptional modification prediction, secondary structure prediction and the Tertiary structure predictions of protein mainly pass through Expasy The bioinformatics on-line analysis software that the website (http://www.expasy.org) provides carries out；
In order to obtain more comprehensive bioinformatic analysis as a result, also by http://www.cbs.dtu.dk/ The websites such as services/ and SoftBerry (http://www.softberry.com) have carried out supplement analysis.
In a preferred embodiment of the invention, in step S102, NtTAT gene interference vector provided in an embodiment of the present invention Building specifically include:
(1) extraction of Tobacco Leaf total DNA
Using K326 spire as material, total DNA is extracted according to the method that a small amount of plant tissue DNA's extraction agent boxes provide；
(2) building of interference vector
Using tobacco spire DNA as template, using 50 μ L Taq PCR reaction systems of standard, each gene respective objects are expanded Segment；The parameter of PCR amplification cDNA is as follows: 94 DEG C of initial denaturation 4min, 35 circulations (94 DEG C of denaturation 1min, 58 DEG C of annealing 1min, 72 DEG C of extension 2min), 72 DEG C of heat preservation 10min.After digestion PCR glue recovery product and related plasmids, Escherichia coli are connected and convert, Choose positive bacterial plaque and digestion and sequence verification；All gene interference vector buildings are shown in Table 1 with primer sequence；
Table 1: hairpin structure amplification primers
(3) NtTAT gene function is verified
Sequence is measured to pass through correctly assembling and compare with actual sequence, it is final to determine target bacterial plaque, it extracts plasmid and is transferred to root Cancer Agrobacterium GV3101 is spare.
(1) transgenic method includes:
1. tobacco aseptic seedling prepares: tobacco seed sterilizing being put into 1/2MS culture bottle and is germinateed；Then 2-3 plants every bottle is pressed It is transplanted in new 1/2MS culture bottle under general tissue culture light and temperature condition and grows；
2. Transgenic procedures:
A 10mL YEB (YEP) shakes bacterium overnight (agrobacterium strains GV3101)；
Bacterium solution is collected by centrifugation in b；
C activates culture medium (liquid) to suspend with 25mL；
D shakes 3-5h at 28 DEG C；
E is transferred to culture dish；
F tobacco leaf is put into culture dish (the activation culture medium containing bacterium solution) above；
Tobacco tests for sterility is switched to 0.2-0.5cm square with scalpel by g；
H impregnates 10min or so in activation culture medium；
I takes out blade, is placed on sterilizing paper and blots bacterium solution；
Blade is put into and co-cultures on base dark culture 3 days by j；Then blade 50mL aqua sterilisa (is dripped into tween and 40 μ containing one L cephalo) it washes 4-6 times, for the last time with pure aqua sterilisa (tween and cephalo is not added)；
K goes to blade on screening and culturing medium (plate/or culture bottle), conventional light and temperature condition culture；
L has bud (plantlet) appearance after general 2 weeks；After plantlet is grown, cuts plantlet and be transferred to root media It is cultivated on (culture bottle).
(2) positive plant detection method:
The plant of transgenosis with HF gctctagaatgaaggaagatatagagcagagtg and
HR cgggatccttatgatgcattaatagaagcctgg combination carries out PCR identification, there is 598bp target fragment view For positive strain；
(3) gene expression detection:
The 20th leaf RNA of K326 and transgenic positive strain, then reverse transcription, then design control are extracted with RNA kit The primer (UbiF:aagacctacaccaagcccaa, UbiR:aagtgagcccacacttacca) and self-test of Gene A CTIN Primer (TAT-qF:caggatgggtaatgggtactctcat, TAT-qR:cctacagatccacacacagcatatc) is used for Q- PCR detection, PCR are carried out on StrataGene Mx3000p quantitative PCR apparatus；
(4) Metabolite measures:
The 20th leaf liquid nitrogen flash freezer of K326 and transgenic positive strain is taken, respectively with GC-MS and UPLC-Q-TOF etc. to amino Acid and carbohydrate etc. are measured；
In a preferred embodiment of the invention, in step S101, vegetable material provided in an embodiment of the present invention is selected high-quality Tobacco cultivars K326, carrier and bacterial strain choose Escherichia coli (Escherichia coli) bacterial strain DH5 α；
In a preferred embodiment of the invention, in step S102, vegetable material provided in an embodiment of the present invention is selected high-quality Tobacco cultivars K326, carrier and bacterial strain choose Escherichia coli (Escherichia coli) bacterial strain DH5 α, carrier VRI1 It is the original preservation carrier in this laboratory with VRI2；
In a preferred embodiment of the invention, in step S103, vegetable material provided in an embodiment of the present invention is that receptor is Cultivar K326, NtTAT interfere offspring；Plasmid is TAT overexpression vector pSVM-iTAT.
Application effect of the invention is explained in detail below with reference to experiment.
1, amino acid transporter gene NtTAT is cloned
1) clone of NtTATcDNA and nucleotide sequence Parameter analysis
As shown in Fig. 2, using the primer of design, Successful amplification goes out the cDNA of NtTAT gene；Sequencing result shows TAT's Code area (including terminator codon) total 1278bp of cDNA gene.
2) physicochemical property of NtTAT albumen
The result shows that NtTAT gene encodes 425 amino acid residues, molecular weight of the encoded protein 46.56kD, theory etc. Electricity point pI is 8.26, in all amino acid residues, basic amino acid 30, accounts for the 7.00% of entire coding albumen, acid 27, amino acid, the 6.3% of entire coding albumen is accounted for, hydrophobic amino acid 194, accounts for the 45.6% of entire coding albumen, polarity 95, amino acid account for the 22.3% of entire coding albumen.It is entire to encode in albumen from the point of view of the composition of amino acid, leucine content Highest (14.12%), followed by valine (10.12%) glycine (8.94%) and serine (8.00%)
3) the possible posttranslational modification of NtTAT albumen and subcellular localization
SignalP 3.0 predicts that NtTAT has signal peptide and the probability of signal anchoring to be that 0 or probability are minimum, so they There is no signal peptide.TargetP 1.1 (Tusn á dy et al, 2001) TAT protein is not secretory protein, and subcellular localization is not It is chloroplast protein (probability 0.057) or mitochondrial protein (probability 0.279), it is likely to be positioned at other positions, probability It is 0.807.WoLFPSORT prediction result shows that TAT protein is positioned at cytoplasm (score value 8.0).Softberry- ProtComp9.0 (http://www.softberry.com/) prediction result think the positioning of NtTAT albumen in cytoplasma membrane, Its probability is 9.6.NetPhos 2.0(http://www.cbs.dtu.dk/services/NetPhos/) prediction NtTAT albumen There are multiple phosphorylation sites.
As shown in figure 3, using NetPhos to the phosphoric acid of serine kinase, threonine kinase and tyrosine kinase in NtTAT Change site to be analyzed, discovery NtTAT contains 8 serine kinase phosphorylation site (S9、S10、S12、S33、S86、S101、S153 And S153) and 3 tyrosine kinase phosphorylation site (Y107、Y324、Y336) and 1 threonine kinase phosphorylation point (T22)；
As a result illustrate, NtTAT albumen can be by these kinases institute phosphorylations, to realize the regulation of its function.
As shown in figure 4, carrying out glycosylation analysis to NtTAT protein sequence with NetGlycate finds that there are 7 for the albumen Glycosylation modified site (the K of possible lysine ε amino groups2、K114、K233、K344、K469), NetNGlyc 1.0 is predicted NtTAT albumen has 2 N- glycosylation sites (N-glycosylation site) to be located at (NLSI) and 151 at 146 amino acid Potential glycosylation site is not detected in (NPSP) .NetOGlyc analysis at amino acid.
4) trans-membrane region of NtTAT and topological structure are predicted
As shown in figure 5, SOSUI prediction NtTAT albumen is that a kind of film is white, there are 11 transmembrane helix structures.Using TMpred The transmembrane structure of TAT is predicted.Software predicts NtTAT, and there are 11 trans-membrane regions from inside to outside.And 11 by extroversion Interior transbilayer helix shows that demonstrating NtTAT by distinct methods analysis is transmembrane protein.
5) Protein secondary structure is predicted
As shown in fig. 6, the main SOPMA software of secondary structure prediction is analyzed.SOPMA is to NtTAT secondary structure Composition is calculated, and wherein alpha-helix is most, accounts for 49.65%, followed by random coils, accounts for 29.18%；Extended chain and β-folding It is folded there was only 18.12% and 3.06% respectively.
6) analysis of NtTAT albumen conservative region and function prediction
As shown in fig. 7, the functional domain prediction of Conserved Domain (CCD) the database progress NtTAT in NCBI, knot Fruit finds that albumen has cross-film amino acid transporter superfamily functional domain.
As shown in figure 8, Interpro scan as the result is shown NtTAT albumen have amino acid transporter superfamily function It can domain.
2, the building of NtTAT gene interference vector
1) amplification of target fragment
As shown in figure 9, amplifying NtTAT interference segment respectively with ITATLF+ITATLR primer and ITATRF+ITATRR Left and right arms, electrophoresis showed obtain the target fragment of desired size.Then glue recycling is carried out to specific fragment.
2) target fragment is loaded into interference vector
As shown in Figure 10, with EcoR I and BglII while double digestion NtTAT left arm amplified production and carrier VIR2, recycling Target fragment and skeleton simultaneously stay overnight connection；With SbfI and BstEII while double digestion TAT right arm amplified production and carrier VIR2, return It receives target fragment and skeleton and stays overnight connection；Connection product is transferred to Escherichia coli, digestion after spot shakes bacterium extracting plasmid is chosen and detects. Hua Da sequencing identification is sent to positive plasmid, as a result obtains the correct interference vector pSVM-iTAT of sequence.
3, the expression characteristic after NtTAT gene interference and the influence situation to tobacco leaf amino acid content
1) transgenosis and offspring cultivate
With the aseptic blade of the Agrobacterium EHA105 dip dyeing tobacco K326 of the pSVM-iTAT of gene interference vector containing NtTAT, lead to Screening is crossed, breaks up, takes root, transplant and cultivate and etc., T0 is finally obtained for seed.
2) transgenosis T1 is detected for positive strain and homozygous strain is identified
In order to accurately measure the expression variation of related gene and the influence to amino acid content, first in PCR detection T1 generation Positive strain, take positive strain tobacco leaf spare；It is laid on antibiotic screening and culturing medium Deng maturation sowing, finds out homozygosis and turn base Because of strain；Metabolite measurement is carried out to spare corresponding homozygous strain.
It is detected through primer HF/R, obtains TAT altogether and interfere 12 plants of positive strain；
Antibiotic-screening is carried out to this 12 plants of seeds, obtains 6 plants of homozygous strains altogether；Control group K326 is complete in screening and culturing medium Portion dies, and the positive homozygous strain offspring detected all can normal growth.
3) the RT-qPCR analysis of homozygous transgenic offspring target gene
As shown in figure 11, changed with expression of the RT-qPCR detection TAT gene in overexpression homozygous strain, the results showed that complete Target gene lowers expression in 6 plants of portion homozygous strain, wherein the homozygous strain expression that number is 1 is minimum, in only wild type K326 The 1/10 of the expression quantity of corresponding gene illustrates the interference success to target gene.
4) homozygous transgenic offspring Contents of Amino Acids: GC-MS Gc-mss
As shown in figure 12, TAT interference homozygous strain in, in surveyed amino acid, content obviously rise (be compare 1.5 times with On) have 5 kinds (valine, proline, threonine and phenylalanines etc.), wherein proline variation is maximum, increases nearly 13 Times, other changes of contents are little.
As a result illustrate that the interference of NtTAT gene improves valine in tobacco leaf, proline, the ammonia such as threonine and phenylalanine The content of base acid, it may be possible to which the metabolism that amino acid is influenced by the change of amino acid transport ability influences the quality of tobacco leaf.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all in essence of the invention Made any modifications, equivalent replacements, and improvements etc., should all be included in the protection scope of the present invention within mind and principle.
Sequence table
<110>Guizhou Province Tabacco Science and Technology Institute
<120>a kind of tobacco amino acid transporter gene NtTAT and application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1278
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
atggggtttg agaaagacaa ggcaagttca tcatcccata ttctgcaaat cccaagagaa 60
gatacaccac ttttagccaa cacccaacat ctttcttcac cttccaaaac ttttgctaat 120
gttttcatag cagtagtagg agctggagtt cttggtcttc cttatagttt caagaaaaca 180
ggatgggtaa tgggtactct catgctttta tcagtagcaa ctcttacttg ctattgtatg 240
atgcttcttg tttattcaag gagaaagcta gaatcccatt tcaaagttgc caagatttca 300
tcttttggtg atttgggata tgctgtgtgt ggatctgtag gtagatgtac agtagatgct 360
atgattgtta tgtctcaagc tggtttttgt ataagttact tgattttcat agccaataca 420
ttagcacact tattcaatta ttctgttaca aatccaagtc ctaaaatctt ggggttgtca 480
cctaaaaaag tgtatatttg gagttgtttc ccatttcagt tggggttgaa ttcaatccct 540
acactcactc acttagcccc tttgagtata tttgctgatg ttgttgattt aggtgctatg 600
ggggtagtta tggctgagga tgtgttgatt tttctaaaga atagacctgt tcttgaaaca 660
tttggtgggt tcagtgtttt cttctatggt cttggtgtat ctgtttatgc ttttgaaggt 720
gttgggatgg tcttaccttt agaagcagag atgaaagaca aggaaaaatt tgggaaaatc 780
ttgggtttgt caatggcttt catttctttg atgtatggtt cttttggagt attggggtac 840
tttgcctttg gggaagagac caaagatata atcacaacca atcttgggag aggattgctt 900
agcacattag tgcaaattgg actttgcata aaccttttct ttactttccc attaatgatg 960
aatcctgttt atgaagtgat ggaaaggaga ttttgtgaag ggagatactg cttttggttg 1020
agatggattg tggttttggt agtcacttta gtggcattaa tggtgccaaa ttttgctgat 1080
ttcttgtcac tagttgggag cagtgtgtgc attgttttgg ggtttgtgct acctgctttg 1140
tttcacttaa ttgtattcaa gaaagaacta ggatggcttg gtttggcttt ggattctgca 1200
cttgttttaa tgggtgcagt tttggctatc tatggaactt attcttccat gctggagatc 1260
tttggagtca aagcttga 1278
<210> 2
<211> 425
<212> PRT
<213>artificial sequence (Artificial Sequence)
<400> 2
Met Gly Phe Glu Lys Asp Lys Ala Ser Ser Ser Ser His Ile Leu Gln
1 5 10 15
Ile Pro Arg Glu Asp Thr Pro Leu Leu Ala Asn Thr Gln His Leu Ser
20 25 30
Ser Pro Ser Lys Thr Phe Ala Asn Val Phe Ile Ala Val Val Gly Ala
35 40 45
Gly Val Leu Gly Leu Pro Tyr Ser Phe Lys Lys Thr Gly Trp Val Met
50 55 60
Gly Thr Leu Met Leu Leu Ser Val Ala Thr Leu Thr Cys Tyr Cys Met
65 70 75 80
Met Leu Leu Val Tyr Ser Arg Arg Lys Leu Glu Ser His Phe Lys Val
85 90 95
Ala Lys Ile Ser Ser Phe Gly Asp Leu Gly Tyr Ala Val Cys Gly Ser
100 105 110
Val Gly Arg Cys Thr Val Asp Ala Met Ile Val Met Ser Gln Ala Gly
115 120 125
Phe Cys Ile Ser Tyr Leu Ile Phe Ile Ala Asn Thr Leu Ala His Leu
130 135 140
Phe Asn Tyr Ser Val Thr Asn Pro Ser Pro Lys Ile Leu Gly Leu Ser
145 150 155 160
Pro Lys Lys Val Tyr Ile Trp Ser Cys Phe Pro Phe Gln Leu Gly Leu
165 170 175
Asn Ser Ile Pro Thr Leu Thr His Leu Ala Pro Leu Ser Ile Phe Ala
180 185 190
Asp Val Val Asp Leu Gly Ala Met Gly Val Val Met Ala Glu Asp Val
195 200 205
Leu Ile Phe Leu Lys Asn Arg Pro Val Leu Glu Thr Phe Gly Gly Phe
210 215 220
Ser Val Phe Phe Tyr Gly Leu Gly Val Ser Val Tyr Ala Phe Glu Gly
225 230 235 240
Val Gly Met Val Leu Pro Leu Glu Ala Glu Met Lys Asp Lys Glu Lys
245 250 255
Phe Gly Lys Ile Leu Gly Leu Ser Met Ala Phe Ile Ser Leu Met Tyr
260 265 270
Gly Ser Phe Gly Val Leu Gly Tyr Phe Ala Phe Gly Glu Glu Thr Lys
275 280 285
Asp Ile Ile Thr Thr Asn Leu Gly Arg Gly Leu Leu Ser Thr Leu Val
290 295 300
Gln Ile Gly Leu Cys Ile Asn Leu Phe Phe Thr Phe Pro Leu Met Met
305 310 315 320
Asn Pro Val Tyr Glu Val Met Glu Arg Arg Phe Cys Glu Gly Arg Tyr
325 330 335
Cys Phe Trp Leu Arg Trp Ile Val Val Leu Val Val Thr Leu Val Ala
340 345 350
Leu Met Val Pro Asn Phe Ala Asp Phe Leu Ser Leu Val Gly Ser Ser
355 360 365
Val Cys Ile Val Leu Gly Phe Val Leu Pro Ala Leu Phe His Leu Ile
370 375 380
Val Phe Lys Lys Glu Leu Gly Trp Leu Gly Leu Ala Leu Asp Ser Ala
385 390 395 400
Leu Val Leu Met Gly Ala Val Leu Ala Ile Tyr Gly Thr Tyr Ser Ser
405 410 415
Met Leu Glu Ile Phe Gly Val Lys Ala
420 425

Claims (3)

1. a kind of tobacco amino acid transporter gene NtTAT, which is characterized in that the tobacco amino acid transporter gene The nucleotides sequence of NtTAT is classified as SEQ ID NO:1.
2. a kind of protein of the coding of the tobacco amino acid transporter gene NtTAT as described in claim 1, which is characterized in that The amino acid sequence of the protein is SEQ ID NO:2.
3. a kind of tobacco amino acid transporter gene NtTAT as described in claim 1 contains in the amino acid for adjusting tobacco leaf Application in amount composition.
CN201811196540.6A 2018-10-15 2018-10-15 Tobacco amino acid transporter gene NtTAT and application thereof Active CN109280668B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811196540.6A CN109280668B (en) 2018-10-15 2018-10-15 Tobacco amino acid transporter gene NtTAT and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811196540.6A CN109280668B (en) 2018-10-15 2018-10-15 Tobacco amino acid transporter gene NtTAT and application thereof

Publications (2)

Publication Number Publication Date
CN109280668A true CN109280668A (en) 2019-01-29
CN109280668B CN109280668B (en) 2021-11-23

Family

ID=65176469

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811196540.6A Active CN109280668B (en) 2018-10-15 2018-10-15 Tobacco amino acid transporter gene NtTAT and application thereof

Country Status (1)

Country Link
CN (1) CN109280668B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114763372A (en) * 2021-01-13 2022-07-19 中国科学院天津工业生物技术研究所 Protein with L-proline efflux function and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104004770A (en) * 2014-06-10 2014-08-27 云南省烟草农业科学研究院 Tobacco cadmium transporter gene NtHMA4 as well as cloning method and application thereof
CN106929522A (en) * 2017-02-23 2017-07-07 武汉生物工程学院 Amino acid transport gene OsAAP1 promotes the application of paddy growth under low nitrogen
CN108103087A (en) * 2017-12-18 2018-06-01 南开大学 The canaline transport protein fusion and its application that one insertion introne is modified

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104004770A (en) * 2014-06-10 2014-08-27 云南省烟草农业科学研究院 Tobacco cadmium transporter gene NtHMA4 as well as cloning method and application thereof
CN106929522A (en) * 2017-02-23 2017-07-07 武汉生物工程学院 Amino acid transport gene OsAAP1 promotes the application of paddy growth under low nitrogen
CN108103087A (en) * 2017-12-18 2018-06-01 南开大学 The canaline transport protein fusion and its application that one insertion introne is modified

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
GENBANK: "XM_009764400.1", 《GENBANK》 *
GENBANK: "XM_016657539.1", 《GENBANK》 *
赵影影: "烟草NtAAP2基因的克隆及功能研究", 《中国优秀硕士学位论文全文数据库（电子期刊）农业科技辑》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114763372A (en) * 2021-01-13 2022-07-19 中国科学院天津工业生物技术研究所 Protein with L-proline efflux function and application thereof

Also Published As

Publication number Publication date
CN109280668B (en) 2021-11-23

Similar Documents

Publication Publication Date Title
US11981905B2 (en) Polynucleotide sequences and proteins encoded thereby useful for modifying plant characteristics
US20110177228A1 (en) Plant nucelotide sequences and corresponding polypeptides
CN101978061A (en) Modulating light response pathways in plants
US10647990B2 (en) Rice high temperature resistance gene and use in crop breeding resistance to high temperature thereof
CN104450640A (en) Transgenic Plant With Increased Stress Tolerance And Yield
CN110184247B (en) Alfalfa melatonin synthetic gene MsASMT and application thereof in regulation and control of plant melatonin and flavonoid synthesis
CN107541520A (en) OsSAUR11 genes related to rice root development and resistance and encoding proteins and application
He et al. Overexpression of a novel transcriptional repressor GmMYB3a negatively regulates salt–alkali tolerance and stress-related genes in soybean
CN109486781A (en) A kind of alfalfa is overexpressed the method and application of squalene synthase gene
Gai et al. A novel late embryogenesis abundant like protein associated with chilling stress in Nicotiana tabacum cv. bright yellow-2 cell suspension culture
CN108603198A (en) Manipulate the composition and method of development of plants
Nguyen et al. The heat-shock response and expression of heat-shock proteins in wheat under diurnal heat stress and field conditions
CN107787180A (en) Genetically modified plants
CN106471124A (en) The purposes of the sucrose concentration of tonoplast proton/sugar reverse transport protein and its increase non-plant sucrose depot organ
EP1650301A1 (en) Gene imparting redifferentiation ability of plant and utilization of the same
CN109280668A (en) A kind of tobacco amino acid transporter gene NtTAT and application thereof
CN106749580B (en) Plant salt tolerance GAP-associated protein GAP TaPUB15-D and its encoding gene and application
CN113004382B (en) Application of EmBP1 gene or protein thereof
CN103374062B (en) OsVIT1 and OsVIT2 gene and improve the application of iron Zn content in rice paddy seed
CN105087508A (en) Eggplant flavanone 3-hydroxylase SmF3H as well as gene and application thereof
JP2003334084A (en) Root-specific gene responding to stress
CN108118063B (en) Mulberry potassium ion channel related gene MaKCO5 and application thereof
CN110407922A (en) Rice cold tolerance gene qSCT1 and its application
CN110903364A (en) Application of CsHSFA1d protein and coding gene thereof in regulation and control of cold resistance of plants
CN110128517A (en) Primula forbesii fragrance of a flower related gene PfLIS/NES and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant