CN117586978A

CN117586978A - Application of cotton protein and related biological materials thereof in enhancing waterlogging tolerance of plants

Info

Publication number: CN117586978A
Application number: CN202311554767.4A
Authority: CN
Inventors: 崔爱花; 孙亮庆; 李永旗; 杨笑敏
Original assignee: Jiangxi Economic Crops Research Institute
Current assignee: Jiangxi Economic Crops Research Institute
Priority date: 2023-11-21
Filing date: 2023-11-21
Publication date: 2024-02-23

Abstract

The invention discloses cotton protein and application of related biological materials thereof in enhancing waterlogging resistance of plants. The GhUGT74B1 gene is cloned from upland cotton, and the over-expression transgenic strain obtained by constructing the over-expression vector of the GhUGT74B1 gene is enhanced compared with the wild waterlogging resistance; the results of silencing the GhUGT74B1 gene in cotton show that the GhUGT74B1 gene plays a key role in improving waterlogging resistance of cotton. The invention can be applied to stress-resistant waterlogging-resistant molecular breeding and variety improvement of plants, especially cotton.

Description

Application of cotton protein and related biological materials thereof in enhancing waterlogging tolerance of plants

Technical Field

The invention relates to the field of biotechnology, in particular to application of cotton proteins and related biological materials thereof in enhancing waterlogging tolerance of plants.

Background

Flood disasters are agricultural natural disasters with high occurrence frequency and serious harm. In recent years, extreme weather in the world frequently occurs, and flood disasters tend to be aggravated. Flood disasters can prevent photosynthesis of crops, thereby influencing the growth and development of the crops and improving the yield.

Cotton is an important commercial crop that is more drought tolerant but sensitive to waterlogging. The waterlogging seriously affects the growth and development of cotton and the improvement of the quality of raw cotton. How to minimize the influence of waterlogging on the yield and quality of cotton becomes an important content of cotton stress resistance research. However, studies on cotton stress resistance, especially waterlogging resistance genes, are still insufficient at present.

Disclosure of Invention

The technical problem to be solved by the invention is how to enhance the waterlogging resistance of plants and/or how to enhance the waterlogging resistance of cotton.

In order to solve the above technical problems, the present invention provides, first, any one of the following applications of a protein or a substance regulating the expression of the protein or an active substance regulating the protein:

p1, in regulating and controlling the waterlogging resistance or flooding stress resistance of plants,

p2, in enhancing the flooding resistance or flooding stress resistance of plants,

p3, application in plant breeding,

p4, application in plant quality improvement;

the protein may be a protein of the following A1), A2) or A3):

a1 Amino acid sequence is protein of sequence 2 in the sequence table;

a2 Protein which is obtained by substituting and/or deleting and/or adding amino acid residues on the amino acid sequence shown in the sequence 2 in the sequence table, has the same function and is derived from A1) or has more than 80 percent of identity with the protein shown in A1);

a3 Fusion proteins obtained by ligating protein tags at the N-terminus or/and the C-terminus of A1) or A2).

In the above application, the protein may be derived from cotton.

The protein can be synthesized artificially or obtained by synthesizing the coding gene and then biologically expressing.

Among the above proteins, the protein tag (protein-tag) refers to a polypeptide or protein that is fusion expressed together with a target protein by using a DNA in vitro recombination technique, so as to facilitate the expression, detection, tracing and/or purification of the target protein. The protein tag may be a Flag tag, his tag, MBP tag, HA tag, myc tag, GST tag, and/or SUMO tag, etc.

In the above proteins, the identity refers to the identity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as BLAST web pages of the NCBI homepage website. For example, in advanced BLAST2.1, the identity of a pair of amino acid sequences can be searched for by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as Matrix, setting Gap existence cost, per residue gap cost and Lambda ratio to 11,1 and 0.85 (default values), respectively, and calculating, and then obtaining the value (%) of the identity.

In the above protein, the 80% or more identity may be at least 81%, 82%, 85%, 86%, 88%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

In the above application, the plant may be any of the following:

d1 Monocotyledonous plants;

d2 Dicotyledonous plants, a plant which is selected from the group consisting of,

d3 A plant of the order malvaceae,

d4 A plant of the family Malvaceae,

d5 A) a plant of the genus gossypium,

d6 Cotton;

d7 A plant of the order Philippinensis,

d8 A plant of the cruciferous family,

d9 An Arabidopsis plant, a plant of the genus Arabidopsis,

d10 Arabidopsis thaliana.

In order to solve the above technical problems, the present invention also provides any one of the following applications of the biological material related to the above protein:

q1, the application of the biological material in regulating and controlling the waterlogging resistance or the flooding stress resistance of plants,

q2, the application of the biological material in enhancing the flooding resistance or flooding stress resistance of plants,

q3, the application of the biological material in plant breeding,

q4, the application of the biological material in plant variety improvement.

The biomaterial may be any one of the following B1) to B9):

b1 A nucleic acid molecule encoding a protein as described above;

b2 An expression cassette comprising the nucleic acid molecule of B1);

b3 A recombinant vector comprising the nucleic acid molecule of B1) or a recombinant vector comprising the expression cassette of B2);

b4 A recombinant microorganism comprising the nucleic acid molecule of B1), or a recombinant microorganism comprising the expression cassette of B2), or a recombinant microorganism comprising the recombinant vector of B3);

b5 A transgenic plant cell line comprising the nucleic acid molecule of B1) or a transgenic plant cell line comprising the expression cassette of B2);

b6 A transgenic plant tissue comprising the nucleic acid molecule of B1) or a transgenic plant tissue comprising the expression cassette of B2);

b7 A transgenic plant organ comprising the nucleic acid molecule of B1) or a transgenic plant organ comprising the expression cassette of B2);

b8 A nucleic acid molecule that promotes or enhances gene expression of a protein as described above;

b9 An expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing the nucleic acid molecule of B8).

In the above application, the nucleic acid molecule of B1) may be a gene encoding the protein as shown in B1) or B2) below:

b1 A coding sequence of the coding chain is a cDNA molecule or a DNA molecule of a nucleotide of a sequence 1 in a sequence table;

b2 A cDNA molecule or a DNA molecule which hybridizes with the cDNA or DNA molecule defined in b 1) and which codes for a protein having the same function.

In the above biological material, the expression cassette containing a nucleic acid molecule of B2) refers to a DNA capable of expressing the protein of the above application in a host cell, and the DNA may include not only a promoter for promoting transcription of a gene encoding the protein but also a terminator for terminating transcription of the gene encoding the protein. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to: constitutive promoters, tissue, organ and development specific promoters, and inducible promoters.

Recombinant expression vectors containing the protein-encoding gene expression cassettes can be constructed using existing plant expression vectors. The plant expression vector comprises a binary agrobacterium vector, a vector which can be used for plant microprojectile bombardment and the like. Such as pAHC25, pWMB123, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA Co.). The plant expression vector may also comprise the 3' -untranslated region of a foreign gene, i.e., comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The polyadenylation signal may direct the addition of polyadenylation to the 3 'end of the mRNA precursor and may function similarly to the 3' transcribed untranslated regions of Agrobacterium tumefaciens induction (Ti) plasmid genes (e.g., nopaline synthase gene Nos) and plant genes (e.g., soybean storage protein genes). When the gene of the present invention is used to construct a plant expression vector, enhancers, including translational or transcriptional enhancers, may be used, and these enhancers may be ATG initiation codon or adjacent region initiation codon, etc., but must be identical to the reading frame of the coding sequence to ensure proper translation of the entire sequence.

In the above biological material, the recombinant microorganism may specifically be yeast, bacteria, algae and fungi.

In order to solve the technical problems, the invention also provides a method for promoting the flowering of plants. The method comprises enhancing or increasing the activity of the above-described protein or/and the expression level of the above-described gene encoding the protein in the plant of interest, thereby promoting flowering of the plant of interest.

The enhancement or increase of the activity of the above-described protein and/or the expression level of the above-described gene encoding the protein in the target plant can be achieved by introducing the above-described gene encoding the protein into the target plant.

In the method, the encoding gene of the protein can be modified as follows and then introduced into a target plant so as to achieve better expression effect:

1) Ligating to promoters expressed by various plants to facilitate expression thereof in plants; the promoter may include constitutive, inducible, chronologically regulated, developmentally regulated, chemically regulated, tissue-preferred, and tissue-specific promoters; the choice of promoter will vary with the time and space of expression requirements and will also depend on the target species; for example, a tissue or organ specific expression promoter, depending on the desired time period of development of the receptor; although many promoters derived from dicots have been demonstrated to be functional in monocots and vice versa, it is desirable to select dicot promoters for expression in dicots and monocot promoters for expression in monocots;

2) The expression efficiency of the gene of the invention can be improved by connecting with a proper transcription terminator; e.g., tml derived from CaMV, E9 derived from rbcS; any available terminator known to function in plants may be ligated to the gene of the present invention;

3) Enhancer sequences such as intron sequences (e.g., derived from Adhl and bronzel) and viral leader sequences (e.g., derived from TMV, MCMV and AMV) are introduced.

In the above method, the stress-sensitive plant may be a transgenic plant, or a plant obtained by conventional breeding techniques such as crossing.

In the above methods, the transgenic plants are understood to include not only first to second generation transgenic plants but also their progeny. For transgenic plants, the gene may be propagated in that species, and may be transferred into other varieties of the same species, including particularly commercial varieties, using conventional breeding techniques. The transgenic plants include seeds, calli, whole plants and cells.

In the above application, the plant may be any of the following:

d1 Monocotyledonous plants;

d3 A plant of the order malvaceae,

d4 A plant of the family Malvaceae,

d5 A) a plant of the genus gossypium,

d6 Cotton;

d7 A plant of the order Philippinensis,

d8 A plant of the cruciferous family,

d9 An Arabidopsis plant, a plant of the genus Arabidopsis,

d10 Arabidopsis thaliana.

In order to solve the technical problems, the invention also provides a method for improving the flooding or flooding stress tolerance of plants, which comprises the steps of enhancing or improving the activity of the protein in the target plants or/and the expression level of the encoding gene of the protein, so as to improve the flooding or flooding stress tolerance of the target plants.

In the above method, the enhancement or improvement of the activity of the above-described protein in the target plant or/and the expression level of the above-described gene encoding the protein is achieved by introducing the above-described gene encoding the protein into the target plant.

In the above method, the plant and/or plant of interest may be any of the following:

d1 Monocotyledonous plants;

d3 A plant of the order malvaceae,

d4 A plant of the family Malvaceae,

d5 A) a plant of the genus gossypium,

d6 Cotton;

d7 A plant of the order Philippinensis,

d8 A plant of the cruciferous family,

d9 An Arabidopsis plant, a plant of the genus Arabidopsis,

d10 Arabidopsis thaliana.

The proteins described above and/or the biological materials described above are also within the scope of the present invention.

According to the invention, the GhUGT74B1 gene is cloned from upland cotton, and an over-expression vector of the GhUGT74B1 gene is constructed, so that the obtained over-expression transgenic strain is enhanced compared with the wild waterlogging resistance, and the GhUGT74B1 gene plays an important role in regulating and controlling the waterlogging resistance of cotton, and can be used for improving waterlogging resistance molecules of cotton. Thus, the present invention has been completed.

In the present invention, the plant is cotton, maize, rice, wheat or arabidopsis.

The invention has the beneficial effects that:

according to the invention, through silencing the GhUGT74B1 gene in cotton, the result shows that the GhUGT74B1 gene may have a key effect in improving waterlogging resistance of cotton. The invention can be used for supporting the stress-resistant molecular improvement of plants, especially cotton.

Drawings

FIG. 1 shows the cloning and tissue-specific expression of a gene of interest. A is the detection result of electrophoresis bands of the target gene; b is the detection result of the relative expression quantity of GhUGT74B1 gene in the root, stem and leaf of waterlogged cotton ZNL 2067; the ordinate indicates the relative expression level of the genes, and the abscissa indicates different cotton tissues.

FIG. 2 is a diagram of transgenic Arabidopsis acquisition and identification. (a) is the molecular identification result of transgenic arabidopsis; (B) screening for over-expressed arabidopsis; (C) a GhUGT74B1 transgenic Arabidopsis thaliana waterlogging phenotype; (D) The middle left graph shows the plant height phenotype of transgenic arabidopsis after flooding in the flowering period; the right graph shows the relevant plant height measurement results, the abscissa shows different plant lines, and the ordinate shows plant heights of all the plant lines; (E) is a structural schematic diagram of pHG empty vector; (F) is the sequence information of the pHG empty vector.

FIG. 3 shows the phenotypic and biochemical index of cotton after GhUGT74B1 gene silencing under waterlogging stress. (A) phenotype of cotton after GhUGT74B1 gene silencing. (B) Expression level of GhUGT74B1 in control and silencing plants. (C) Chlorophyll content of control and GhUGT74B1 silenced plants. PDS: injection pYL156: whitened cotton after PDS; WT: normal growth of wild cotton; pYL156 and 156: blank cotton (LBA 4404/pYL156 injected cotton); pYL156 and 156: ghUGT74B1: cotton after injection of LBA4404/pYL156-GhUGT74B 1. * : p <0.05,: p <0.01.

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The cotton material selected in the examples of the present invention was waterlogging tolerant germplasm ZNL2067 from cotton institute of China national academy of sciences (related literature: sun L, wang J, cui Y, cui R, kang R, zhang Y, wang S, zhao L, wang D, lu X, fan Y, han M, chen C, chen X, guo L, ye W.changes in terpene biosynthesis and submergence tolerance in cotton.BMC Plant biol.2023Jun 21;23 (1): 330); arabidopsis thaliana is the Columbia wild type (Col-0 type).

The reagents and consumables used in the embodiment of the invention are as follows:

related enzymes and kits: the related enzyme, the modification enzyme, the restriction enzyme, the gel recovery kit, the homologous recombination enzyme and the cloning kit of the PCR reaction system are derived from Noruzan biotechnology Co-Ltd;

TransStart Top Green qPCR SuperMix the kit is from the whole gold biotechnology company;

the RNA extraction kit, the plasmid DNA extraction kit and the like are derived from Beijing Tiangen biochemical science and technology company;

kanamycin (Kana), rifampicin (Rif) was derived from beijing solibao technologies limited;

coli competent DH 5. Alpha. And Agrobacterium competent LBA4404 were derived from Shanghai Weidi Biotechnology Co., ltd;

the over-expression vector pHG was obtained from Shanghai Pubrier Biotechnology Co., ltd, vector pYL (and pYL: PDS (positive control) and pYL (helper) and was maintained by the cotton institute of China department of agriculture stress-resistant subject group (related literature: zhang Y, rui C, fan Y, xu N, zhang H, wang J, sun L, dai M, ni K, chen X, lu X, wang D, wang J, wang S, guo L, zhao L, feng X, chen C, ye W.Identification of SNAT Family Genes Suggests GhSNAT3D Functional Reponse to Melatonin Synthesis Under Salinity Stress in Cotton. Front Mol biosci.2022 Feb 10; 9:843814).

The main instrument is as follows: PCR amplification apparatus (BIO-RAD), fluorescent quantitative PCR apparatus (Bio-Rad 7500), high-speed centrifuge (Hettich MIKRO 200R), gel imaging system (BIO-RAD), high-temperature sterilization pot (Sanyang Japan), electrothermal constant temperature incubator (Shanghai forest letter), constant temperature culture oscillator (Shanghai Zhi city), intelligent artificial climate chamber (Ningbo saifu).

Culture medium:

TABLE 1 Medium formulation

Note that: above Yeast extract, tryptone, naCl, agar, yeast extract, glucose, mgSO ₄ 、KNO ₃ 、NH ₄ NO3、KH ₂ PO ₄ 、MgCl ₂ 、CaCl ₂ And the like is the domestic analytical purity.

Example 1 bioinformatics analysis of cotton GhUGT74B1 Gene

CDS sequence information of GH_D01G1589 and coded amino acid sequence are downloaded from a website CottonFGD (http:// www.cottonfgd.org /), the whole length of the gene is 1380bp, 459 amino acid residues are coded, the gene is named GhUGT74B1, and the function of the gene is studied.

The sequence of the GhUGT74B1 gene is the sequence 1 (5 '-3') in the sequence table:

ATGGAACACAAGCAGTTCAAAGGGCACGTGATACTTCTGCCATACCCAAGCCAAGGCCACATCAACCCTCTTCTCCAATTTGCTAAACGTTTAGCCTCTAAAGGTGTCAAGGCAACACTAGCCACCACCCACTACACATTCAATTCCATATGTGCAGCTCACATTGGGGTCGAACCTATATCTGATGGATTCGATGAAGGTGGCTTTTCTCAAGCTGGAAATGTAGACTTTTACCTTAAGTCATTCAAGGAAGAAGGGTCCCGATCGCTGTCGCAACTCATCCAAAAGTTTAAAGACTCTAGCACCTCTGTTACCTGTGTGGTGTATGACTCGTTTCTGCCATGGGCTCTTGATGTGGCAAAGCAGCATGGGATTTATGGAGCTTCTTTCTTTACCAACTCTGCCGCTGTGTGTAGCATCTTTTCTCGCATCCATCATGGCCGGCTTGCTCTGCCGCTGACCCCTGAAAGCAAACCCTTAATGTTACCAGGACTTCCTCCATTGAATTTCCGTGACCTGCCCACTTTTCTTCGGTTTCCAGATAGCTACCCTGCTTACTTGGCCATGAAATTGAGTCAGTATTCGAATTTGAATGAAGCTGATTGGGTTTTCGATAACACCTTTGAAGACTTGGAAGGAAAGGAAGCAAAAGGCGTGTCAGAGCTCTGGCAAGCGAAGTTGATTGGGCCTATGGTACCATCTGCTTACCTAGATGAAAGGATCAAAGGTGACAGAGGTTACGGTTCAAGTTTATGGAAGCCACTTAGCGAAGAGTGCATGGAATGGCTAGAAACAAAGCCATCTCAATCCGTTGTCTATATTTCATTTGGAAGCATGGTTTCATTAACAGAGGAAGAAACGGAAGAGATTGCTCGTGCCTTAGAGGAAAGCAATTTGCATTACCTGTGGATCGTCAGAGAGACGGAACAGAAAAAACTGCCCAAATGGTTCCTAGAATCAAATAAAGAAAAGGGCATGGTGGTGACATGGTGCAACCAACTAGAAATGCTGGCACATCCAGCCGTAGGCTGCTTTGTGACACATTGTGGGTGGAACTCAACCCTTGAAGGGCTAAGCCTTGGCGTGCCAATGGTGGGTGTGCCCAAATGGGCTGATCAATTGACGGATGCCAAGTTTGTGGAGGAGATTTGGGGGATTGGAGTGAGGGCCAAAGAGGATGAGGAAGGAGTTGTGAGGCGAGAGGAACTAATTAAGTGCTTGAAGGAAGTAATGGAAGGGGAGAGAGGCAAAGATATCAAGAGTAACGCTAACAAATGGAAGGAATTGGCTAAGAAAGCAATCAGTGAAGGTGGGAGCTCTGATGAGTGTATTAATAAGTTCGTCCAACATCTGATGGCCATAGTCGAACAAATTAATTGA。

the amino acid sequence coded by GhUGT74B1 is sequence 2 in a sequence table:

MEHKQFKGHVILLPYPSQGHINPLLQFAKRLASKGVKATLATTHYTFNSICAAHIGVEPISDGFDEGGFSQAGNVDFYLKSFKEEGSRSLSQLIQKFKDSSTSVTCVVYDSFLPWALDVAKQHGIYGASFFTNSAAVCSIFSRIHHGRLALPLTPESKPLMLPGLPPLNFRDLPTFLRFPDSYPAYLAMKLSQYSNLNEADWVFDNTFEDLEGKEAKGVSELWQAKLIGPMVPSAYLDERIKGDRGYGSSLWKPLSEECMEWLETKPSQSVVYISFGSMVSLTEEETEEIARALEESNLHYLWIVRETEQKKLPKWFLESNKEKGMVVTWCNQLEMLAHPAVGCFVTHCGWNSTLEGLSLGVPMVGVPKWADQLTDAKFVEEIWGIGVRAKEDEEGVVRREELIKCLKEVMEGERGKDIKSNANKWKELAKKAISEGGSSDECINKFVQHLMAIVEQIN。

example 2 cloning and expression Pattern analysis of GhUGT74B1

1. Sampling

ZNL2067 was grown in a potted plant, and when grown normally to trefoil, roots, stems and leaves were sampled separately, three samples were taken per tissue, about 0.1g per sample, and stored in liquid nitrogen at-80℃for later experiments.

Extraction of RNA

The total RNA is rapidly extracted by referring to Edley EASYspin Plus Plant RNA Kit, and the specific steps are as follows:

(1) 1000. Mu.L of lysate RLT was first transferred to a 1.5ml centrifuge tube, and then 100. Mu.L of PLANTAid was added.

(2) Cotton tissue was ground to a fine powder using liquid nitrogen in a mortar, and then 0.1g of cotton tissue fine powder was transferred into the centrifuge tube of step (1), immediately vigorously shaken for 20sec, and allowed to sufficiently lyse.

(3) The lysate was centrifuged at 13,000rpm for 10min, and impurities were precipitated.

(4) The supernatant of the lysate was transferred to a new centrifuge tube. And adding the absolute ethyl alcohol with half the volume of the supernatant into a new centrifuge tube, immediately blowing and uniformly mixing, and avoiding centrifugation.

(5) The mixture was applied to a genome removal column and centrifuged at 13,000rpm for 2min, and the waste liquid was discarded.

(6) The genomic DNA-cleared column was placed in a clean 2ml centrifuge tube, 500. Mu.L of lysate RLT Plus was added to the column, and the mixture was centrifuged at 13,000rpm for 30sec, and the filtrate was collected. Then adding 0.5 times of absolute ethyl alcohol, immediately blowing and uniformly mixing, and not centrifuging.

(7) The mixture was put into an adsorption column RA, centrifuged at 13,000rpm for 2min, and the waste liquid was discarded.

(8) mu.L of deproteinized solution RW1 was added thereto, and the mixture was left at room temperature for centrifugation at 13,000rpm for 30sec, followed by discarding the waste liquid.

(9) mu.L of the rinse solution RW was added and centrifuged at 13,000rpm for 30sec, and the waste liquid was discarded. 500. Mu.L of the rinse RW was added and repeated.

(10) The adsorption column RA was put back into the empty collection tube and centrifuged at 13,000rpm for 2min.

(11) The adsorption column RA was removed, placed in an RNase free centrifuge tube, 50. Mu. L RNase free water was added to the middle portion of the adsorption membrane, and the mixture was left at room temperature for 2min at 12,000rpm for 1min.

3. Synthesis of reverse transcribed cDNA

Reverse transcription was performed using the TransScript All-in-One First-Strand cDNA Synthesis SuperMix for PCR kit. 1. Mu.g of total RNA, 4. Mu.L of Mix and an appropriate amount of ddH were added sequentially to a centrifuge tube ₂ O, 20. Mu.L of the reaction system was prepared. After being evenly mixed by blowing, the cDNA is synthesized by incubating for 30min at 42 ℃ and heating for 5sec at 85 ℃ in a water bath kettle.

4. Cloning of genes

Designing an amplification primer of the GhUGT74B1 gene by DNAMAN software, and verifying the specificity of the primer by means of NCBI website to obtain a primer sequence as follows: f:5'-ATGGAACACAAGCAGTTCAAAGG-3'; r:5'-TCAATTAATTTDTTCGACTATGGCCA-3'. cDNA of waterlogging-tolerant germplasm ZNL2067 was used as a templateMax Master Mix (Vazyme) amplified the GhUGT74B1 gene. The 50. Mu.L PCR system was as follows: 1. Mu.L of cDNA, 2. Mu.L of upstream primer F, 2. Mu.L of downstream primer R, 25. Mu.L of 2X Phanta Max Master Mix and 20. Mu.L of ddH ₂ O. The PCR reaction procedure was: pre-denaturation at 95℃for 3min, denaturation at 95℃for 15sec, annealing at 59℃for 15sec, extension at 72℃for 2min, and extension at 72℃for 5min. 34 cycles from denaturation to extension were provided. Electrophoresis and sequencing results show that the full length 1380bp (corresponding band to lane 2 of A in FIG. 1) of the GhUGT74B1 gene encodes 459 amino acid residues.

5. Real-time fluorescent quantitative PCR

Real-time fluorescent quantitative PCR (RT-qPCR) was performed on roots, stems and leaves of trefoil ZNL and 2067, and RT-qPCR was performed according to the instructions of TransStart Top Green qPCR SuperMix kit. The primer sequences were as follows:

GhUGT74B1 detection related primer:

RT-F：5’-TGCTCGTGCCTTAGAGGAAA-3’；

RT-R：5’-AGTTGGTTGCACCATGTCAC-3’；

the reference gene action primer:

Actin-F：5’-ATCCTCCGTCTTGACCTTG-3’；

Actin-R：5’-TGTCCGTCAGGCAACTCAT-3’。

the results showed that the GhUGT74B1 gene was expressed in roots (represented by Root in FIG. 1B), stems (represented by Stem in FIG. 1B) and leaves (represented by Leaf in FIG. 1B), but the expression amounts were significantly different, and the GhUGT74B1 gene was expressed highest in leaves (B in FIG. 1).

EXAMPLE 3 construction of GhUGT74B1 plant expression vector

1. Acquisition and recovery of target fragments

The full-length mRNA sequence of GhUGT74B1 was amplified using the cDNA of cotton ZNL2067 obtained in example 2 as a template and a 2X Phanta Max Master Mix (Vazyme) kit, and the primer sequence was F according to the specification of the procedure: 5'-ATGGAACACAAGCAGTTCAAAGG-3'; r:5'-TCAATTAATTTDTTC GACTATGGCCA-3'. The amplified product was recovered using a gel recovery kit Magen HiPure Gel Pure Micro Kit (Magen) to obtain a target product.

2 vector construction

T-carrier construction: ligation products were constructed rapidly using pEASY-Blunt Zero Cloning Kit. The reaction system was 1. Mu.L of PCR product, 1. Mu.L of pEASY-Blunt Zero Cloning Vector, 3. Mu.L of ddH ₂ O. Mixing the materials, and incubating at 25deg.C for 20min. The ligation product was added to competent cells DH 5. Alpha. And gently mixed and allowed to stand in ice for 25min, after which heat shock was applied at 42℃for 45sec, the ligation product was rapidly placed on ice for 2min.

Culturing the transformed competent cells in LB liquid medium at 37 ℃ overnight, then enriching the thallus, plating the thallus on a resistant LB solid culture medium plate containing kanamycin (Kan) at 37 ℃ overnight, picking up monoclonal colonies growing on the solid culture medium plate, carrying out bacterial liquid PCR (primer sequence is F:5'-ATGGAACACAAGCAGTTCAAAGG-3'; R:5'-TCAATTAATTTDTTCGACTATGG CCA-3'), and delivering bacterial liquid (containing fragment of sequence 1 in a sequence table) with correct PCR verification to Shanghai workers for sequencing. And extracting plasmids from the positive monoclonal strains with correct sequencing results to obtain GhUGT74B1-T positive plasmids.

Construction of VIGS vector and recombinant overexpression vector

And designing enzyme cutting sites according to the information of the expression vector. The virus-induced gene silencing (VIGS) vector pYL has SacI and XbaI double cleavage sites, respectively, and pHG has BamHI and PstI double cleavage sites, respectively. Primers GhUGT74B 1-pYL-F and GhUGT74B 1-pYL-156-R (Table 2) containing SacI and XbaI cleavage sites, and primers GhUGT74B1-pHG-F and GhUGT74B1-pHG-R containing BamHI and PstI cleavage sites were designed, respectively (Table 2). PCR amplification is carried out by taking GhUGT74B1-T positive plasmid as a template, and two groups of PCR amplification product fragments are obtained: fragment 1 of interest (containing SacI and XbaI double sites) and fragment 2 of interest (containing BamHI and PstI double sites).

The pYL empty vector and the target fragment 1 (about 300 bp) were subjected to double cleavage using SacI and XbaI, and the cleavage products were purified, and then recombinant VIGS vector pYL-GhUGT 74B1 of GhUGT74B1 gene was constructed using an In-Fusion technology system (refer to In-Fusion HD Cloning Plus vector construction kit description).

The pHG empty vector and the desired fragment 2 (about 1400 bp) were digested with BamHI and PstI, and the digested products were purified, and then, a recombinant overexpression vector pHG-GhUGT74B1 (for transformation of Arabidopsis) of the GhUGT74B1 gene was constructed using the In-Fusion technology system (refer to the In-Fusion HD Cloning Plus vector construction kit instructions). The recombinant overexpression vector pHG-GhUGT74B1 contains a CDS fragment of the GhUGT74B1 gene shown in a sequence 1 in a sequence table, and can express the GhUGT74B1 protein shown in a sequence 2 in the sequence table.

After the recombinant VIGS vector and the recombinant overexpression vector are respectively introduced into escherichia coli DH5 alpha, the recombinant VIGS vector and the recombinant overexpression vector are coated on an LB solid medium containing kanamycin for overnight culture, and monoclonal colonies growing on a flat plate are picked. After colony PCR verification and DNA sequencing are correct, extracting plasmids and preserving thalli to obtain positive recombinant VIGS vector plasmids and positive recombinant over-expression vector plasmids, and preserving at-80 ℃ for later use.

TABLE 2 primer sequences for constructing vectors

Example 4 Agrobacterium-mediated transformation of Arabidopsis thaliana

Planting arabidopsis thaliana: the sterilized wild arabidopsis thaliana is sown on a solid MS culture medium, vernalized for 3d at 4 ℃, and then placed into an illumination incubator for germination, wherein the relative humidity is 60%, the constant temperature is 21-23 ℃, and the illumination period is 16h illumination/8 h darkness. Finally transplanting the Arabidopsis seedlings sprouting for 7d into nutrient soil for growth.

Activation of agrobacterium: first, agrobacterium LBA4404 containing recombinant overexpression vector pHG-GhUGT74B1 plasmid, which was preserved at-80℃was activated. 2mL of the activated Agrobacterium solution was added to 30mL of a liquid LB medium containing Kana (50 mg/L) and Rif (25 mg/L), and the mixture was cultured at 28℃and 200rpm for 8 hours to turn the color of the solution into orange, OD _600nm =about 1.0. And then, collecting bacterial liquid. Centrifuging at 20deg.C and 4,000rpm for 15min, collecting the submerged thallus, adding heavy suspension to obtain bacterial liquid OD ₆₀₀ =about 1.0.

Transformation of Agrobacterium: the arabidopsis thaliana which is being bolting and flowering is watered with water one day in advance, and the pod which is pollinated is cut off. First, the pot was inverted and all inflorescences were immersed in the resuspended bacterial liquid for about 30sec. Then wrapping and horizontally placing the infected arabidopsis by using a black plastic bag, and removing the black plastic bag after 24 hours to enable the arabidopsis to grow normally; after 7d the transformation was repeated once as described above. Note that: 2-3 weeks later, pouring nutrition liquid as little as possible, accelerating aging, collecting mature seeds in paper bag, and collecting T ₀ The seeds were placed in a desiccator for 7d.

Screening of transgenic Arabidopsis thaliana: first, T that has completed after-ripening ₀ /T ₁ /T ₂ Sterilizing the seeds of arabidopsis thaliana: sterilizing with 70% ethanol for 1min, sterilizing with 1mL sodium hypochlorite solution for 10min, mixing, and washing with sterile water for 6 times. Next, the sterilized seeds were resuspended in 100. Mu.L of sterile water and sown on 1/2MS medium (50 mg/L Kana) plates containing antibiotics. Then, after vernalization for 48 hours at 4 ℃, the seeds are put into a climatic chamber to start germination and growth, the growth environment is 60% relative humidity, the constant temperature is 20-22 ℃, and the illumination period is 16 hours of illumination/darkness for 8 hours. Then, observing the phenotype after 8-15d growth, and transplanting the screened positive seedlings into nutrient soil. Finally, after the arabidopsis seedlings grow up, extracting the DNA of arabidopsis leaves, and performing PCR amplification verification to obtain a transgenic positive GhUGT74B1 overexpression strain. PCR primersThe sequence is as follows: HPT-F: GGTCGCGGAGGCTATGGATGC; HPT-R: GCTTCTGCGGGCGATTTGTGT.

Example 5 phenotypic identification of transgenic overexpressing Arabidopsis plants

Through multiple times of screening in a 1/2MS culture medium containing kanamycin resistance, T of transgenic GhUGT74B1 gene over-expressed Arabidopsis strains (OE 4, OE5 and OE 8) is obtained ₀ 、T ₁ And T ₂ Plants were replaced (fig. 2). PCR identification shows that 16T's are obtained ₂ The generation of pure and transgenic Arabidopsis lines (the detection results of lanes 1-16 of A in FIG. 2 all contain a band of about 1380bp of a sequence 1 in a sequence table). The over-expression strains OE4, OE5 and OE8 were selected as the key study strains. Root flooding stress is carried out in the seedling stage of arabidopsis thaliana, and experimental operations are as follows:

the arabidopsis is cultivated in a pot, and grows in an illumination incubator, wherein the relative humidity is 60%, the temperature is constant at 22 ℃, and the illumination period is 16h illumination/8 h darkness. The plant height was measured after 3d of submerged water treatment at anthesis and then 7d of growth recovery.

Experimental results found that transgenic overexpressing Arabidopsis thaliana (OE 4, OE5, and OE8 of C in FIG. 2) grew stronger than wild-type (WT of C in FIG. 3) Arabidopsis thaliana. After flooding treatment and recovery of growth in the flowering phase of Arabidopsis, it is evident that the plant height of transgenic overexpressed Arabidopsis (OE 4, OE5 and OE8 in the right panel of D in FIG. 2) is significantly higher than that of wild-type Arabidopsis (WT in the right panel of D in FIG. 2). From this preliminary conclusion, the waterlogging tolerance of the over-expressed strain was improved, indicating that GhUGT74B1 is involved in the response of the plant to waterlogging stress.

EXAMPLE 6 Virus-induced Gene silencing

To further investigate the function of UGT gene GhUGT74B1 in abiotic stress, gene silencing analysis was performed on GhUGT74B1.

In example 3, the SacI and BamHI double-cut target fragment 1 and pYL empty vector were used, and the 300bp target fragment 1 enzyme-cut purified fragment was inserted into the double-cut pYL empty vector to obtain a positive recombinant VIGS vector plasmid pYL-GhUGT 74B1.

Positive recombinant VIGS vector plasmid, pYL (empty, blank), pYL 156:156 PDS (positive pair)Illumination) and pYL (helper) to obtain recombinant Agrobacterium LBA4404/pYL156-GhUGT74B1 and LBA4404/pYL156, LBA4404/pYL156: PDS and LBA4404/pYL192. Four recombinant agrobacteria were added to LB liquid medium containing antibiotics (50. Mu.g/mL Kana and 25. Mu.g/mL Rif), respectively, and cultured at 28℃under 200rpm overnight protected from light. Shake to OD ₆₀₀ When the ratio is=1.2-1.5, centrifuging at 5000rpm for 10min, discarding the supernatant to collect thalli, and finally adding an equal volume of sterile heavy suspension to mix uniformly, and standing the mixed heavy suspension for 4h in a dark place, wherein the components of the sterile heavy suspension are as follows: 10mM MES, 200. Mu.M/AS, 10mM MgCl ₂ The pH was 5.8. The resuspension of recombinant Agrobacterium (LBA 4404/pYL156-GhUGT74B 1), positive control (LBA 4404/pYL 156:156 PDS) and blank control (LBA 4404/pYL 156:156) were mixed with equal volumes of the helper bacterial resuspension (LBA 4404/pYL 192), respectively, prior to infestation. When cotton ZNL and 2067 were grown until the two cotyledons were spread (true leaves were not present), the subsurface surfaces of the cotyledons were broken by the needle of a syringe, and the bacterial liquid was injected into the cotyledons using a 2mL syringe until the cotyledons were filled. After the injection is completed, the culture is performed in the dark at 25 ℃ for 24 hours, and then the growth is normal under the light/dark for 16 hours at 25 ℃. After about 2 weeks, a albino phenotype appeared on the plants, indicating successful gene silencing. Recipient cotton wild type and LBA4404/pYL156, LBA4404/pYL156 PDS and LBA4404/pYL156-GhUGT74B1 cotton were subjected to non-topped flooding. The relative expression levels of the genes were analyzed by RT-qPCR experiments.

As shown in FIG. 3, when the cotton after injection grew to the trefoil stage, LBA4404/pYL156 was injected and the cotton plant leaves of PDS appeared whitened (represented by PDS in FIG. 3A).

Under normal growth conditions, the relative expression level of the GhUGT74B1 gene in the silenced plants injected with LBA4404/pYL156-GhUGT74B1 (CK-pYL: ghUGT74B1 in FIG. 3) was significantly lower than that of the empty control plants injected with LBA4404/pYL156 (CK-pYL in FIG. 3, represented by B), indicating successful silencing of the GhUGT74B1 gene in the silenced plants.

Under flooded conditions, the phenotype of the silenced plants injected with LBA4404/pYL156-GhUGT74B1 (pYL: ghUGT74B1 in FIG. 3) was more pronounced than the phenotype of the empty plants injected with LBA4404/pYL156 (pYL in FIG. 3) and the leaves showed more pronounced wilting and browning. The expression level of the silenced plants (represented by flood-pYL 156: ghUGT74B1 in FIG. 3) was significantly lower than that of the empty plant control (represented by flood-pYL 156 in FIG. 3B) injected with LBA4404/pYL 156. Meanwhile, the chlorophyll content of the silenced plants (represented by flood-pYL 156: ghUGT74B1 in FIG. 3C) was significantly lower than that of the empty plant control (represented by flood-pYL 156 in FIG. 3C) injected with LBA4404/pYL156 (FIG. 3C).

In conclusion, experiments of the invention show that the GhUGT74B1 protein in cotton is related to the flooding stress resistance of plants, and the overexpression of the GhUGT74B1 protein is helpful for relieving the phenotype of the flooding stress and improving the resistance of plants to the flooding stress.

The present invention is described in detail above. It will be apparent to those skilled in the art that the present invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with respect to specific embodiments, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains.

Claims

1. Use of a protein or a substance that modulates the expression of a protein or a substance that modulates the activity of a protein for any of the following applications:

p3, application in plant breeding,

p4, application in plant quality improvement;

the protein is the protein of A1), A2) or A3) as follows:

a1 Amino acid sequence is protein of sequence 2 in the sequence table;

2. The use according to claim 1, characterized in that: the protein is derived from cotton.

3. Use according to claim 1 or 2, characterized in that: the plant is any one of the following:

d1 Monocotyledonous plants;

d3 A plant of the order malvaceae,

d4 A plant of the family Malvaceae,

d5 A) a plant of the genus gossypium,

d6 Cotton;

d7 A plant of the order Philippinensis,

d8 A plant of the cruciferous family,

d9 An Arabidopsis plant, a plant of the genus Arabidopsis,

d10 Arabidopsis thaliana.

4. Use of any of the following biological materials in relation to the protein as claimed in claim 1 or 2:

q3, the application of the biological material in plant breeding,

q4, the application of the biological material in plant variety improvement,

the biomaterial is any one of the following B1) to B9):

b1 A nucleic acid molecule encoding the protein of claim 1;

b2 An expression cassette comprising the nucleic acid molecule of B1);

b8 A nucleic acid molecule which promotes or enhances the gene expression of the protein of claim 1;

5. The use according to claim 4, characterized in that: b1 The nucleic acid molecule is a gene encoding the protein as shown in b 1), b 2) or b 3) below:

6. Use according to claim 4 or 5, characterized in that: the plant is any one of the following:

d1 Monocotyledonous plants;

d3 A plant of the order malvaceae,

d4 A plant of the family Malvaceae,

d5 A) a plant of the genus gossypium,

d6 Cotton;

d7 A plant of the order Philippinensis,

d8 A plant of the cruciferous family,

d9 An Arabidopsis plant, a plant of the genus Arabidopsis,

d10 Arabidopsis thaliana.

7. A method for increasing the flooding or flooding stress tolerance of a plant, comprising increasing or increasing the activity of the protein of claim 1 or/and the expression level of the gene encoding the protein of claim 1 in a plant of interest, thereby increasing the flooding or flooding stress tolerance of the plant of interest.

8. The method according to claim 7, wherein: the enhancement or improvement of the activity of the protein of claim 1 or/and the expression level of the gene encoding the protein of claim 1 in a plant of interest is achieved by introducing the gene encoding the protein of claim 1 into the plant of interest.

9. The method according to claim 7 or 8, characterized in that: the plant and/or the target plant is any one of the following:

d1 Monocotyledonous plants;

d3 A plant of the order malvaceae,

d4 A plant of the family Malvaceae,

d5 A) a plant of the genus gossypium,

d6 Cotton;

d7 A plant of the order Philippinensis,

d8 A plant of the cruciferous family,

d9 An Arabidopsis plant, a plant of the genus Arabidopsis,

d10 Arabidopsis thaliana.

10. The protein of claim 1 and/or the biomaterial of claim 4 or 5.