CN109182550A - It is a kind of to kiss the primer and its design method and methods for using them of red tongue sole for quickly identifying Cynoglossus semilaevis and length - Google Patents
It is a kind of to kiss the primer and its design method and methods for using them of red tongue sole for quickly identifying Cynoglossus semilaevis and length Download PDFInfo
- Publication number
- CN109182550A CN109182550A CN201811231764.6A CN201811231764A CN109182550A CN 109182550 A CN109182550 A CN 109182550A CN 201811231764 A CN201811231764 A CN 201811231764A CN 109182550 A CN109182550 A CN 109182550A
- Authority
- CN
- China
- Prior art keywords
- primer
- red tongue
- cynoglossus semilaevis
- long
- tongue sole
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to field of molecular biotechnology, Cynoglossus semilaevis and the long red tongue sole of kiss can rapidly and accurately be identified to solve to have no effective ways at present, and it is based only upon the problems such as traditional morphological observation its biomorph feature is easy to cause the confusion on Identification of Species and phyletic evolution, the present invention provides a kind of for quickly identifying Cynoglossus semilaevis and the long primer and its design method and methods for using them for kissing red tongue sole.Primer provided by the present invention can efficiently and specifically expand Cynoglossus semilaevis and the long ITS1-5.8S-ITS2 rDNA sequence for kissing red tongue sole, and disposably two kinds of species can be expanded simultaneously, it is efficiently quickly and convenient to have the advantages that, and primer is after ITS1-5.8S-ITS2 rDNA sequence amplification, species identification directly can be carried out to it by the length heteroplasmy that gel electrophoresis visually observes ITS1, cost is saved, it is often more important that greatly improve work efficiency and accuracy is very high.
Description
Technical field
The present invention relates to field of molecular biotechnology, more particularly to one kind to kiss red tongue for quickly identifying Cynoglossus semilaevis and length
The primer and its design method and methods for using them of sole.
Background technique
Cynoglossus semilaevis and the long red tongue sole of kiss belong to Pleuronectiformes Cynoglossidae tongue sole category, and the two body is in long ligule, and head left side is
There are 2 nostrils, there are 3 side lines on the left of body, it is very close in form.Mainly pass through fin ray number, lateral line scales, vertebra number equal difference
It is different to distinguish.But since it from scale after water is easy to fall off, both cause to be difficult to reflect based on traditional morphology
It is fixed, thus lead to the confusion on Identification of Species and phyletic evolution；And by the differences such as observation fin ray number, lateral line scales and vertebra number into
Row identification, takes time and effort.
The region ribosomes ITS (ITS1-5.8S-ITS2) is one section and is located at rRNA encoding gene 18S rDNA and 28S
One section of gene among rDNA, including two sections of noncoding regions (ITS1 and ITS2) and one section of code area (5.8S rDNA) are evolved
Rate is relatively fast, tends to be similar substantially in kind, and then assumes a marked difference in inter-species, and different types of ITS long
Spend difference clearly.
Summary of the invention
Cynoglossus semilaevis and the long red tongue sole of kiss can rapidly and accurately be identified to solve to have no effective ways at present, and only
Based on traditional morphological observation, its biomorph feature is easy to cause the confusion on Identification of Species and phyletic evolution, and passes through sight
It surveys the differences such as fin ray number, lateral line scales and vertebra number and carries out the problems such as identification takes time and effort, the present invention provides one kind for quick
Identify Cynoglossus semilaevis and the long primer and its design method and methods for using them for kissing red tongue sole.It, which first has to realize, quickly primer
The purpose designed and prepared to effect, and realize that kissing red tongue sole to Cynoglossus semilaevis and length is quickly and effectively identified by the primer
Purpose.
To achieve the above object, the invention adopts the following technical scheme:
It is a kind of to kiss the primer of red tongue sole for quickly identifying Cynoglossus semilaevis and length, it is described for quickly identifying Cynoglossus semilaevis and long kiss
Forward primer is SEQ ID NO.1:5 '-TCGCTACTACCGATTGGATGGTTTA-3 ', reverse primer in the primer of red tongue sole
For SEQ ID NO.2:5 '-GCTCTTCCCTCTTCACTCG-3 '.
A kind of design method of the primer for quickly identifying Cynoglossus semilaevis and growing the red tongue sole of kiss, the method are as follows:
Cynoglossus semilaevis and the long rDNA sequence for kissing red tongue sole are downloaded in Genbank database, and multiple alignment is carried out to these sequences, point
Find out region more biggish than more conservative sequence and variation at 3 ' ends and 5 ' ends, and the 18S rDNA that guards at both ends and
Design primer on 28S rDNA amplifies the very close tongue sole fish ITS1-5.8S-ITS2 sequence of two kinds of forms.
A kind of application method of above-mentioned primer, the primer can be used for Cynoglossus semilaevis and the long identification for kissing red tongue sole.
Preferably, it is described identification the following steps are included:
1) DNA extraction agent box method extracts Cynoglossus semilaevis to be measured and the long rDNA for kissing red tongue sole；
2) using primer described in claim 1, and using Cynoglossus semilaevis to be measured and the long rDNA for kissing red tongue sole as template, into
Row PCR amplification, obtains amplified production；
3) gel electrophoresis is carried out to amplified production, RNA isolation kit is tapped and recovered amplified fragments, the amplified fragments that recycling is obtained into
Row observation and identification.
Preferably, casting out its incidence, only from it to avoid intestinal contents from polluting when step 1) the extraction rDNA
Extract rDNA in tail portion.
Preferably, the reaction system of the step 2) PCR amplification forms are as follows: dNTP2 μ L, the 10 × TaqDNA of 2.5mM
Polymerase Buffer2.5 μ L, 10 μM of forward primer SEQ ID NO.1 and each 1 μ L of reverse primer SEQ ID NO.2,5U/ μ L
0.2 μ L of Taq DNA polymerase, 100g/ μ L 1 μ L of rDNA template solution and sterilizing 17.3 μ L of distilled water；
The PCR amplification condition are as follows: 95 DEG C of initial denaturation 5min, subsequent 95 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 60s,
35 circulations are carried out altogether, are finally carried out 72 DEG C of extension 5min, are saved under the conditions of 4 DEG C.
Preferably, the step 3) gel electrophoresis is carried out using 1.0% Ago-Gel.
Preferably, observation described in step 3) can be carried out by directly visually observing, and compare recycled amplification piece
Segment length carries out Rapid identification.
The beneficial effects of the present invention are:
1) provided by the present invention efficiently and specifically to expand for quickly identifying Cynoglossus semilaevis and the long primer for kissing red tongue sole
Increase Cynoglossus semilaevis and the long ITS1-5.8S-ITS2rDNA sequence for kissing red tongue sole, and disposably two kinds of species can be carried out simultaneously
Amplification, it is efficiently quickly and convenient to have the advantages that；
2) provided by the present invention for quickly identifying Cynoglossus semilaevis and the long primer for kissing red tongue sole in ITS1-5.8S-
After ITS2rDNA sequence amplification, species mirror directly can be carried out to it by the length heteroplasmy that gel electrophoresis visually observes ITS1
Not, the Morphological Identification program of very complicated had not only been eliminated, but also has saved cost, it is often more important that had been greatly improved work efficiency simultaneously
And accuracy is very high.
Detailed description of the invention
Fig. 1 is gained map after carrying out gel electrophoresis in the embodiment of the present invention；
In figure, M DL2000,1 is Cynoglossus semilaevis, and 2 kiss red tongue sole to be long.
Specific embodiment
Further clear detailed description explanation is made to the present invention below in conjunction with specific embodiment and Figure of description.This
Field those of ordinary skill will realize the present invention based on these explanations.In addition, being related in following the description
The embodiment of the present invention be generally only an of the invention branch embodiment, instead of all the embodiments.Therefore, it is based on this hair
Embodiment in bright, those of ordinary skill in the art's every other reality obtained without making creative work
Example is applied, should fall within the scope of the present invention.
Embodiment
The preparation of primer:
S1 Cynoglossus semilaevis and the long rDNA sequence for kissing red tongue sole) are downloaded in Genbank database；
S2 multiple alignment) is carried out to the obtained rDNA sequence of downloading, respectively 3 ' ends and 5 ' ends find out than more conservative sequence with
And the biggish region of variation；
S3) the design primer on 18S rDNA and the 28S rDNA that both ends are guarded amplifies the very close tongue sole of two kinds of forms
Fish ITS1-5.8S-ITS2 sequence, gained primer are
Forward primer SEQ ID NO.1:5 '-TCGCTACTACCGATTGGATGGTTTA-3 '；
Reverse primer SEQ ID NO.2:5 '-GCTCTTCCCTCTTCACTCG-3 '.
It is expanded and is identified using the above-mentioned primer pair Cynoglossus semilaevis being prepared and the long red tongue sole of kiss, specific steps
It is as follows:
1) Cynoglossus semilaevis and long acquisition, identification and the preservation for kissing red tongue sole
Cynoglossus semilaevis used in the present embodiment and the long red tongue sole sample of kiss pick up from the natural environment of field, and in its morphology
Feature disappear before it is carried out type determine, institute's sample thief take back laboratory be made sample go forward side by side row information registration.Type mirror
Surely the Cynoglossus semilaevis and long kiss 100% absolute alcohol of red tongue sole sample completed are impregnated and are stored in spare in 4 DEG C of refrigerator；
2) Cynoglossus semilaevis and the long DNA for kissing red tongue sole are extracted
Cynoglossus semilaevis to be measured and the long rDNA for kissing red tongue sole are extracted using DNA extraction agent box method, to avoid intestinal contents dirty
Dye, casts out its incidence, only extracts rDNA from its tail portion, and rDNA extraction directlys adopt DNA extraction kit progress, and extraction obtains
Cynoglossus semilaevis and the long rDNA for kissing red tongue sole be stored in -20 DEG C under the conditions of it is spare；
3) PCR amplification
The reaction system of PCR amplification forms are as follows: dNTP2 μ L, 10 × Taq DNA polymerase Buffer2.5 μ L, 10 μM of 2.5mM
Forward primer SEQ ID NO.1 and each 1 μ L of reverse primer SEQ ID NO.2,5U/ μ L 0.2 μ L of Taq DNA polymerase,
The 1 μ L of rDNA template solution and sterilizing 17.3 μ L of distilled water of 100g/ μ L；
The PCR amplification condition are as follows: 95 DEG C of initial denaturation 5min, subsequent 95 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 60s,
35 circulations are carried out altogether, are finally carried out 72 DEG C of extension 5min, are saved amplified production under the conditions of 4 DEG C；
4) observation and identification of pcr amplification product
1.0% agarose gel electrophoresis of PCR product, the segment expanded are all made of RNA isolation kit and are tapped and recovered, to recycling institute
The amplified production obtained is visually observed, and the judgement of accurate quick can be carried out by the form of its amplified production, such as Fig. 1 institute
Show, 1 is Cynoglossus semilaevis in Fig. 1, and 2 kiss red tongue sole to be long, and difference is fairly obvious, can observe by the naked eye direct judgement.
Cynoglossus semilaevis is sequenced, sequencing result is SEQ ID NO.3:5 '-TCGCTACTACCGATTGGATGG
TTTAGTGAGGTCCTCGGATCGGCCCCGCCGGATTCGGC AACGGCCCTGGCGGAGCGCCGAGAAGACGATCAAACT
TGACTATCTAGAGGAAGTAAA AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATCACCGGTCGGC
GGGC CTGGCGGTCACTGCCGCAGCCTACAGAGCGCGCGCCGGTCGCGGACGAGGCGGGCGCA GGGGAGCGAGGA
CCGGCGCAGCCGTCGTCGCCCGCCGGAAAGCGCCGCCGTCCCCGG GAGAGGGGGGCGAACCTCATTCCCTCTCAG
TATCAAACCAGGACCCCCAGTCTGTGCCG CCCCTGTCCTCCACGAGGAGGGGGAGCCGGTCAGTTGGAACTCCGC
CGGACGGGTACC CAACCCTCCGTGCTCCCTCGGAGCACGGCGGAGGGGTTAATATCTCCCTCCTCCCGCTC CCG
GGGCGGCCCGGAGTGCCTGTCCGTTTGGTTATCGTTGTCACCCCACACCTCTCAGC AGGACCTTGGCCGTCTGAA
CGAGCGAGCGTGTTGTACAACTCTTAGCGGCGGATCACTC GGTTCGTGCGTCGATGAAGAACGCAGCTAGCTGCG
AGAATTAATGTGACTTGCAGGACG CATTGATCATCGACACTTTGAACGCACATTGCGGCCCCGAGCTCTGCCCGG
GGCTACGC CTGTCTGAGGGTCGCTCTTCCATCAATCGGGGTCAACCTCCCCGCGGATGGGGTTCGTC GCAGTCC
GCACGCCGGTCTTCGTCCCCCCCCCCCCCCCCCAAGTGCAGACCTCCGAGCC CCAACGCCCGTGGCGTCGCCTCC
CCGCCGTTGGGGTGGGCGCGACGCGGCTGCCGGCC GACCTCCCAGCTGCCCGCGCCACCCACCACCGCTTTGGCT
GTGGGAGGCAAAGCCCGG CGCCCGGCTTACCGCGCGCGCGATCCAGGGGACCGTGAGCCTCGCGCCACGAAGCCCC
CACATCGACTACGACCTCAGATCAGGCGAGACGACCCGCTGAACTTAAGCATATCACTA GGCGGAGGAAGAGAAA
CTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGAGGGAAG AGC-3'；
The long red tongue sole of kiss is sequenced, sequencing result is SEQ ID NO.4:5 '-TCGCTACTACCGATTGGATGGTT
TAGTGAGGTCCTCGGATCGGCCCCGCCGGGGTCGGC AACGGCCCTGGCGGAGCGCCGAGAAGACGATCAAACTTG
ACTATCTAGAGGAAGTAAA GGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGGTTTGGCG
GGC CCAGGCCGCAGCCAGCACCGCGACGCTCTCTCCCCGGTCGAGGACGGCGCGCCCAGCG CCGCCGTCCCCGG
GCGGTCGGGAACGGGAAGGGACGGACGGACTCCGTTCGGCCCGCT CGCCCCGCCGCCCTCTCCGTCTCCTCCCCG
TAGTCCGGGCCGCGCCACCGTCGTCGCCG ACCACGGGACGGCGCGGCCCGCCACGACGGAACCCAGACACAGCGC
CGAGCCCGCGC GGCGAGGCGCGCCGGACGGGTACCCAACCAACTCTCCGTTCTCCGGCGGAGGACGGCG GGGGG
TTCAATATCTCCGCTCTCGCGCGCCGCGCGCCCCGGACCGTCCCCTCGCGGGCC GGGAAGGGGCCGTTGCGCGCG
GCCCGGAGTGCCCGCCCCGGTTTCCCTCGGGGAGTGC CAGCGCGCGACGCTGACGCACGCCCCGAGTCTCGGTCG
CACACTCTCCGTGAAGAAAC GCTTGGCCCTTTTGACGAAAGCGGACGCGGCGCCACAGCGTCGCTCCGCGCTCAC
ACA CACACACACACACAGTGTCTACAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGAT GAAGAACGCAGC
TAGCTGCGAGAACTAATGTGAATTGCAGGACACATTGATCATCGACA TTTCGAACGCACCTTGCGGCCCCGGGTT
CTTCCCGGGGCTACGCCTGTCTGAGGGTCGC TTTGCCATCAATCAGGGAAAAGCTCCCCGCGGCTGGGGTTTCTT
CGTCGCAGGCCCGAA CCGGCCTCCGTGCCCCCAAGTGCAGACCTCTGAGCCCATAGCCCGCGGCTCCGCCTCCC
CGGACCCCAGCGGGTTTCGCGAGGCGCACGCGGCTGCCGGTGGACCCTCACGGTCTCC GAGCTGCCCGCGACGTG
CCGAGCGGACCCCTCGGACGCAGGGGAAGAAGGGCGGACC GCCGCGAGCGCCGCGTCCCCCCCCGGACGCCGCGC
GCCACATCTGACTACGACCTCAGA TCAGACGAGACAACCCGCTGAATTTAAGCATATTACTAAGCGGAGGAAAAG
AAACTAAC CAGGATTCCCTCAGTAGCGGCGAGTGAAGAGGGAAGAGC-3’。
Sequence table
<110>Zhejiang Ocean university
<120>a kind of for quickly identifying Cynoglossus semilaevis and the long primer and its design method and methods for using them for kissing red tongue sole
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213>forward primer (Forward primer)
<400> 1
tcgctactac cgattggatg gttta 25
<210> 2
<211> 19
<212> DNA
<213>reverse primer (Reverse primer)
<400> 2
gctcttccct cttcactcg 19
<210> 3
<211> 1113
<212> DNA
<213>Cynoglossus semilaevis (Cynoglossus semilaevis Gunther)
<400> 3
tcgctactac cgattggatg gtttagtgag gtcctcggat cggccccgcc ggattcggca 60
acggccctgg cggagcgccg agaagacgat caaacttgac tatctagagg aagtaaaagt 120
cgtaacaagg tttccgtagg tgaacctgcg gaaggatcat caccggtcgg cgggcctggc 180
ggtcactgcc gcagcctaca gagcgcgcgc cggtcgcgga cgaggcgggc gcaggggagc 240
gaggaccggc gcagccgtcg tcgcccgccg gaaagcgccg ccgtccccgg gagagggggg 300
cgaacctcat tccctctcag tatcaaacca ggacccccag tctgtgccgc ccctgtcctc 360
cacgaggagg gggagccggt cagttggaac tccgccggac gggtacccaa ccctccgtgc 420
tccctcggag cacggcggag gggttaatat ctccctcctc ccgctcccgg ggcggcccgg 480
agtgcctgtc cgtttggtta tcgttgtcac cccacacctc tcagcaggac cttggccgtc 540
tgaacgagcg agcgtgttgt acaactctta gcggcggatc actcggttcg tgcgtcgatg 600
aagaacgcag ctagctgcga gaattaatgt gacttgcagg acgcattgat catcgacact 660
ttgaacgcac attgcggccc cgagctctgc ccggggctac gcctgtctga gggtcgctct 720
tccatcaatc ggggtcaacc tccccgcgga tggggttcgt cgcagtccgc acgccggtct 780
tcgtcccccc cccccccccc caagtgcaga cctccgagcc ccaacgcccg tggcgtcgcc 840
tccccgccgt tggggtgggc gcgacgcggc tgccggccga cctcccagct gcccgcgcca 900
cccaccaccg ctttggctgt gggaggcaaa gcccggcgcc cggcttaccg cgcgcgcgat 960
ccaggggacc gtgagcctcg cgccacgaag cccccacatc gactacgacc tcagatcagg 1020
cgagacgacc cgctgaactt aagcatatca ctaggcggag gaagagaaac taaccaggat 1080
tccctcagta gcggcgagtg aagagggaag agc 1113
<210> 4
<211> 1266
<212> DNA
<213>long to kiss red tongue sole (Cynoglossus lighti)
<400> 4
tcgctactac cgattggatg gtttagtgag gtcctcggat cggccccgcc ggggtcggca 60
acggccctgg cggagcgccg agaagacgat caaacttgac tatctagagg aagtaaaggt 120
cgtaacaagg tttccgtagg tgaacctgcg gaaggatcat taccggtttg gcgggcccag 180
gccgcagcca gcaccgcgac gctctctccc cggtcgagga cggcgcgccc agcgccgccg 240
tccccgggcg gtcgggaacg ggaagggacg gacggactcc gttcggcccg ctcgccccgc 300
cgccctctcc gtctcctccc cgtagtccgg gccgcgccac cgtcgtcgcc gaccacggga 360
cggcgcggcc cgccacgacg gaacccagac acagcgccga gcccgcgcgg cgaggcgcgc 420
cggacgggta cccaaccaac tctccgttct ccggcggagg acggcggggg gttcaatatc 480
tccgctctcg cgcgccgcgc gccccggacc gtcccctcgc gggccgggaa ggggccgttg 540
cgcgcggccc ggagtgcccg ccccggtttc cctcggggag tgccagcgcg cgacgctgac 600
gcacgccccg agtctcggtc gcacactctc cgtgaagaaa cgcttggccc ttttgacgaa 660
agcggacgcg gcgccacagc gtcgctccgc gctcacacac acacacacac acagtgtcta 720
caactcttag cggtggatca ctcggctcgt gcgtcgatga agaacgcagc tagctgcgag 780
aactaatgtg aattgcagga cacattgatc atcgacattt cgaacgcacc ttgcggcccc 840
gggttcttcc cggggctacg cctgtctgag ggtcgctttg ccatcaatca gggaaaagct 900
ccccgcggct ggggtttctt cgtcgcaggc ccgaaccggc ctccgtgccc ccaagtgcag 960
acctctgagc ccatagcccg cggctccgcc tccccggacc ccagcgggtt tcgcgaggcg 1020
cacgcggctg ccggtggacc ctcacggtct ccgagctgcc cgcgacgtgc cgagcggacc 1080
cctcggacgc aggggaagaa gggcggaccg ccgcgagcgc cgcgtccccc cccggacgcc 1140
gcgcgccaca tctgactacg acctcagatc agacgagaca acccgctgaa tttaagcata 1200
ttactaagcg gaggaaaaga aactaaccag gattccctca gtagcggcga gtgaagaggg 1260
aagagc 1266
Claims (8)
1. a kind of for quickly identifying Cynoglossus semilaevis and the long primer for kissing red tongue sole, which is characterized in that described for quickly identifying
Forward primer is SEQ ID NO.1:5 '-in Cynoglossus semilaevis and the long primer for kissing red tongue sole
TCGCTACTACCGATTGGATGGTTTA-3 ', reverse primer are SEQ ID NO.2:5 '-GCTCTTCCCTCTTCACTCG-3 '.
2. it is a kind of as described in claim 1 for quickly identifying the design method of Cynoglossus semilaevis and the long primer for kissing red tongue sole,
It is characterized in that, the method are as follows: Cynoglossus semilaevis and the long rDNA sequence for kissing red tongue sole are downloaded in Genbank database, to this
A little sequences carry out multiple alignment, hold at 3 ' ends and 5 ' find out region more biggish than more conservative sequence and variation respectively, and
Design primer on conservative 18S rDNA and the 28S rDNA in both ends amplifies the very close tongue sole fish ITS1- of two kinds of forms
5.8S-ITS2 sequence.
3. a kind of application method of primer as described in claim 1, which is characterized in that the primer can be used for Cynoglossus semilaevis and
The long identification for kissing red tongue sole.
4. a kind of application method according to claim 3, which is characterized in that it is described identification the following steps are included:
1) DNA extraction agent box method extracts Cynoglossus semilaevis to be measured and the long rDNA for kissing red tongue sole；
2) using primer described in claim 1, and using Cynoglossus semilaevis to be measured and the long rDNA for kissing red tongue sole as template, into
Row PCR amplification, obtains amplified production；
3) gel electrophoresis is carried out to amplified production, RNA isolation kit is tapped and recovered amplified fragments, the amplified fragments that recycling is obtained into
Row observation and identification.
5. a kind of application method according to claim 4, which is characterized in that avoid intestines when step 1) the extraction rDNA
The pollution of road content, casts out its incidence, only extracts rDNA from its tail portion.
6. a kind of application method according to claim 4, which is characterized in that the reaction system of the step 2) PCR amplification
Composition are as follows: dNTP2 μ L of 2.5mM, 10 × Taq DNA polymerase Buffer2.5 μ L, 10 μM of forward primer SEQ IDNO.1 and
Each 1 μ L of reverse primer SEQ ID NO.2, the 0.2 μ L of Taq DNA polymerase of 5U/ μ L, 100g/ μ L 1 μ L of rDNA template solution and
Sterilize 17.3 μ L of distilled water；
The PCR amplification condition are as follows: 95 DEG C of initial denaturation 5min, subsequent 95 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 60s,
35 circulations are carried out altogether, are finally carried out 72 DEG C of extension 5min, are saved under the conditions of 4 DEG C.
7. a kind of application method according to claim 4, which is characterized in that the step 3) gel electrophoresis uses 1.0%
Ago-Gel carries out.
8. a kind of application method according to claim 4, which is characterized in that observation described in step 3) can pass through direct meat
Eye observation carries out, and compares recycled expanding fragment length and carry out Rapid identification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811231764.6A CN109182550A (en) | 2018-10-22 | 2018-10-22 | It is a kind of to kiss the primer and its design method and methods for using them of red tongue sole for quickly identifying Cynoglossus semilaevis and length |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811231764.6A CN109182550A (en) | 2018-10-22 | 2018-10-22 | It is a kind of to kiss the primer and its design method and methods for using them of red tongue sole for quickly identifying Cynoglossus semilaevis and length |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109182550A true CN109182550A (en) | 2019-01-11 |
Family
ID=64942558
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811231764.6A Pending CN109182550A (en) | 2018-10-22 | 2018-10-22 | It is a kind of to kiss the primer and its design method and methods for using them of red tongue sole for quickly identifying Cynoglossus semilaevis and length |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109182550A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858350A (en) * | 2017-11-20 | 2018-03-30 | 浙江海洋大学 | A kind of universal primer of Pleuronectiformes Soleidae fish ribosomes the Internal Transcribed Spacer 2 and design and amplification method |
| CN107881248A (en) * | 2017-12-15 | 2018-04-06 | 浙江海洋大学 | Pleuronectiformes Soleidae fish ribosomes the Internal Transcribed Spacer 1（ITS1）Universal primer design method and application |
| CN108034731A (en) * | 2017-12-15 | 2018-05-15 | 浙江海洋大学 | A kind of quick molecular biology method for differentiating Zanzibar tongue sole and Nigeria tongue sole |
| CN108148913A (en) * | 2017-12-15 | 2018-06-12 | 浙江海洋大学 | A kind of quick discriminating Japan striped sole and the molecular biology method of tassel squama striped sole |
| CN109097483A (en) * | 2018-10-09 | 2018-12-28 | 浙江海洋大学 | A kind of molecular biology method of quick identification east Symphurus and black cheek Symphurus |
-
2018
- 2018-10-22 CN CN201811231764.6A patent/CN109182550A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858350A (en) * | 2017-11-20 | 2018-03-30 | 浙江海洋大学 | A kind of universal primer of Pleuronectiformes Soleidae fish ribosomes the Internal Transcribed Spacer 2 and design and amplification method |
| CN107881248A (en) * | 2017-12-15 | 2018-04-06 | 浙江海洋大学 | Pleuronectiformes Soleidae fish ribosomes the Internal Transcribed Spacer 1（ITS1）Universal primer design method and application |
| CN108034731A (en) * | 2017-12-15 | 2018-05-15 | 浙江海洋大学 | A kind of quick molecular biology method for differentiating Zanzibar tongue sole and Nigeria tongue sole |
| CN108148913A (en) * | 2017-12-15 | 2018-06-12 | 浙江海洋大学 | A kind of quick discriminating Japan striped sole and the molecular biology method of tassel squama striped sole |
| CN109097483A (en) * | 2018-10-09 | 2018-12-28 | 浙江海洋大学 | A kind of molecular biology method of quick identification east Symphurus and black cheek Symphurus |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105861642B (en) | A kind of acipenser schrencki gender gap opposite sex molecular labeling and detection acipenser schrencki property method for distinguishing | |
| CN103898235B (en) | A kind of DNA bar code method for identifying molecules of Hirudo | |
| CN111394479A (en) | Molecular marker for assisting in fine wool sheep breeding and application method | |
| CN107326077A (en) | A kind of molecular labeling for differentiating spotted maigre genetic sex and its application | |
| CN111471775B (en) | Specific DNA fragment SSM2 for sturgeon gender identification and application | |
| CN112176049B (en) | DNA molecular marker for sex identification of apostichopus japonicus living body and identification method | |
| CN105483217B (en) | A kind of molecule labelling method for identifying rice east wild type cytoplasmic male sterility source | |
| CN101333563B (en) | Sex appraisal process for pigeon for meat | |
| CN110129452A (en) | The molecular labeling and its identification method of a kind of early stage identification duck slaughter paramenter and application | |
| CN101967480A (en) | Molecular marker relevant to chicken skin color and authentication method and application thereof | |
| Takashima et al. | Complete mitochondrial DNA sequence of Atlantic horse mackerel Trachurus trachurus and molecular identification of two commercially important species T. trachurus and T. japonicus using PCR-RFLP | |
| CN105368948A (en) | Primer for sex identification of Nile tilapia and PCR (polymerase chain reaction) identification method | |
| CN109880893B (en) | Specific DNA fragment for sex identification of mystus guttatus and application | |
| CN102758016B (en) | Kit for simply, conveniently and rapidly detecting sheep multifetal gene BMPR-IB (bone morphogenetic protein receptor IB) | |
| CN107858350B (en) | Floundles sole family fish ribose in vivo transcription spacer region 2 universal primer and design and amplification method | |
| CN109182550A (en) | It is a kind of to kiss the primer and its design method and methods for using them of red tongue sole for quickly identifying Cynoglossus semilaevis and length | |
| CN112746070A (en) | Primer pair and kit for early sex identification of chicken and application of primer pair and kit | |
| CN102041310A (en) | Method for detecting rose cockscomb character | |
| CN108754010B (en) | Method for rapidly detecting genome DNA residues in total RNA sample | |
| CN102134600B (en) | PCR (Polymerase Chain Reaction) method for sex appraisal of Nipponia nippon | |
| CN109182551A (en) | A kind of primer and its design method and methods for using them for quick band line striped sole and angle sole | |
| CN103421771A (en) | Genetic marker for character of litter size of pig utilizing WIF1 gene | |
| CN103725688A (en) | Molecular markers related with antibody level of newcastle disease virus as well as identification method and application of molecular markers | |
| CN104531688A (en) | Spider mitochondria genome complete sequence amplification primer and amplification method | |
| CN104694650A (en) | Molecular detection method for identifying chicken feed utilization efficiency as well as application of method and molecular detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190111 |