CN109182551A - A kind of primer and its design method and methods for using them for quick band line striped sole and angle sole - Google Patents
A kind of primer and its design method and methods for using them for quick band line striped sole and angle sole Download PDFInfo
- Publication number
- CN109182551A CN109182551A CN201811231781.XA CN201811231781A CN109182551A CN 109182551 A CN109182551 A CN 109182551A CN 201811231781 A CN201811231781 A CN 201811231781A CN 109182551 A CN109182551 A CN 109182551A
- Authority
- CN
- China
- Prior art keywords
- sole
- primer
- angle
- rdna
- band line
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to field of molecular biotechnology, band line striped sole and angle sole can rapidly and accurately be identified to solve to have no effective ways at present, and it is based only upon the problems such as traditional morphological observation its biomorph feature is easy to cause the confusion on Identification of Species and phyletic evolution, the present invention provides a kind of primers and its design method and methods for using them for quick band line striped sole and angle sole.Primer provided by the present invention can efficiently and the ITS1-5.8S-ITS2 rDNA sequence of specifically amplified band line striped sole and angle sole, and disposably two kinds of species can be expanded simultaneously, it is efficiently quickly and convenient to have the advantages that, and primer is after ITS1-5.8S-ITS2 rDNA sequence amplification, species identification directly can be carried out to it by the length heteroplasmy that gel electrophoresis visually observes ITS1, cost is saved, it is often more important that greatly improve work efficiency and accuracy is very high.
Description
Technical field
The present invention relates to field of molecular biotechnology more particularly to a kind of drawing for quick band line striped sole and angle sole
Object and its design method and methods for using them.
Background technique
Band line striped sole and angle sole belong to Pleuronectiformes Soleidae, very close in form, mainly by interorbital space whether there is or not scale,
Tail portion spot colors distinguish.But since it from spot colors after water is easy to change, and scale is also easy to take off
It falls, the two is caused to be difficult to be identified based on traditional morphology, thus lead to the confusion on Identification of Species and phyletic evolution.
The region ribosomes ITS (ITS1-5.8S-ITS2) is one section and is located at rRNA encoding gene 18S rDNA and 28S
One section of gene among rDNA, including two sections of noncoding regions (ITS1 and ITS2) and one section of code area (5.8S rDNA) are evolved
Rate is relatively fast, tends to be similar substantially in kind, and then assumes a marked difference in inter-species, and different types of ITS long
Spend difference clearly.
Summary of the invention
Band line striped sole and angle sole can rapidly and accurately be identified to solve to have no effective ways at present, and be based only upon biography
The problems such as its biomorph feature of the morphological observation of system is easy to cause the confusion on Identification of Species and phyletic evolution, the present invention mentions
A kind of primer and its design method and methods for using them for quick band line striped sole and angle sole is supplied.It first has to realization pair
The purpose that primer fast and effeciently designs and prepares, and realized by the primer and band line striped sole and angle sole are carried out quickly and effectively
The purpose of identification.
To achieve the above object, the invention adopts the following technical scheme:
A kind of primer for quick band line striped sole and angle sole, the primer for quick band line striped sole and angle sole
Middle forward primer is SEQ ID NO.1:5 '-TCGCTACTACCGATTGGATGGTTTA-3 ', and reverse primer is SEQ ID
NO.2:5 '-GCTCTTCCCTCTTCACTCG-3 '.
A kind of design method of the primer for quick band line striped sole and angle sole, the method are as follows: Genbank data
These sequences are carried out multiple alignment by the rDNA sequence of lower carrier band line striped sole and angle sole in library, are found out respectively at 3 ' ends and 5 ' ends
Region more biggish than more conservative sequence and variation, and the design primer on 18S rDNA and the 28S rDNA that both ends are guarded,
Amplify the very close sole class ITS1-5.8S-ITS2 sequence of two kinds of forms.
A kind of application method of above-mentioned primer, the primer can be used for the identification with line striped sole and angle sole.
Preferably, it is described identification the following steps are included:
1) DNA extraction agent box method extracts the rDNA to measuring tape line striped sole and angle sole；
2) using primer described in claim 1, and, as template, to carry out PCR to the rDNA of measuring tape line striped sole and angle sole
Amplification, obtains amplified production；
3) gel electrophoresis is carried out to amplified production, RNA isolation kit is tapped and recovered amplified fragments, the amplified fragments that recycling is obtained into
Row observation and identification.
Preferably, casting out its incidence, only from it to avoid intestinal contents from polluting when step 1) the extraction rDNA
Extract rDNA in tail portion.
Preferably, the reaction system of the step 2) PCR amplification forms are as follows: dNTP2 μ L, the 10 × TaqDNA of 2.5mM
Polymerase Buffer2.5 μ L, 10 μM of forward primer SEQ ID NO.1 and each 1 μ L of reverse primer SEQ ID NO.2,5U/ μ L
0.2 μ L of Taq DNA polymerase, 100g/ μ L 1 μ L of rDNA template solution and sterilizing 17.3 μ L of distilled water；
The PCR amplification condition are as follows: 95 DEG C of initial denaturation 5min, subsequent 95 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 60s,
35 circulations are carried out altogether, are finally carried out 72 DEG C of extension 5min, are saved under the conditions of 4 DEG C.
Preferably, the step 3) gel electrophoresis is carried out using 1.0% Ago-Gel.
Preferably, observation described in step 3) can be carried out by directly visually observing, and compare recycled amplification piece
Segment length carries out Rapid identification.
The beneficial effects of the present invention are:
1) primer provided by the present invention for quick band line striped sole and angle sole can efficiently and specifically amplified band line
The ITS1-5.8S-ITS2rDNA sequence of striped sole and angle sole, and disposably two kinds of species can be expanded simultaneously, there is height
The quick and convenient advantage of effect；
2) primer provided by the present invention for being used for quick band line striped sole and angle sole is in ITS1-5.8S-ITS2rDNA sequence
After amplification, species identification directly can be carried out to it by the length heteroplasmy that gel electrophoresis visually observes ITS1, both eliminated numerous
The Morphological Identification program of trivial complexity, and saved cost, it is often more important that greatly improve work efficiency and accuracy very
It is high.
Detailed description of the invention
Fig. 1 is gained map after carrying out gel electrophoresis in the embodiment of the present invention；
In figure, M DL2000,1 is band line striped sole, and 2 be angle sole.
Specific embodiment
Further clear detailed description explanation is made to the present invention below in conjunction with specific embodiment and Figure of description.This
Field those of ordinary skill will realize the present invention based on these explanations.In addition, being related in following the description
The embodiment of the present invention be generally only an of the invention branch embodiment, instead of all the embodiments.Therefore, it is based on this hair
Embodiment in bright, those of ordinary skill in the art's every other reality obtained without making creative work
Example is applied, should fall within the scope of the present invention.
Embodiment
The preparation of primer:
S1) the lower rDNA sequence for carrying line striped sole and angle sole in Genbank database；
S2 multiple alignment) is carried out to the obtained rDNA sequence of downloading, respectively 3 ' ends and 5 ' ends find out than more conservative sequence with
And the biggish region of variation；
S3) the design primer on 18S rDNA and the 28S rDNA that both ends are guarded amplifies the very close sole class of two kinds of forms
ITS1-5.8S-ITS2 sequence, gained primer are
Forward primer SEQ ID NO.1:5 '-TCGCTACTACCGATTGGATGGTTTA-3 '；
Reverse primer SEQ ID NO.2:5 '-GCTCTTCCCTCTTCACTCG-3 '.
It is expanded and is identified using the above-mentioned primer pair band line striped sole being prepared and angle sole, the specific steps of which are as follows:
1) acquisition, identification and preservation with line striped sole and angle sole
Band line striped sole and angle sole sample used in the present embodiment pick up from the natural environment of field, and disappear in its morphological feature
Lose before it is carried out type determine, institute's sample thief take back laboratory be made sample go forward side by side row information registration.Identification of Species is completed
Impregnate and be stored in spare in 4 DEG C of refrigerator with line striped sole and 100% absolute alcohol of angle sole sample；
2) it is extracted with the DNA of line striped sole and angle sole
Cast out using the rDNA that DNA extraction agent box method is extracted to measuring tape line striped sole and angle sole to avoid intestinal contents from polluting
Its incidence only extracts rDNA from its tail portion, and rDNA extraction directlys adopt DNA extraction kit progress, the band line extracted
The rDNA of striped sole and angle sole is spare under the conditions of being stored in -20 DEG C；
3) PCR amplification
The reaction system of PCR amplification forms are as follows: dNTP2 μ L, 10 × Taq DNA polymerase Buffer2.5 μ L, 10 μM of 2.5mM
Forward primer SEQ ID NO.1 and each 1 μ L of reverse primer SEQ ID NO.2,5U/ μ L 0.2 μ L of Taq DNA polymerase,
The 1 μ L of rDNA template solution and sterilizing 17.3 μ L of distilled water of 100g/ μ L；
The PCR amplification condition are as follows: 95 DEG C of initial denaturation 5min, subsequent 95 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 60s,
35 circulations are carried out altogether, are finally carried out 72 DEG C of extension 5min, are saved amplified production under the conditions of 4 DEG C；
4) observation and identification of pcr amplification product
1.0% agarose gel electrophoresis of PCR product, the segment expanded are all made of RNA isolation kit and are tapped and recovered, to recycling institute
The amplified production obtained is visually observed, and the judgement of accurate quick can be carried out by the form of its amplified production, such as Fig. 1 institute
Show, 1 is angle sole for band line striped sole, 2 in Fig. 1, and difference is fairly obvious, can observe by the naked eye direct judgement.
Cynoglossus semilaevis is sequenced, sequencing result is SEQ ID NO.3:5 '-TCGCTACTACCGATTGGATGGT
TTAGTGAGGTCCTCGGATCGGCCCCGCCGGGGTCGGT CACGGCCCTGGCGGAGCGCCGAGAAGACGATCAAACTT
GACTATCTAGAGGAAGTAAA AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGCGCGC
CAGG CGGGTGGCCCCCGCAACCCGGCCTGCGCGAGACCCCCGGACGCTTAGGGCGCCCCCGG CGCCCGAGGTGA
GCGGTTGGGGCGCGACCCCCTCCGCCCTTTTTCACCTCCCCTCCCCT CTTTGGTCCGGGGCCGTGTTCCCCGCGA
GAGAGCGCCCCTCTCTCCACCGGGGGCTGGC CCCACTCCAACCACCGGAACCAAACACCCCAATGCGCGGGGTGG
GAGCATATACACTCC TCCCCGCGCGCCGACCGGGTACCCAACTCTCCACGCTCCCCCGGAGGGTGGCGGGGGG T
TCAATGTCTCTCCGGAGCGCCCGGCTGTCCGGAAAAAGGCTCGGAAACCCAGACTATG AAACCCCGTTGGCGGCT
TGGCACAGGTTGAAAAACAAAAAGAAAGAGAACAAACAAC TCTTAGCGGTGGATCACTTGGCTCGTGCGTCGATG
AAGGACGCAGCTAGCTGCGAGAAC TAATGTGAATTGCAGGACACATTGATCATTGACACTTCGAACGCACCTTGC
GGCCCCGG GTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTGCCATCAATCGGAGACGCCCGC GTCTCCG
CGGCTGGGGCAGTCGCAGGCCGCGCAGGCCTCCGTCCCCCCGAGTGCAGAC CGAGATGGCCGGAACGGAACGGAG
CGTTTCCGGGGCCGAAAAACCCCCCACCCCCCCG CGCGCGCACGAGCCGGGCGCGGCTGCCGGTGGACTCTCGGG
TCTCCGCGCTGCCCGCG TTACGCGTGCGCCGCACCCGGGTGGGGTCGGCCCCTCTGCCCCCGACCGCGCCGGCCG
CCCAGCGCGCCCCGACGGGGGCGCCGGGCGACATCACCTCGTTCGACTACGACCTCAG ATCAGACGAGACGACCC
GCTGAATTTAAGCATATTACTAAGCGGAGGAAAAGAAACTAA CCAGGATTCCCTCAGTAGCGGCGAGTGAAGAGG
GAAGAGC-3'；
Diagonal sole is sequenced, and sequencing result is SEQ ID NO.4:5 '-TCGCTACTACCGATTGGATGGTTTAGTGA
GGTCCTCGGATCGGCCCCGCCGGGGTCGGT CACGGCCCCGGCGGAGCGCCGAGAAGACGATCAAACTTGACTATC
TAGAGGAAGTAAA AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCAGAAGGATCATTACCGAGCCGGCCTGG CG
GAGTGCTACCCCACTCGGCCTGCGCCACGTTTGTCCCCGGGACGCCCAGGGTGCGC GCTCGCCGCCGCCCGAGGC
GAGGGAGGCGGCGGCGGCGGCTGCGGGGGGTGGTTGTG GCGGTGGTTGTGGCGGGGGTTGGTGGCGGCGCCGTCG
CGCGCCCCCTCCTGCTCCCCC ACCTCCTCCTCCACCGCCTCCCCCCCTCCGCCTCCCCTCTCTCTCTCTCTCTTC
CCCCCTC TGGTCCGGGGCACCGTCCCCGCGAGAGAGCGCTCCTCTCTCCACCGGGCTTGCCCCCCA AAAAACAA
CGGAACCTCTGACCCAGCGCGGTGCGGGGTTGGGCGACGCAGCCCCTCCC CCCCCGCGCGCCGACCGGGTACCCA
ACCTTCCGCCCTCCCCCGGGGCGGCGGGGGGTT CAATGTCTCCCCGGAGCGCCCGGCCGGTTGAAAGAGTCTGTC
CCCCGAAACCATGAAA CCGGTCTTTGGCGGATTGGCAAAGAAAAACGAAAACAAAAAAGAGTACAACTCTTAGC
GGTGGATCACTTGGCTCGTGCGTCGATGAAGGACGCAGCTAGCTGCGAGAACTAATGTG AATTGCAGGACACATT
GATCATTGACACTTCGAACGCACCTTGCGGCCCCGGGTTCCTC CCGGGGCTACGCCTGTCTGAGGGTCGCTTTGC
CATCAATCGGAGACGCCCGCGTGCGCC TCCGCGGCTGGGGCAGTCGCAGGCCCGGGGCCCACGCGCCTCGGCCTC
CGTCCCCCCA AGTGCAGACCACCTCGCGGAGAGAGAGCAGCGACTCCTGCCCCCGCCCGACGCACGA GCCGGGC
GCGGCTGCCGGTGGACTCCAGGGTCTCCGCGCTGCCCGCGCTACGCGTGCG CCGCGTGCGGGTCGGGTCTCTCTG
CCCCGCTGCCCAGCGCGACGGGCGGGAGGGCGTC GGAAAAAGACGCCCGCCCCCGCCCGCCGCCGGGCGCCAGCA
AACCTCCTTCGACTACG ACCTCAGATCAGACGAGACGACCCGCTGAATTTAAGCATATTACTAAGCGGAGGAAAAG
AAACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGAGGGAAGAGC-3’。
Sequence table
<110>Zhejiang Ocean university
<120>a kind of primer and its design method and methods for using them for quick band line striped sole and angle sole
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213>forward primer (Forward primer)
<400> 1
tcgctactac cgattggatg gttta 25
<210> 2
<211> 19
<212> DNA
<213>reverse primer (Reverse primer)
<400> 2
gctcttccct cttcactcg 19
<210> 3
<211> 1151
<212> DNA
<213>band line striped sole (Zebrias zebra Bloch et Schneider)
<400> 3
tcgctactac cgattggatg gtttagtgag gtcctcggat cggccccgcc ggggtcggtc 60
acggccctgg cggagcgccg agaagacgat caaacttgac tatctagagg aagtaaaagt 120
cgtaacaagg tttccgtagg tgaacctgcg gaaggatcat taccgagcgc gccaggcggg 180
tggcccccgc aacccggcct gcgcgagacc cccggacgct tagggcgccc ccggcgcccg 240
aggtgagcgg ttggggcgcg accccctccg ccctttttca cctcccctcc cctctttggt 300
ccggggccgt gttccccgcg agagagcgcc cctctctcca ccgggggctg gccccactcc 360
aaccaccgga accaaacacc ccaatgcgcg gggtgggagc atatacactc ctccccgcgc 420
gccgaccggg tacccaactc tccacgctcc cccggagggt ggcggggggt tcaatgtctc 480
tccggagcgc ccggctgtcc ggaaaaaggc tcggaaaccc agactatgaa accccgttgg 540
cggcttggca caggttgaaa aacaaaaaga aagagaacaa acaactctta gcggtggatc 600
acttggctcg tgcgtcgatg aaggacgcag ctagctgcga gaactaatgt gaattgcagg 660
acacattgat cattgacact tcgaacgcac cttgcggccc cgggttcctc ccggggctac 720
gcctgtctga gggtcgcttt gccatcaatc ggagacgccc gcgtctccgc ggctggggca 780
gtcgcaggcc gcgcaggcct ccgtcccccc gagtgcagac cgagatggcc ggaacggaac 840
ggagcgtttc cggggccgaa aaacccccca cccccccgcg cgcgcacgag ccgggcgcgg 900
ctgccggtgg actctcgggt ctccgcgctg cccgcgttac gcgtgcgccg cacccgggtg 960
gggtcggccc ctctgccccc gaccgcgccg gccgcccagc gcgccccgac gggggcgccg 1020
ggcgacatca cctcgttcga ctacgacctc agatcagacg agacgacccg ctgaatttaa 1080
gcatattact aagcggagga aaagaaacta accaggattc cctcagtagc ggcgagtgaa 1140
gagggaagag c 1151
<210> 4
<211> 1273
<212> DNA
<213>angle sole (Horn)
<400> 4
tcgctactac cgattggatg gtttagtgag gtcctcggat cggccccgcc ggggtcggtc 60
acggccccgg cggagcgccg agaagacgat caaacttgac tatctagagg aagtaaaagt 120
cgtaacaagg tttccgtagg tgaacctgca gaaggatcat taccgagccg gcctggcgga 180
gtgctacccc actcggcctg cgccacgttt gtccccggga cgcccagggt gcgcgctcgc 240
cgccgcccga ggcgagggag gcggcggcgg cggctgcggg gggtggttgt ggcggtggtt 300
gtggcggggg ttggtggcgg cgccgtcgcg cgccccctcc tgctccccca cctcctcctc 360
caccgcctcc ccccctccgc ctcccctctc tctctctctc ttcccccctc tggtccgggg 420
caccgtcccc gcgagagagc gctcctctct ccaccgggct tgccccccaa aaaacaacgg 480
aacctctgac ccagcgcggt gcggggttgg gcgacgcagc ccctcccccc ccgcgcgccg 540
accgggtacc caaccttccg ccctcccccg gggcggcggg gggttcaatg tctccccgga 600
gcgcccggcc ggttgaaaga gtctgtcccc cgaaaccatg aaaccggtct ttggcggatt 660
ggcaaagaaa aacgaaaaca aaaaagagta caactcttag cggtggatca cttggctcgt 720
gcgtcgatga aggacgcagc tagctgcgag aactaatgtg aattgcagga cacattgatc 780
attgacactt cgaacgcacc ttgcggcccc gggttcctcc cggggctacg cctgtctgag 840
ggtcgctttg ccatcaatcg gagacgcccg cgtgcgcctc cgcggctggg gcagtcgcag 900
gcccggggcc cacgcgcctc ggcctccgtc cccccaagtg cagaccacct cgcggagaga 960
gagcagcgac tcctgccccc gcccgacgca cgagccgggc gcggctgccg gtggactcca 1020
gggtctccgc gctgcccgcg ctacgcgtgc gccgcgtgcg ggtcgggtct ctctgccccg 1080
ctgcccagcg cgacgggcgg gagggcgtcg gaaaaagacg cccgcccccg cccgccgccg 1140
ggcgccagca aacctccttc gactacgacc tcagatcaga cgagacgacc cgctgaattt 1200
aagcatatta ctaagcggag gaaaagaaac taaccaggat tccctcagta gcggcgagtg 1260
aagagggaag agc 1273
Claims (8)
1. a kind of primer for quick band line striped sole and angle sole, which is characterized in that described to be used for quick band line item
Forward primer is SEQ ID NO.1:5 '-TCGCTACTACCGATTGGATGGTTTA-3 ' in the primer of sole and angle sole, is reversely drawn
Object is SEQ ID NO.2:5 '-GCTCTTCCCTCTTCACTCG-3 '.
2. a kind of design method for the primer for being used for quick band line striped sole and angle sole as described in claim 1, feature
It is, the method are as follows: the rDNA sequence of lower carrier band line striped sole and angle sole in Genbank database carries out these sequences more
It compares again, finds out region more biggish than more conservative sequence and variation, and the 18S guarded at both ends at 3 ' ends and 5 ' ends respectively
Design primer on rDNA and 28S rDNA amplifies the very close sole class ITS1-5.8S-ITS2 sequence of two kinds of forms.
3. a kind of application method of primer as described in claim 1, which is characterized in that the primer can be used for band line striped sole and
The identification of angle sole.
4. a kind of application method according to claim 3, which is characterized in that it is described identification the following steps are included:
1) DNA extraction agent box method extracts the rDNA to measuring tape line striped sole and angle sole；
2) using primer described in claim 1, and, as template, to carry out PCR to the rDNA of measuring tape line striped sole and angle sole
Amplification, obtains amplified production；
3) gel electrophoresis is carried out to amplified production, RNA isolation kit is tapped and recovered amplified fragments, the amplified fragments that recycling is obtained into
Row observation and identification.
5. a kind of application method according to claim 4, which is characterized in that avoid intestines when step 1) the extraction rDNA
The pollution of road content, casts out its incidence, only extracts rDNA from its tail portion.
6. a kind of application method according to claim 4, which is characterized in that the reaction system of the step 2) PCR amplification
Composition are as follows: dNTP2 μ L of 2.5mM, 10 × Taq DNA polymerase Buffer2.5 μ L, 10 μM of forward primer SEQ ID NO.1 and
Each 1 μ L of reverse primer SEQ ID NO.2, the 0.2 μ L of Taq DNA polymerase of 5U/ μ L, 100g/ μ L 1 μ L of rDNA template solution and
Sterilize 17.3 μ L of distilled water；
The PCR amplification condition are as follows: 95 DEG C of initial denaturation 5min, subsequent 95 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 60s,
35 circulations are carried out altogether, are finally carried out 72 DEG C of extension 5min, are saved under the conditions of 4 DEG C.
7. a kind of application method according to claim 4, which is characterized in that the step 3) gel electrophoresis uses 1.0%
Ago-Gel carries out.
8. a kind of application method according to claim 4, which is characterized in that observation described in step 3) can pass through direct meat
Eye observation carries out, and compares recycled expanding fragment length and carry out Rapid identification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811231781.XA CN109182551A (en) | 2018-10-22 | 2018-10-22 | A kind of primer and its design method and methods for using them for quick band line striped sole and angle sole |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811231781.XA CN109182551A (en) | 2018-10-22 | 2018-10-22 | A kind of primer and its design method and methods for using them for quick band line striped sole and angle sole |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109182551A true CN109182551A (en) | 2019-01-11 |
Family
ID=64942544
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811231781.XA Pending CN109182551A (en) | 2018-10-22 | 2018-10-22 | A kind of primer and its design method and methods for using them for quick band line striped sole and angle sole |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109182551A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858350A (en) * | 2017-11-20 | 2018-03-30 | 浙江海洋大学 | A kind of universal primer of Pleuronectiformes Soleidae fish ribosomes the Internal Transcribed Spacer 2 and design and amplification method |
| CN107881248A (en) * | 2017-12-15 | 2018-04-06 | 浙江海洋大学 | Pleuronectiformes Soleidae fish ribosomes the Internal Transcribed Spacer 1（ITS1）Universal primer design method and application |
| CN108034731A (en) * | 2017-12-15 | 2018-05-15 | 浙江海洋大学 | A kind of quick molecular biology method for differentiating Zanzibar tongue sole and Nigeria tongue sole |
| CN108148913A (en) * | 2017-12-15 | 2018-06-12 | 浙江海洋大学 | A kind of quick discriminating Japan striped sole and the molecular biology method of tassel squama striped sole |
| CN109097483A (en) * | 2018-10-09 | 2018-12-28 | 浙江海洋大学 | A kind of molecular biology method of quick identification east Symphurus and black cheek Symphurus |
-
2018
- 2018-10-22 CN CN201811231781.XA patent/CN109182551A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858350A (en) * | 2017-11-20 | 2018-03-30 | 浙江海洋大学 | A kind of universal primer of Pleuronectiformes Soleidae fish ribosomes the Internal Transcribed Spacer 2 and design and amplification method |
| CN107881248A (en) * | 2017-12-15 | 2018-04-06 | 浙江海洋大学 | Pleuronectiformes Soleidae fish ribosomes the Internal Transcribed Spacer 1（ITS1）Universal primer design method and application |
| CN108034731A (en) * | 2017-12-15 | 2018-05-15 | 浙江海洋大学 | A kind of quick molecular biology method for differentiating Zanzibar tongue sole and Nigeria tongue sole |
| CN108148913A (en) * | 2017-12-15 | 2018-06-12 | 浙江海洋大学 | A kind of quick discriminating Japan striped sole and the molecular biology method of tassel squama striped sole |
| CN109097483A (en) * | 2018-10-09 | 2018-12-28 | 浙江海洋大学 | A kind of molecular biology method of quick identification east Symphurus and black cheek Symphurus |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105861642B (en) | A kind of acipenser schrencki gender gap opposite sex molecular labeling and detection acipenser schrencki property method for distinguishing | |
| CN103898235B (en) | A kind of DNA bar code method for identifying molecules of Hirudo | |
| RU2017100253A (en) | KIT OR DEVICE FOR DETECTING PROSTATE CANCER AND DETECTION METHOD | |
| CN111394479A (en) | Molecular marker for assisting in fine wool sheep breeding and application method | |
| CN105483217B (en) | A kind of molecule labelling method for identifying rice east wild type cytoplasmic male sterility source | |
| CN110183525A (en) | The relevant TXR albumen of wheat stripe rust resisting disease and its encoding gene and application | |
| CN107151690B (en) | Molecular marker for detecting day age of pigs with weight of 100kg and application thereof | |
| CN105368948A (en) | Primer for sex identification of Nile tilapia and PCR (polymerase chain reaction) identification method | |
| CN102162012B (en) | Qualitative PCR detection method for transgenic rice kefeng No. 6 | |
| CN107858350B (en) | Floundles sole family fish ribose in vivo transcription spacer region 2 universal primer and design and amplification method | |
| CN105441547B (en) | For identifying multiple PCR primer and method and the application of Anji Chinese salamander | |
| CN102433379B (en) | Method for rapidly detecting expression of ANS (Anthocyanidin Synthetase) genes from different sources in rape seed capsule and application thereof | |
| CN109880893A (en) | DNA fragment specific and application for mystus nemurus sex identification | |
| CN102041310B (en) | Method for detecting rose cockscomb character | |
| CN108950088A (en) | A kind of double PCR primer and method identifying grapevine leafroll virus 3 and grape Stem Pitting Virus | |
| CN109182551A (en) | A kind of primer and its design method and methods for using them for quick band line striped sole and angle sole | |
| CN102758016A (en) | Kit for simply, conveniently and rapidly detecting sheep multifetal gene BMPR-IB (bone morphogenetic protein receptor IB) | |
| CN108754010B (en) | Method for rapidly detecting genome DNA residues in total RNA sample | |
| CN112695125A (en) | Katelia SSR molecular marker primer composition and application thereof | |
| KR20110039575A (en) | Method for simultaneous detection of viroid pstvd and tcdvd | |
| CN109182550A (en) | It is a kind of to kiss the primer and its design method and methods for using them of red tongue sole for quickly identifying Cynoglossus semilaevis and length | |
| CN102134600B (en) | PCR (Polymerase Chain Reaction) method for sex appraisal of Nipponia nippon | |
| CN104099423A (en) | Molecular marker for discriminating different ecotype populations of coilia ectenes | |
| CN107893129A (en) | The method for detecting apple green wrinkle fruit disease poison | |
| CN102643799B (en) | Method for cloning intron-containing partial sequence of GAPDH (glyceraldehyde-phosphate dehydrogenase) gene of Cyprinus carpio var. Jian and real time PCR method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190111 |
|
| RJ01 | Rejection of invention patent application after publication |