CN109097483A - A kind of molecular biology method of quick identification east Symphurus and black cheek Symphurus - Google Patents
A kind of molecular biology method of quick identification east Symphurus and black cheek Symphurus Download PDFInfo
- Publication number
- CN109097483A CN109097483A CN201811212260.XA CN201811212260A CN109097483A CN 109097483 A CN109097483 A CN 109097483A CN 201811212260 A CN201811212260 A CN 201811212260A CN 109097483 A CN109097483 A CN 109097483A
- Authority
- CN
- China
- Prior art keywords
- symphurus
- east
- cheek
- black
- black cheek
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to field of molecular biotechnology, solve the problems, such as by the method for sequencing to species identification there are it is cumbersome, expend that the time is longer, disclose a kind of molecular biology method for quickly identifying east Symphurus and black cheek Symphurus.This method first extracts the genomic DNA of east Symphurus and black cheek Symphurus respectively, then the universal primer in the design amplification region ITS, the area ribose vivo transcription ITS amplified reaction is carried out to the genomic DNA of east Symphurus and black cheek Symphurus respectively using universal primer, obtain the two amplified production, agarose gel electrophoresis analysis finally is carried out to the two amplified production respectively, compare amplified production length, a belt length is black cheek Symphurus, and band is short for east Symphurus.The present invention directly carries out species identification by comparing sequence length and has both saved cost to eliminate sequencing procedure, greatly improves work efficiency.
Description
Technical field
The present invention relates to field of molecular biotechnology, wireless more particularly, to a kind of quickly identification east Symphurus and black cheek
The molecular biology method of sole.
Background technique
East Symphurus and black cheek Symphurus belong to the wireless Solea of Pleuronectiformes Cynoglossidae Symphurus subfamily, unusual phase in form
Closely, it is main by back, whether there is or not black band, gill opening height and head height ratios to distinguish for anal fin.But since it is from color after water
It is easy for taking off, and scale is also easy to fall off, in addition passing through survey calculation, it is desirable that very accurate, process is very complicated, leads
It causes the two to be difficult to be identified by morphological feature, thus leads to the confusion on Identification of Species and phyletic evolution.Chinese patent is public
The number of opening CN104531688 discloses a kind of spider mitochondrial genome complete sequence amplimer and amplification method, which uses
The total DNA of extraction spider genome spider is identified by the long PCR amplification of mitochondrial genomes DNA and sequencing, but
It is only capable of expanding spider；The identification of this biological variety must could carry out accurate judgement to species by sequencing, operate numerous
Trivial, the identification consuming time is longer, and determination rates are low.
Summary of the invention
The present invention be in order to overcome the prior art by be sequenced method to species identification there are it is cumbersome, expend the time
Longer problem provides a kind of molecular biology method for capableing of Rapid identification east Symphurus and black cheek Symphurus, this method
Easy to operate, cost is relatively low.
To achieve the goals above, the invention adopts the following technical scheme: a kind of quickly identify east Symphurus and black cheek
The molecular biology method of Symphurus, comprising the following steps:
1) genomic DNA of east Symphurus and black cheek Symphurus is extracted respectively；
2) Pleuronectiformes Cynoglossidae fish 18SrDNA and 28SrDNA sequence is obtained from Genbank database, is utilized
ClustalXv1.83 does the comparison of sequence, finds out conserved sequence for designing the logical of the amplification region ITS at 3 ' ends and 5 ' ends respectively
Use primer；
3) ribose vivo transcription ITS is carried out to the genomic DNA of east Symphurus and black cheek Symphurus respectively using universal primer
Area's amplified reaction obtains the two amplified production；
4) agarose gel electrophoresis analysis is carried out to the two amplified production respectively, compares amplified production length, a belt length is black
Cheek Symphurus, band are short for east Symphurus.
The region ribosomes ITS (ITS1-5.8S-ITS2) is one section and is located at rRNA encoding gene 18S rDNA and 28S
One section of gene among rDNA, including two sections of noncoding regions (ITS1 and ITS2) and one section of code area (5.8S rDNA) are evolved
Rate is relatively fast, tends to be similar substantially in kind, and then assumes a marked difference in inter-species, and different types of ITS long
Spend difference clearly, thus can on 18S rDNA and the 28S rDNA at both ends design primer, it is wireless for expanding two kinds
The ITS1-5.8S-ITS2rDNA sequence of sole directly compares the ITS1-5.8S- of two kinds of Symphurus by gel electrophoresis naked eyes
ITS2rDNA sequence length heteroplasmy carries out type identification and has both eliminated the form of very complicated to eliminate sequencing procedure
Evaluation program, and saved cost, it is often more important that it greatly improves work efficiency.
Preferably, the genomic DNA method for extracting east Symphurus and black cheek Symphurus in the step 1) is standard
Phenol-chloroform method.
Preferably, the forward primer sequence of universal primer is in the step 2)
TCGCTACTACCGATTGGATGGTTTA, reverse primer sequences GCTCTTCCCTCTTCACTCG.
Preferably, amplification reaction system in the step 3) are as follows: take 100ng template DNA, 0.5 μ L concentration is 10 μm of ol/
The forward primer of L, concentration are the reverse primer that 0.5 μ L concentration is 10 μm of ol/L, 2.5 10 × buffer of μ L, and 1.5 μ L concentration are
The MgCl of 25mmol/L2, 0.5 μ L concentration is the dNTP of 10mmol/L, and the mixing of 0.2 μ L Taq polymerase adds distilled water to 25 μ L.
Preferably, amplification reaction condition in the step 3) are as follows: first initial denaturation 3-5min, then 96- at 93-95 DEG C
It is denaturalized 10-15s at 98 DEG C, anneal 20-30s at 50-55 DEG C, 70-73 DEG C of extension 2-3min, carries out 30 circulations, finally exists
72-75 DEG C of extension 6-10min.
Preferably, the concentration of Ago-Gel is 1.5%-2% in the step 4).
Therefore, the invention has the following beneficial effects: this patents sets on 18S rDNA and the 28S rDNA that both ends are guarded
Primer is counted, the ITS1-5.8S-ITS2 sequence of the very close Symphurus type of two kinds of forms is expanded, directly by comparing its sequence
Column length carries out species identification and has both saved cost to eliminate sequencing procedure, it is often more important that substantially increases work effect
Rate.
Detailed description of the invention
Fig. 1 is that two kinds of tongue sole ITS1-5.8S-ITS2 expand electrophoretogram, M:DL2000；1: east Symphurus；2: black cheek without
Line sole.
Specific embodiment
Below by specific embodiment, technical scheme is described further.
In the present invention, if not refering in particular to, used raw material and equipment etc. are commercially available or commonly used in the art,
Method in embodiment is unless otherwise instructed the conventional method of this field.
Embodiment 1
A kind of molecular biology method of quick identification east Symphurus and black cheek Symphurus, comprising the following steps:
1) genomic DNA for extracting east Symphurus and black cheek Symphurus respectively with standard phenol-chloroform method, is dissolved in TE, -20 DEG C
It saves；
2) Pleuronectiformes Cynoglossidae fish 18SrDNA and 28SrDNA sequence is obtained from Genbank database, is utilized
ClustalXv1.83 does the comparison of sequence, finds out conserved sequence for designing the logical of the amplification region ITS at 3 ' ends and 5 ' ends respectively
Forward primer sequence with primer, universal primer is TCGCTACTACCGATTGGATGGTTTA, and reverse primer sequences are
GCTCTTCCCTCTTCACTCG；
3) ribose vivo transcription ITS is carried out to the genomic DNA of east Symphurus and black cheek Symphurus respectively using universal primer
Area's amplified reaction obtains the two amplified production, wherein amplification reaction system are as follows: takes 100ng template DNA, 0.5 μ L concentration is 10 μ
The forward primer of mol/L, concentration are the reverse primer that 0.5 μ L concentration is 10 μm of ol/L, and 2.5 μ L 10 × buffer, 1.5 μ L are dense
Degree is the MgCl of 25mmol/L2, 0.5 μ L concentration is the dNTP of 10mmol/L, and the mixing of 0.2 μ L Taq polymerase adds distilled water extremely
25μL；Amplification reaction condition are as follows: then the first initial denaturation 4min at 94 DEG C is denaturalized 12s at 97 DEG C, anneal 25s at 53 DEG C, and 72
DEG C extend 2min, carry out 30 circulation, finally in 73 DEG C of extension 7min；
4) agarose gel electrophoresis analysis is carried out to the two amplified production respectively, wherein the concentration of Ago-Gel is 1.8%, knot
Fruit illustrates that expanded DNA fragmentation is long as shown in Figure 1, if amplified production is corresponding with swimming lane 2, is black cheek Symphurus；If amplification produces
Object is corresponding with swimming lane 1, illustrates that expanded DNA fragmentation band is short, is east Symphurus.
Verification result: obtaining the east Symphurus of Known Species, repeats step 1), 2), 3), purifies to amplified production
Sequencing, gained sequence are as follows:
TCGCTACTACCGATTGGATGGTTTAGTGAGGTCCTCGGATCGGCCCCGCCGGGGTCGGCAACGGCCCTGGTGG
AGCGCCGAGAAGACGATCAAACTTGACTATCTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCG
GAAGGATCATTACCGGTCGGCGCGCCCACGGCCACGTCGCAGGGGCCCGAGGCCGCAGCCCGCACACACGCTCCGGT
CGCGGACGGCCGGGTGTTTTTCCCTCCTCACCCGACGCTGTCGCAAACGCCTGGCCCTAGTCGCACAAAACGAACGA
AAAGAGTCTACAACTCTTAGCGGCGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCTAGCTGCGAGAACTAAC
GTGAATTGCAGGACACATTGATCATCGACATTTCGAATGCACCTTGCGGTCCCGGGTTCTTCCCGGGGCTACGCCTG
TCTGAGGGTCGCTTTGCCATCAATCGGGGAAAACGCTCCCCGCGGCTGGGGTCCGTCGCAGGCCTGCTCCGCCGGCC
TTCGTCCCCCCAAGAGCAGACCTCTGAGCCCAGAGCCCCGCGGCTCTGCCTCCCCGACTCACGCCGGAGCGTGGGCG
CGCGAGGCGGGCGCGGCTGCCGGTGGACCTACGGTCTCCGAGCTGCCCGCGTCTCGCCGAGCCTGCGCACGCTCGGG
CTGCGGGAGGCGAAGCCCGGGCCTCGGCCGAGCGCGCCACGGACCGTGAGCCTCGCGCCACGACGGCCGTCTGTGCG
GCGGCCACCATCGACTACGACCTCAGATCAGACGAGACAACCCGCTGAATTTAAGCATATTACTAAGCGGAGGAATA
GAAACTAACCAGGATTCCCTCAGTAGCGGCGAGTGAAGAGGGAAGAGC；
The black cheek Symphurus of Known Species is obtained, step 1), 2), 3) is repeated, purifying sequencing, gained sequence is carried out to amplified production
Are as follows:
TACCGGTTTGGCGGGGACCCGCGCCGAAAGGCAGGGCCTTCCCCCCCGTTCCACACCCACCGCTTAGGGCGT
GCGGTGGTGGGTACTCCGCTCCGCGGAGGTCCCCCCCGCTCGTCCGAGGCGCGCGGAGACGGAGTCCTCGGGCTCC
GGCCTCCGCCTCTGACAGCCGCTCTTTTCGTCCAGCGGGCCCCACGGTCCCCGTCCTGCCGGGCGCCCCCGCCTCC
GACTCTCCGCCTCGGCCGTCCGCGCGGCCAGGAGAGCCCGGGGGGTCCGGGAGCGCAGCCGCCGGCGGACGAGCCG
CGGGACTGGGGCCCCGTCCACCGGAACGCAACCCCAACCCGCGGGGCGCGACGCGGCCTCGCGCCCCGCACCGCCC
GGGTGCCCAACTCTCCCCTCTCCCCCGGGGAGCGGAGGGGGGCTCAATGTCTCCGCGGCGGTCGCTCGTCGGCCGT
CCCGGAGCGCCCGGACCCGGCACCGGCGCTTCGGCGCCACCCCGTGCCTTCCATCCCCTCGCTCCAACCGTACACA
CTTCCAACGGAAAGCTGGCCACGCTCGGAAACGAGATATAAAAATAAACTAAAAGTCTTACGACTCTTAGCGGTGG
ATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCTAGCTGCGAGAACTAATGTGAATTGCAGGACACATTGATCAT
CGACACTTCGAACGCACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTGCCATCGAT
CGGAGGCCTCCGCGTCTCCGCGGCTGGGGCCGTCGCAGGCAGCTCCTCCGGGGGCTCGCCTTCGTCCCCCCAAACG
CAGACCTCTGGCTCGGGGCGGCTCCGGCCCCCCTCGGTCTCCCGTCGCCTCGGTTCACTCACCCCACGGGGCGTGA
GTCGGGCGCGGCTGCCGGTGTGCGACCTCCGGTCCCACCCCCGCGCTGCCCGCGTTACGCGCGCCTCGAGAGAAAC
CCCGGGCCCGGGCGGTTCCCGAGGAACTCCGAGCCGGAAAACGGGCGTCAGCCCTCGCCATCTCTCGGCGAGCCCG
GCCTCCTTCCGGGCCGGCCGCCACACGCTCCTTCGACT；
It can be obtained black cheek Symphurus amplified production by comparing and be longer than east Symphurus, therefore the verifying of step 4) acquired results is correct.
Embodiment 2
A kind of molecular biology method of quick identification east Symphurus and black cheek Symphurus, comprising the following steps:
1) genomic DNA for extracting east Symphurus and black cheek Symphurus respectively with standard phenol-chloroform method, is dissolved in TE, -20 DEG C
It saves；
2) Pleuronectiformes Cynoglossidae fish 18SrDNA and 28SrDNA sequence is obtained from Genbank database, is utilized
ClustalXv1.83 does the comparison of sequence, finds out conserved sequence for designing the logical of the amplification region ITS at 3 ' ends and 5 ' ends respectively
Forward primer sequence with primer, universal primer is TCGCTACTACCGATTGGATGGTTTA, and reverse primer sequences are
GCTCTTCCCTCTTCACTCG；
3) ribose vivo transcription ITS is carried out to the genomic DNA of east Symphurus and black cheek Symphurus respectively using universal primer
Area's amplified reaction obtains the two amplified production, wherein amplification reaction system are as follows: takes 100ng template DNA, 0.5 μ L concentration is 10 μ
The forward primer of mol/L, concentration are the reverse primer that 0.5 μ L concentration is 10 μm of ol/L, and 2.5 μ L 10 × buffer, 1.5 μ L are dense
Degree is the MgCl of 25mmol/L2, 0.5 μ L concentration is the dNTP of 10mmol/L, and the mixing of 0.2 μ L Taq polymerase adds distilled water extremely
25μL；Amplification reaction condition are as follows: then the first initial denaturation 5min at 95 DEG C is denaturalized 15s at 98 DEG C, anneal 30s at 55 DEG C, and 73
DEG C extend 3min, carry out 30 circulation, finally in 75 DEG C of extension 10min；
4) agarose gel electrophoresis analysis is carried out to the two amplified production respectively, wherein the concentration of Ago-Gel is 2%, is compared
Amplified production length, a belt length are black cheek Symphurus, and band is short for east Symphurus.
Embodiment 3
A kind of molecular biology method of quick identification east Symphurus and black cheek Symphurus, comprising the following steps:
1) genomic DNA for extracting east Symphurus and black cheek Symphurus respectively with standard phenol-chloroform method, is dissolved in TE, -20 DEG C
It saves；
2) Pleuronectiformes Cynoglossidae fish 18SrDNA and 28SrDNA sequence is obtained from Genbank database, is utilized
ClustalXv1.83 does the comparison of sequence, finds out conserved sequence for designing the logical of the amplification region ITS at 3 ' ends and 5 ' ends respectively
Forward primer sequence with primer, universal primer is TCGCTACTACCGATTGGATGGTTTA, and reverse primer sequences are
GCTCTTCCCTCTTCACTCG；
3) ribose vivo transcription ITS is carried out to the genomic DNA of east Symphurus and black cheek Symphurus respectively using universal primer
Area's amplified reaction obtains the two amplified production, wherein amplification reaction system are as follows: takes 100ng template DNA, 0.5 μ L concentration is 10 μ
The forward primer of mol/L, concentration are the reverse primer that 0.5 μ L concentration is 10 μm of ol/L, and 2.5 μ L 10 × buffer, 1.5 μ L are dense
Degree is the MgCl of 25mmol/L2, 0.5 μ L concentration is the dNTP of 10mmol/L, and the mixing of 0.2 μ L Taq polymerase adds distilled water extremely
25μL；Amplification reaction condition are as follows: then the first initial denaturation 3min at 93 DEG C is denaturalized 10s at 96 DEG C, anneal 20s at 50 DEG C, and 70
DEG C extend 2min, carry out 30 circulation, finally in 72 DEG C of extension 6min；
4) agarose gel electrophoresis analysis is carried out to the two amplified production respectively, wherein the concentration of Ago-Gel is 1.5%, than
Compared with amplified production length, a belt length is black cheek Symphurus, and band is short for east Symphurus.
The above described is only a preferred embodiment of the present invention, be not intended to limit the present invention in any form, though
So the present invention has been disclosed as a preferred embodiment, and however, it is not intended to limit the invention, any technology people for being familiar with this profession
Member, without departing from the scope of the present invention, when the technology contents using the disclosure above make a little change or modification
It is right according to the technical essence of the invention for the equivalent embodiment of equivalent variations, but without departing from the technical solutions of the present invention
Any simple modification, equivalent change and modification made by above embodiments, all of which are still within the scope of the technical scheme of the invention.
Sequence table
<110>Zhejiang Ocean university
<120>a kind of molecular biology method for quickly identifying east Symphurus and black cheek Symphurus
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 891
<212> DNA
<213>east Symphurus (Symphurus orientalis)
<400> 1
tcgctactac cgattggatg gtttagtgag gtcctcggat cggccccgcc ggggtcggca 60
acggccctgg tggagcgccg agaagacgat caaacttgac tatctagagg aagtaaaagt 120
cgtaacaagg tttccgtagg tgaacctgcg gaaggatcat taccggtcgg cgcgcccacg 180
gccacgtcgc aggggcccga ggccgcagcc cgcacacacg ctccggtcgc ggacggccgg 240
gtgtttttcc ctcctcaccc gacgctgtcg caaacgcctg gccctagtcg cacaaaacga 300
acgaaaagag tctacaactc ttagcggcgg atcactcggc tcgtgcgtcg atgaagaacg 360
cagctagctg cgagaactaa cgtgaattgc aggacacatt gatcatcgac atttcgaatg 420
caccttgcgg tcccgggttc ttcccggggc tacgcctgtc tgagggtcgc tttgccatca 480
atcggggaaa acgctccccg cggctggggt ccgtcgcagg cctgctccgc cggccttcgt 540
ccccccaaga gcagacctct gagcccagag ccccgcggct ctgcctcccc gactcacgcc 600
ggagcgtggg cgcgcgaggc gggcgcggct gccggtggac ctacggtctc cgagctgccc 660
gcgtctcgcc gagcctgcgc acgctcgggc tgcgggaggc gaagcccggg cctcggccga 720
gcgcgccacg gaccgtgagc ctcgcgccac gacggccgtc tgtgcggcgg ccaccatcga 780
ctacgacctc agatcagacg agacaacccg ctgaatttaa gcatattact aagcggagga 840
atagaaacta accaggattc cctcagtagc ggcgagtgaa gagggaagag c 891
<210> 2
<211> 1098
<212> DNA
<213>black cheek Symphurus (Symphurus plagiusa)
<400> 2
taccggtttg gcggggaccc gcgccgaaag gcagggcctt cccccccgtt ccacacccac 60
cgcttagggc gtgcggtggt gggtactccg ctccgcggag gtcccccccg ctcgtccgag 120
gcgcgcggag acggagtcct cgggctccgg cctccgcctc tgacagccgc tcttttcgtc 180
cagcgggccc cacggtcccc gtcctgccgg gcgcccccgc ctccgactct ccgcctcggc 240
cgtccgcgcg gccaggagag cccggggggt ccgggagcgc agccgccggc ggacgagccg 300
cgggactggg gccccgtcca ccggaacgca accccaaccc gcggggcgcg acgcggcctc 360
gcgccccgca ccgcccgggt gcccaactct cccctctccc ccggggagcg gaggggggct 420
caatgtctcc gcggcggtcg ctcgtcggcc gtcccggagc gcccggaccc ggcaccggcg 480
cttcggcgcc accccgtgcc ttccatcccc tcgctccaac cgtacacact tccaacggaa 540
agctggccac gctcggaaac gagatataaa aataaactaa aagtcttacg actcttagcg 600
gtggatcact cggctcgtgc gtcgatgaag aacgcagcta gctgcgagaa ctaatgtgaa 660
ttgcaggaca cattgatcat cgacacttcg aacgcacctt gcggccccgg gttcctcccg 720
gggctacgcc tgtctgaggg tcgctttgcc atcgatcgga ggcctccgcg tctccgcggc 780
tggggccgtc gcaggcagct cctccggggg ctcgccttcg tccccccaaa cgcagacctc 840
tggctcgggg cggctccggc ccccctcggt ctcccgtcgc ctcggttcac tcaccccacg 900
gggcgtgagt cgggcgcggc tgccggtgtg cgacctccgg tcccaccccc gcgctgcccg 960
cgttacgcgc gcctcgagag aaaccccggg cccgggcggt tcccgaggaa ctccgagccg 1020
gaaaacgggc gtcagccctc gccatctctc ggcgagcccg gcctccttcc gggccggccg 1080
ccacacgctc cttcgact 1098
Claims (6)
1. a kind of molecular biology method for quickly identifying east Symphurus and black cheek Symphurus, which is characterized in that including following
Step:
1) genomic DNA of east Symphurus and black cheek Symphurus is extracted respectively；
2) Pleuronectiformes Cynoglossidae fish 18SrDNA and 28SrDNA sequence is obtained from Genbank database, is utilized
ClustalXv1.83 does the comparison of sequence, finds out conserved sequence for designing the logical of the amplification region ITS at 3 ' ends and 5 ' ends respectively
Use primer；
3) ribose vivo transcription ITS is carried out to the genomic DNA of east Symphurus and black cheek Symphurus respectively using universal primer
Area's amplified reaction obtains the two amplified production；
4) agarose gel electrophoresis analysis is carried out to the two amplified production respectively, compares amplified production length, a belt length is black
Cheek Symphurus, band are short for east Symphurus.
2. a kind of molecular biology method for quickly identifying east Symphurus and black cheek Symphurus according to claim 1,
It is characterized in that, the genomic DNA method for extracting east Symphurus and black cheek Symphurus in the step 1) is standard phenol-chloroform
Method.
3. a kind of molecular biology method for quickly identifying east Symphurus and black cheek Symphurus according to claim 1,
It is characterized in that, the forward primer sequence of universal primer is TCGCTACTACCGATTGGATGGTTTA in the step 2), reversely
Primer sequence is GCTCTTCCCTCTTCACTCG.
4. a kind of molecular biology method for quickly identifying east Symphurus and black cheek Symphurus according to claim 1,
It is characterized in that, amplification reaction system in the step 3) are as follows: take 100ng template DNA, 0.5 μ L concentration be 10 μm of ol/L just
To primer, concentration is the reverse primer that 0.5 μ L concentration is 10 μm of ol/L, 2.5 10 × buffer of μ L, and 1.5 μ L concentration are
The MgCl of 25mmol/L2, 0.5 μ L concentration is the dNTP of 10mmol/L, and the mixing of 0.2 μ L Taq polymerase adds distilled water to 25 μ L.
5. a kind of molecular biology method for quickly identifying east Symphurus and black cheek Symphurus according to claim 1,
It is characterized in that, amplification reaction condition in the step 3) are as follows: the first initial denaturation 3-5min at 93-95 DEG C, then at 96-98 DEG C
It is denaturalized 10-15s, anneal 20-30s at 50-55 DEG C, 70-73 DEG C of extension 2-3min, 30 circulations is carried out, finally at 72-75 DEG C
Extend 6-10min.
6. a kind of molecular biology method for quickly identifying east Symphurus and black cheek Symphurus according to claim 1,
It is characterized in that, the concentration of Ago-Gel is 1.5%-2% in the step 4).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811212260.XA CN109097483A (en) | 2018-10-09 | 2018-10-09 | A kind of molecular biology method of quick identification east Symphurus and black cheek Symphurus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811212260.XA CN109097483A (en) | 2018-10-09 | 2018-10-09 | A kind of molecular biology method of quick identification east Symphurus and black cheek Symphurus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109097483A true CN109097483A (en) | 2018-12-28 |
Family
ID=64868940
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811212260.XA Pending CN109097483A (en) | 2018-10-09 | 2018-10-09 | A kind of molecular biology method of quick identification east Symphurus and black cheek Symphurus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109097483A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109182550A (en) * | 2018-10-22 | 2019-01-11 | 浙江海洋大学 | It is a kind of to kiss the primer and its design method and methods for using them of red tongue sole for quickly identifying Cynoglossus semilaevis and length |
| CN109182551A (en) * | 2018-10-22 | 2019-01-11 | 浙江海洋大学 | A kind of primer and its design method and methods for using them for quick band line striped sole and angle sole |
| CN109750125A (en) * | 2019-03-22 | 2019-05-14 | 福建省农业科学院畜牧兽医研究所 | One group of primer and kit for quickly identifying PCV1 and PCV2 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858350A (en) * | 2017-11-20 | 2018-03-30 | 浙江海洋大学 | A kind of universal primer of Pleuronectiformes Soleidae fish ribosomes the Internal Transcribed Spacer 2 and design and amplification method |
| CN107881248A (en) * | 2017-12-15 | 2018-04-06 | 浙江海洋大学 | Pleuronectiformes Soleidae fish ribosomes the Internal Transcribed Spacer 1（ITS1）Universal primer design method and application |
-
2018
- 2018-10-09 CN CN201811212260.XA patent/CN109097483A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858350A (en) * | 2017-11-20 | 2018-03-30 | 浙江海洋大学 | A kind of universal primer of Pleuronectiformes Soleidae fish ribosomes the Internal Transcribed Spacer 2 and design and amplification method |
| CN107881248A (en) * | 2017-12-15 | 2018-04-06 | 浙江海洋大学 | Pleuronectiformes Soleidae fish ribosomes the Internal Transcribed Spacer 1（ITS1）Universal primer design method and application |
Non-Patent Citations (2)
| Title |
|---|
| 闫文朝等: "基于ITS1-5.8S rRNA-ITS2序列兔肝球虫PCR检测方法的建立 ", 《中国养兔》 * |
| 闫文朝等: "斯氏艾美耳球虫ITS1-5.8S rRNA-ITS2序列的克隆及PCR检测方法的建立 ", 《畜牧兽医学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109182550A (en) * | 2018-10-22 | 2019-01-11 | 浙江海洋大学 | It is a kind of to kiss the primer and its design method and methods for using them of red tongue sole for quickly identifying Cynoglossus semilaevis and length |
| CN109182551A (en) * | 2018-10-22 | 2019-01-11 | 浙江海洋大学 | A kind of primer and its design method and methods for using them for quick band line striped sole and angle sole |
| CN109750125A (en) * | 2019-03-22 | 2019-05-14 | 福建省农业科学院畜牧兽医研究所 | One group of primer and kit for quickly identifying PCV1 and PCV2 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110004235B (en) | SNP locus related to rapid growth of fugu obscurus and application | |
| CN109097483A (en) | A kind of molecular biology method of quick identification east Symphurus and black cheek Symphurus | |
| CN106755527B (en) | SNP marker, primer and evaluation method for evaluating growth performance of grass carp | |
| CN106434977A (en) | Molecular marker primer and method for identifying Shao's Sillago and Sillago sihama | |
| CN106811540B (en) | Microsatellite marker and specific primer for identifying male and female individuals of Pseudobagrus ussuriensis and application of microsatellite marker and specific primer | |
| CN114686597A (en) | SNP molecular marker for sex identification of salangid and application thereof | |
| CN113528677B (en) | Leaf-specific notopterygium plateau loach microsatellite molecular marker, and primer and application thereof | |
| CN105624322A (en) | Method for developing SSR (Simple Sequence Repeat) molecular mark of nibea albiflora for population identification | |
| CN104846093A (en) | Brassica juncea EST-SSR (expressed sequence tag-simple sequence repeat) marker primer group based on development of transcriptome sequence | |
| CN113462787A (en) | Male molecular marker of barbel grahami and application of male molecular marker | |
| CN116769891A (en) | SNP (Single nucleotide polymorphism) marker for rapidly identifying genetic sex of Chinese soft-shelled turtles as well as primer and application thereof | |
| CN109234412A (en) | The quickly method of the fast erythroculter ilishaeformis of the detection speed of growth and molecular labeling used | |
| CN106755422B (en) | Detection method of MEG3 gene SNP related to cattle growth traits and application thereof | |
| Gong et al. | Development and characterization of 13 polymorphic microsatellite DNA markers for the pond green frog (Rana nigromaculata) | |
| CN108148913A (en) | A kind of quick discriminating Japan striped sole and the molecular biology method of tassel squama striped sole | |
| CN108034731A (en) | A kind of quick molecular biology method for differentiating Zanzibar tongue sole and Nigeria tongue sole | |
| CN107841563A (en) | Differentiate the molecular specificity labeled primers and method of catfish | |
| CN106868186B (en) | Andrias davidianus microsatellite marker and application thereof | |
| CN112522422A (en) | Molecular identification method of pelagic fish and little-scale pelagic fish based on COI gene fragment | |
| CN116516026B (en) | Molecular marker related to antibody titer of broiler chickens, detection method and application | |
| CN110423823A (en) | A kind of C. guichenoti DNA bar code sequence and its application | |
| CN109880915A (en) | One kind SNP site relevant to the high character of donkey body and its application | |
| CN114686596B (en) | SNP molecular marker for sex identification of silver dragon fish and application thereof | |
| CN114686594B (en) | SNP molecular marker suitable for sex identification of silver dragon fish and application thereof | |
| CN105256045B (en) | It is a kind of identify pig kill after 24 it is small when longissimus dorsi muscle pH value size method and its special primer pair |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181228 |
|
| RJ01 | Rejection of invention patent application after publication |