CN109172597A - Adjust substance and its application of the histone methylated level of rDNA gene chromatin - Google Patents
Adjust substance and its application of the histone methylated level of rDNA gene chromatin Download PDFInfo
- Publication number
- CN109172597A CN109172597A CN201811038473.5A CN201811038473A CN109172597A CN 109172597 A CN109172597 A CN 109172597A CN 201811038473 A CN201811038473 A CN 201811038473A CN 109172597 A CN109172597 A CN 109172597A
- Authority
- CN
- China
- Prior art keywords
- phf6
- expression
- cell
- rdna
- substance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Hematology (AREA)
- Oncology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to disclose the purposes of regulation PHF6 expression substance.A kind of purposes provided by the present invention is to regulate and control the application of the substance transcription initiation region rDNA H3K9me3 level in preparation regulation zooblast of PHF6 expression.The application's experiments have shown that can influence the level of the transcription initiation region rDNA H3K9me3 by the expression quantity of regulation PHF6, the level of H3K9me3 can be significantly improved by being overexpressed PHF6, the level of H3K9me3 can be significantly reduced by reducing PHF6, to realize the apparent modification to rDNA histone.
Description
Technical field
The present invention relates to molecular biology fields, and in particular to PHF6 is to adjust rDNA chromatin histone methyl for regulation
Change the new application of horizontal substance.
Background technique
Plant homeodomain zinc finger protein 6 (Plant Homeodomain Finger Protein 6, PHF6) gene
On X chromosome, it is made of 11 exons.Wherein the coding of exon 2-10, which becomes, contains 365 amino acid, and molecular weight is
41kDa.PHF6 albumen is widely present in tissue, wherein the expression quantity highest in thymus gland, ovary and thyroid gland, initial quilt
A kind of determining three syndrome (Borjeson-Forssman- of Familial Occurrence disease " Bai-Fu-Lay " with X-linkage
Lehmann Syndrome, BFLS) it is closely related.With the further investigation to PHF6, it has been found that some patients BFLS are simultaneously
Suffered from T cell leukaemia, and had also discovered the gene mutation of PHF6 in non-BFLS leukaemic, these research shows that
The mutation of PHF6 gene may be related with the occurrence and development of leukaemia.And in addition some studies pointed out that many in T cell leukaemia
The gene of encoding ribosomal proteins is mutated, this reveals that ribosomes generate exception and leukaemia occurrence and development it
Between have close connection.When ribosomes generates, it is necessary first to rna plymerase i, which is incorporated on rDNA, transcribes out pre-rRNA, and
The level of pre-rRNA often significantly increases in cancer.Correlative study has confirmed that PHF6 has apparent entoblast fixed
Position, and it is capable of the transcription of negative regulation rDNA.The above results have prompted PHF6 regulation rDNA transcription to be likely to participate in leukaemia
Occurrence and development.
PHF6 includes two ZaP sequences, is based on this feature, and PHF6 albumen is recognized as with transcriptional control and changes dye
The function of chromatin structure, and the modification to histone in chromatin is related to the change of chromatin Structure.Histone is
A variety of apparent modifications, including methylation, acetylation, phosphorylation and ubiquitination can occur for important protein ingredient in chromatin.
These apparent modifications frequently occur in the histone tail end for extending nucleosome, and these modifications can change histone tail end with
The interaction of DNA is so as to influencing chromatinic structure.In addition, these apparent modifications can also be as Histone Code by one
A little special factors are identified and are combined.In most cases, special apparent modification and chromatinic cohesion, transcriptional control and
Some biological functions such as the duplication of DNA are closely related, and abnormal one for being tumour cell of apparent modification of histone is jointly
The characteristics of.The methylation of the 27th and the 9th lysine of H3 and histone H2A the 119th ubiquitination be all genetic transcription by
The mark of inhibition usually occurs in cryptiogene region.H3K27me3 and H2AK119ul and the formation of any heterochromatin have
It closes, and H3K9me2/3 can also regulate and control base in growth course other than playing a role during forming constitutive heterochromatin
The expression of cause.Therefore, research PHF6 and the modification of chromatin histone have for understanding treatment PHF6 related leukemia in depth
Very important meaning.
Summary of the invention
The present invention aiming at the problem that be to provide regulation PHF6 to influence the tri-methylated horizontal substance of rDNA chromatin and its
Purposes, particular content are as follows:
The substance that one aspect of the invention provides regulation 6 expression of plant homeodomain zinc finger protein is being prepared just
Regulate and control the application in the product of the tri-methylated level of rDNA chromatin.
In the inventive solutions, the application is to improve the substance of PHF6 expression in preparation up-regulation rDNA dye
Application in the product of the tri-methylated level of chromaticness, it is preferable that the substance for improving PHF6 expression is encoding regulator plant
The DNA molecular of object homeodomain zinc finger protein 6, or the DNA molecular containing encoding regulator plant homeodomain zinc finger protein 6
Recombinant vector, recombinant microorganism, recombinant plant cell or recombinant animal cell.
In the inventive solutions, the application is to reduce the substance of PHF6 expression in preparation downward rDNA dye
Application in the product of the tri-methylated level of chromaticness, it is preferable that the substance for reducing PHF6 expression is shRNA, expression
Expression vector, recombinant microorganism cell, recombinant animal cell, the recombinant plant cell of the shRNA, or reduce PHF6 and express water
The expression vector of siRNA, the expression siRNA that flat shRNA is generated, recombinant animal cell, recombinate recombinant microorganism cell
Plant cell.
In the inventive solutions, the shRNA is the short hairpin RNA to form loop-stem structure, the stem ring knot
One article of sequence of stem is 772-795 of SEQ ID No.3 in structure, another chain-ordering of the stem in the loop-stem structure with
SEQ ID 772-795 reverse complementals of No.3；Preferably
shPHF6:
GATCCGCAGAATTTGGAGACTTTGATATTCAAGAGATATCAAAGTCTCCAAATTCTGTTTTTTGGAAA
SEQ ID No.1
Or
shNC:
TTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATT SEQ ID No.2。
In the inventive solutions, the 6 sequence such as SEQ ID No.3 of regulation plant homeodomain zinc finger protein
It is described.
ATGTCAAGCTCAGTTGAACAGAAAAAAGGGCCTACAAGACAGCGCAAATGTGGCTTTTGTAAGTCAAA
TAGAGACAAGGAATGTGGACAGTTACTAATATCTGAAAACCAGAAGGTGGCAGCGCACCATAAGTGCATGCTCTTT
TCATCTGCTTTGGTATCATCACACTCTGATAATGAAAGTCTTGGTGGATTTTCTATTGAAGATGTCCAAAAGGAAA
TTAAAAGAGGCACGAAGCTGATGTGTTCTTTGTGCCATTGTCCTGGAGCAACAATTGGTTGTGATGTGAAAACATG
TCACAGGACATACCACTACCACTGTGCATTGCATGATAAAGCTCAAATACGAGAGAAACCTTCACAAGGAATTTAC
ATGGTCTATTGCCGAAAACACAAGAAAACTGCACATAACTCCGAAGCTGATTTAGAAGAAAGTTTTAATGAACATG
AACTGGAGCCCTCATCACCTAAAAGTAAAAAGAAAAGTCGCAAAGGAAGGCCAAGAAAAACTAATTTTAAAGGGCT
GTCAGAAGATACCAGGTCCACATCCTCCCATGGAACAGATGAAATGGAAAGTAGTTCCTATAGAGATAGGTCTCCA
CACAGAAGCAGCCCTAGTGACACCAGGCCTAAATGTGGATTTTGCCATGTAGGGGAGGAAGAAAATGAAGCACGAG
GAAAACTGCATATATTTAATGCCAAGAAGGCAGCTGCCCATTATAAGTGCATGTTGTTTTCTTCTGGCACAGTCCA
GCTCACAACAACATCAAGAGCAGAATTTGGAGACTTTGATATTAAAACTGTACTTCAGGAGATTAAACGAGGAAAA
AGAATGAAATGTACACTTTGCAGTCAGCCTGGTGCTACTATTGGATGTGAAATAAAAGCCTGTGTTAAGACTTACC
ATTACCACTGTGGAGTACAAGACAAAGCTAAATACATTGAAAATATGTCACGAGGAATTTACAAACTATACTGTAA
AAATCATAGTGGAAATGATGAGAGAGATGAAGAAGATGAGGAACGAGAGAGTAAAAGCCGAGGAAAAGTAGAAATT
GATCAGCAACAACTAACTCAGCAGCAACTTAATGGAAACTAG SEQ ID No.3
In the inventive solutions, the rDNA chromatin it is tri-methylated for rDNA chromatin histone H 3 K9me1,
H3K9me2, H3K9me3, H3K27, H3K27me1, H3K27me2, H3K27me3, preferably H3K9me3.
The substance for wherein regulating and controlling PHF6 expression concretely reduces the substance of PHF6 expression or improves PHF6 table
Up to horizontal substance.The substance for reducing PHF6 expression can be any object that can reduce PHF6 expression in cell
Matter reduces DNA molecular, the expression institute of the siRNA of PHF6 expression as described in the siRNA of reduction PHF6 expression, coding
State the micro- life of recombination of the expression vector for reducing the siRNA of PHF6 expression, the expression siRNA for reducing PHF6 expression
Object, expresses the reduction PHF6 expression at the recombinant plant cell for expressing the siRNA for reducing PH expression
The recombinant animal cell of siRNA；The substance for reducing PHF6 expression can be also any reduction PHF6 expression
The DNA molecular of shRNA, the coding shRNA for reducing PHF6 expression express the reduction PHF6 expression
The expression vector of shRNA, the recombinant microorganism of the expression shRNA for reducing PHF6 expression, the expression reduction PHF6
The recombinant plant cell of the shRNA of expression and the recombinant animal cell for expressing the shRNA for reducing PHF6 expression.
The substance for improving PHF6 expression can be the DNA molecular of coding PHF6, or DNA points containing coding PHF6
Recombinant vector, recombinant microorganism, recombinant plant cell or the recombinant animal cell of son.
Concretely bacterium, yeast, algae, fungi or virus, above-mentioned recombinant plant cell do not include above-mentioned recombinant microorganism
The propagation material of plant, above-mentioned recombinant animal cell do not include the propagation material of animal.
The regulation PHF6 expression can be the transcriptional level of regulation PHF6 and/or the protein translation water of regulation PHF6
It is flat.
In the application, the PHF6 is amino acid sequence protein as shown in SEQ ID No.3.
The application's experiments have shown that PHF6 is the novel targets for adjusting the tri-methylated level of rDNA chromatin histone, Ke Yitong
The expression reduction tri-methylated level of rDNA chromatin histone for reducing PHF6 is crossed, PHF6 is overexpressed and increases rDNA chromatin group egg
White tri-methylated level.
Detailed description of the invention
Fig. 1 is that chromatin immune coprecipitation method detects wild type PHF6 in the combination of the transcript regions pre-rRNA of rDNA
Situation wherein shows primer sequence in the position of the transcript regions pre-rRNA of rDNA, the results showed that in HeLa cell in Figure 1A
In (Figure 1B) and Jurkat cell (Fig. 1 C), detection primer position used can detect the DNA fragmentation that PHF6 antibody combines,
This illustrates that PHF6 has combination on the transcript regions pre-rRNA of rDNA.
Fig. 2 be co-immunoprecipitation method detect wild type PHF6 can and histone H 3 methylate simulating peptide combination feelings
Condition, the results showed that PHF6 and H3K9me1/H3K9me2/H3K9me3 have combination, wherein and H3K9me1 and H3K9me2 combination
Weaker, the combination of PHF6 and H3K9me3 are more (Fig. 2A)；PHF6 and H3K27/H3K27me1/H3K27me2/H3K27me3 have
In conjunction with (Fig. 2 B).
Fig. 3 is that chromatin immune coprecipitation method detects wild type PHF6 combination rDNA transcription initiation region H3K9 (me1/
2/3) the case where site /H3K27 (me1/2/3), the results showed that the H3K9me1/ of the transcription initiation region PHF6 and rDNA
H3K9me2/H3K9me3 has combination (Fig. 3 A), the H3K27me1/H3K27me2/ of the transcription initiation region PHF6 and rDNA
H3K27me3 has combination (Fig. 3 B).
Fig. 4 is that chromatin immune coprecipitation method detects the wild type PHF6 regulation transcription initiation region rDNA H3K9me3
Horizontal situation, the results showed that in HeLa cell, the expression (Fig. 4 A) of PHF6 can be detected after the plasmid of transfection expression PHF6, and
And the level of H3K9me3 is obviously improved (Fig. 4 B)；And striking low PHF6 (Fig. 4 E) significantly reduces the level (Fig. 4 F) of H3K9me3；
PHF6 (Fig. 4 C) is overexpressed equally in Jurkat cell can dramatically increase the level (Fig. 4 D) of H3K9me3；And strike low PHF6
The level (Fig. 4 H) of (Fig. 4 G) significant decrease H3K9me3.
Specific embodiment
The present invention is further described in detail With reference to embodiment, and the embodiment provided is only for explaining
The bright present invention, the range being not intended to be limiting of the invention.Experimental method in following embodiments is unless otherwise specified
Conventional method.Quantitative test in following embodiment is respectively provided with and repeats three times unless otherwise instructed.It is used in following embodiments
Material, reagent etc., be commercially available unless otherwise specified.
Human cervical cancer cell lines HeLa cell, human embryonic kidney cell line HEK 293 and human embryonic kidney cells in following embodiments
It is the cell that HEK 293T is the preservation of this laboratory.Human peripheral Leukemia Cell Lines Jurkat cell is purchased from Shanghai cell bank.
In following embodiments containing the DMEM culture medium containing 10% fetal calf serum in following embodiments cultivated to DMEM
The volumetric concentration that fetal calf serum (Hyclone) is added to fetal calf serum in base (Gibco) is 10% obtained culture medium.
1640 culture mediums containing 10% fetal calf serum in following embodiments are that tire is added into 1640 culture mediums (Gibco)
The volumetric concentration of cow's serum (Hyclone) to fetal calf serum is 10% obtained culture medium.
In the application, PHF6 is amino acid sequence protein as shown in SEQ ID No.3.
Embodiment 1, PHF6 have combination in the transcript regions pre-rRNA of rDNA
1, according to the sequence design detection primer of the transcript regions pre-rRNA on rDNA, 8 pairs of primers altogether, respectively H0,
H1, H4, H8, H13, H18, H23, H42.9, throughout the entire transcript regions pre-rRNA (Figure 1A).
H0 primer sequence is respectively SEQ ID No.4 and SEQ ID No.5
F:GGTATATCTTTCGCTCCGAG SEQ ID No.4
R:GACGACAGGTCGCCAGAGGA SEQ ID No.5
H1 primer sequence is respectively SEQ ID No.6 and SEQ ID No7
F:GGCGGTTTGAGTGAGACGAGA SEQ ID No.6
R:ACGTGCGCTCACCGAGAGCAG SEQ ID No7
H4 primer sequence is respectively SEQ ID No.8 and SEQ ID No.9
F:CGACGACCCATTCGAACGTCT SEQ ID No.8
R:CTCTCCGGAATCGAACCCTGA SEQ ID No.9
H8 primer sequence is respectively SEQ ID No.10 and SEQ ID No.11
F:AGTCGGGTTGCTTGGGAATGC SEQ ID No.10
R:CCCTTACGGTACTTGTTGACT SEQ ID No.11
H13 primer sequence is respectively SEQ ID No.12 and SEQ ID No.13
F:ACCTGGCGCTAAACCATTCGT SEQ ID No.12
R:GGACAAACCCTTGTGTCGAGG SEQ ID No.13
H18 primer sequence is respectively SEQ ID No.14 and SEQ ID No.15
F:GTTGACGTACAGGGTGGACTG SEQ ID No.14
R:GGAAGTTGTCTTCACGCCTGA SEQ ID No.15
H23 primer sequence is respectively SEQ ID No.16 and SEQ ID No.17
F:CCTTCCACGAGAGTGAGAAGC SEQ ID No.16
R:TCGACCTCCCGAAATCGTACA SEQ ID No.17
H42.9 primer sequence is respectively SEQ ID No.18 and SEQ ID No.19
F:CCCGGGGGAGGTATATCTTT SEQ ID No.18
R:CCAACCTCTCCGACGACA SEQ ID No.19
2, PHF6 can be in conjunction with the transcript regions pre-rRNA of rDNA
It is detected using the method for chromatin immune co-precipitation and the method for Real Time RT-PCR.It is thin in HeLa
Formaldehyde is added in born of the same parents, and (final concentration of 1%), normal temperature crosslinked 10min are washed three times after terminating crosslinking using cold PBS solution.It is added
Lysate (150mM NaCl, 20mM Tris (pH 7.4), 1mM EGTA, the 1%NP-40,1mM EDTA, Roche of 500 μ l
Cocktail), collect after lysate is placed in the EP pipe of 1.5ml and carry out ultrasonication (ultrasonic power 20%, ultrasound works time
10s, ultrasonic interval time are 50s, are repeated five times).By the sample after ultrasonic treatment under 12,000rpm speed low-temperature centrifugation
It is spare to collect supernatant by 15min.It stays part supernatant to be placed in -80 DEG C to save for Input group analysis, remaining equivalent experiment
The primary antibody that anti-PHF6 is added in the supernatant of group is incubated overnight in 4 DEG C, adds 15 μ l Dynabeads protein G in 4
2h is incubated in DEG C.The magnetic bead in sample is drawn onto EP bottom of the tube using magnetic frame, sucks supernatant, cell pyrolysis liquid washing is added
Three times, magnetic bead is drawn onto EP bottom of the tube removal cleaning solution after washing by each 10min.Input group is placed in -80 DEG C
It is taken out after 30min and removes supernatant after being centrifuged 15min under 12,000rpm speed.It will be added 40 μ l's in Input group and experimental group
Tube wall is touched after 10% Chelex to be mixed, and is then placed into 100 DEG C and is heated 10min, 1 μ l egg is added after taking out cooling
White enzyme K, tapping tube wall are placed in 100 DEG C again after mixing and heat 10min, and centrifuging and taking supernatant carries out real-time quantitative reverse transcription
The operation of PCR, what primer was selected is the primer in Figure 1A.Experimental result shows that detection primer position used can detect
The DNA fragmentation that PHF6 antibody combines, this is illustrated in HeLa cell, and PHF6 has on the transcript regions pre-rRNA of rDNA
In conjunction with (Figure 1B).
In Jurkat cell be added formaldehyde (final concentration of 1%), normal temperature crosslinked 10min, terminate crosslinking after 1200rpm from
The heart collects cell, operates the chromatin immune co-precipitation operating procedure of same HeLa cell later, and primer selects the part in Figure 1A
Primer, experimental result show that detection primer position used can detect the DNA fragmentation that PHF6 antibody combines, this is illustrated
In Jurkat cell, PHF6 has combination (Fig. 1 C) on the transcript regions pre-rRNA of rDNA.
In short, experiment shows that PHF6 can be in conjunction with the transcript regions pre-rRNA of rDNA.
Embodiment 2, PHF6 can be methylated with histone H 3 in conjunction with simulating peptide
It is detected using the method for co-immunoprecipitation and immunoblotting.The methylation of artificial synthesized some histone H 3s is repaired
Adorn site simulating peptide, include H3K9, H3K9me1, H3K9me2, H3K9me3, H3K27, H3K27me1, H3K27me2 and
H3K27me3, these simulating peptides have biotin (Biotin) label, and the primary antibody that can use antibiotin is detected.By matter
Grain Flag-PHF6 is transferred to expression Flag-PHF6 albumen in 293 cell of HEK, extracts cell pyrolysis liquid after 48h, anti-Flag is added
Primary antibody and synthesis H3K9, H3K9me1, H3K9me2, H3K9me3, H3K27, H3K27me1, H3K27me2 and H3K27me3
Simulating peptide is common respectively to be incubated overnight, and Flag antibody conjugates are precipitated with the pearl of proteinA/G, are recycled immune
The method of trace is analyzed.Experimental result shows that Flag-PHF6 and H3K9me1/H3K9me2/H3K9me3 have combination,
In and H3K9me1 and H3K9me2 combination it is weaker, the combination of PHF6 and H3K9me3 are more (Fig. 2A)；Flag-PHF6 with
H3K27/H3K27me1/H3K27me2/H3K27me3 has combination (Fig. 2 B).
Embodiment 3, PHF6 can combine the site (me1/2/3) H3K9 and the H3K27 (me1/2/ of the transcription initiation region rDNA
3) site
HeLa cell is selected, is tested using the method for Re-ChIP, that is, is needed with the co-precipitation step of chromatin immune twice
Suddenly.Firstly, collecting cell pyrolysis liquid after fixing using formaldehyde, supernatant is collected after centrifugation in ultrasonication, utilizes the primary antibody of anti-PHF6
It is incubated for supernatant, the DNA small fragment that magnetic bead obtains an anti-binding of anti-PHF6 is added；It is anti-by being combined with obtained in previous step
In the magnetic bead of the DNA small fragment of an anti-binding of PHF6 be added 10mM dithiothreitol (DTT) (DL-Dithiothreitol, DTT) into
Eluent is divided into the equal numbers of needs, is separately added into phase after adding cell pyrolysis liquid to be diluted to suitable volumes again by row elution action
Corresponding negative control IgG, anti-PHF6/H3K9me1/H3K9me2/H3K9me3/H3K27me1/H3K27me2/H3K27me3
Primary antibody carries out chromatin immune co-precipitation experiment, finally obtains the DNA small fragment of these corresponding anti-bindings.For the side of research
Just, we select H0 primer as representing, and the method for obtained DNA small fragment Real Time RT-PCR is detected.
Chromatin immune co-precipitation experimental result show, the H3K9me1/H3K9me2/ of the transcription initiation region PHF6 and rDNA
H3K9me3 has combination (Fig. 3 A), and the H3K27me1/H3K27me2/H3K27me3 of the transcription initiation region PHF6 and rDNA has combination
(Fig. 3 B).
Embodiment 4, PHF6 can regulate and control the level of the transcription initiation region rDNA H3K9me3
1, the level of the transcription initiation region rDNA H3K9me3 can be significantly improved by being overexpressed PHF6
1.1 overexpression PHF6 can significantly improve the level of the transcription initiation region rDNA H3K9me3 in HeLa cell
Overexpression is expressed PHF6 with Lipofectamine 2000transfection reagent (Invitrogen)
The encoding gene of PHF6 (is inserted between the site BamHI and EcoRI of pFlag-CMV2 and obtains Flag- by plasmid Flag-PHF6
PHF expression plasmid) import HeLa cell after, pass through immune-blotting method to Flag-PHF6 expression (Fig. 4 A)；Exempted from using chromatin
The method of epidemic disease co-precipitation and Real Time RT-PCR detects that expression Flag-PHF6 can dramatically increase rDNA transcription initiation
Region H3K9me3 level (Fig. 4 B).
1.2 overexpression PHF6 can significantly improve the level of the transcription initiation region rDNA H3K9me3 in Jurkat cell
The Packaging experimentation of slow virus is carried out using human embryonic kidney cell line's HEK 293T cell.Specific experimental method is as follows: will
293T cell is cultivated in 10cm Tissue Culture Dish, and the stand density of observation 293T cell can be carried out transfecting when reaching 80%
The experiment of viral packaging plasmid.It should be noted that 1h renews the fresh DMEM culture containing 10% fetal calf serum before transfection
Base is needed when changing culture medium softly, because the adherent ability of 293T cell is not fine.Slow disease is carried out using the method for calcium phosphate
The transfection experiment of toxin grain.The slow virus packaging plasmid ratio being added in each culture dish is as follows: two packaging virus are respectively 5
μ g, target plasmid/negative control plasmids are 10 μ g.It needs to collect to be placed in 4 DEG C by cell supernatant after transfection 12h to store, and
The DMEM culture medium containing 30% fetal calf serum is added in cell and continues culture for 24 hours, collects cell supernatant again later, and
With first time collect supernatant mix, be dispensed into cell cryopreservation tube be placed in it is spare in -80 DEG C, obtain overexpression PHF6 it is slow
The slow virus of virus and negative control.
It with above two slow virus infected cell, operates as follows: cell passage being cultivated in six orifice plates, exchanges fresh training for
Base is supported, suitable slow virus re-suspension liquid (20-100 μ l) is added according to the Packing Condition of virus, while needing to be added 5 μ g/ml's
Polybrene is placed in cell incubator after mixing and cultivates.Fresh culture is replaced after 12h, and puromycin is added afterwards for 24 hours
(final concentration of 1ug/ml) drug screening three days, observes cell survival.The cell death not being infected, at us
Experiment in, slow virus can reach 90% or more to the infection rate of HeLa cell, obtain be overexpressed PHF6 Jurkat cell system
With negative control Jurkat cell system.
Both cell lines are inoculated in in six orifice plates equipped with 1640 culture mediums containing 10% fetal calf serum 37 DEG C respectively
Culture 24 hours collects cell cracking cell extraction protein, then with the antibody of anti-PHF6 (from Santa Cruz company respectively
Purchase) carry out the protein level variation (Fig. 4 C) that Western blot immunoblot experiment detects PHF6.The Western blot
In immunoblot experiment, with GAPDH (glyceraldehyde-3-phosphate dehydrogenase) for internal reference.
Both cell lines are inoculated in in six orifice plates equipped with 1640 culture mediums containing 10% fetal calf serum 37 DEG C respectively
Culture 24 hours is handled using the method that chromatin immune is co-precipitated, and the method for Real Time RT-PCR detects table
Bright, the level of the transcription initiation region rDNA H3K9me3 significantly improves (Fig. 4 D) in Jurkat cell after overexpression PHF6.
2, striking low PHF6 can reduce the level of the transcription initiation region rDNA H3K9me3
2.1, which strike low PHF6, can significantly reduce the level of HeLa cellular rDNA-transcription initiation region H3K9me3
(1) shRNA for targeting PHF6 can reduce to conspicuousness the PHF6 protein expression of HeLa cell.One is packed first
The slow virus (entitled shPHF6 slow virus) of the shRNA (entitled shPHF6) of expression targeting PHF6 packs another expression
The slow virus (entitled shNC slow virus) of the shRNA (entitled shNC) of random sequence is used as negative control.Then it uses respectively
ShPHF6 slow virus, shNC slow virus both slow-virus infections HeLa cell, the results showed that the interference sequence shPHF6 of PHF6
It can reduce to conspicuousness the PHF6 protein expression (Fig. 4) of HeLa cell.
Wherein, experimental method is as follows:
2.1.1 the packaging of the slow virus of low protein expression is struck
The sequence of both of shPHF6 and shNC shRNA are as follows:
shPHF6:
GATCCGCAGAATTTGGAGACTTTGATATTCAAGAGATATCAAAGTCTCCAAATTCTGTTTTTTGGAAA
(SEQ ID No.1)
shNC:
TTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATT(SEQ ID No.2)
The shPHF6 DNA encoded is inserted into pGPH1/GFP/Neo and obtains the expression vector of shPHF6, by shNC coding
DNA is inserted into pGPH1/GFP/Neo and obtains the expression vector of shNC.The expression vector of the shPHF6 is packaged into expression shPHF6
Slow virus (entitled shPHF6 slow virus), by the expression vector of shNC be packaged into expression shNC slow virus it is (entitled
ShNC slow virus).ShPHF6 slow virus and shNC slow virus utilize cat. no by Shanghai JiMa pharmacy Technology Co., Ltd
It is prepared for the slow virus packaging system of D01001.ShPHF6 slow virus is different with the shRNA sequence in shNC slow virus except expression
Outside, other all the same.
2.1.2 two kinds of slow-virus infection HeLa cells of 2.1.2 are used respectively.Infection method is as follows: HeLa cell inoculation in
5 μ g/ml Polybrene are first added after cultivating 24 hours in the DMEM culture medium containing 10% fetal calf serum in 37 DEG C in six orifice plates
(Sigma), it is then respectively adding 1 × 108TU/ml shPHF6 slow virus venom and shNC slow virus venom.After 12 hours, go
Except virus-culturing fluid is contained, renews the fresh DMEM culture medium for containing 10% fetal calf serum and continue to cultivate the HeLa that virus infection is crossed at 37 DEG C
Cell, culture respectively obtained two kinds of successful cell lines of slow-virus infection, the i.e. HeLa of shPHF6 slow-virus infection after 36 hours
The HeLa cell line of cell line and shNC slow-virus infection.Both cell lines are inoculated in respectively equipped with containing 10% fetal calf serum
DMEM culture medium six orifice plates in 37 DEG C cultivate 24 hours, cell cracking cell extraction protein is collected respectively, then with anti-
The antibody (buying from Santa Cruz company) of PHF6 carries out the albumen water of Western blot immunoblot experiment detection PHF6
Flat variation (Fig. 4 E).In the Western blot immunoblot experiment, with GAPDH (glyceraldehyde-3-phosphate dehydrogenase) for internal reference.
(2) striking the transcription initiation region the rDNA H3K9me3 level after low PHF6 in HeLa cell significantly reduces
The HeLa cell line of the HeLa cell line of shPHF6 slow-virus infection and shNC slow-virus infection is inoculated in respectively
It is cultivated 24 hours for 37 DEG C in six orifice plates equipped with the DMEM culture medium containing 10% fetal calf serum, utilizes chromatin immune co-precipitation
Method is handled, and the detection of the method for Real Time RT-PCR shows to strike after low PHF6 rDNA transcription initiation in HeLa cell
The horizontal of region H3K9me3 significantly reduces (Fig. 4 F).
2.2, which strike low PHF6, can significantly reduce the level of the transcription initiation region rDNA H3K9me3 in Jurkat cell
(1) shRNA for targeting PHF6 can reduce to conspicuousness the PHF6 protein expression of Jurkat cell.It is slow with shPHF6
Virus, shNC slow virus both slow-virus infection Jurkat cells, prepare the Jurkat cell system of shPHF6 slow-virus infection
With the Jurkat cell system of shNC slow-virus infection.Both cell lines are inoculated in respectively and are equipped with containing 10% fetal calf serum
It is cultivated 24 hours for 37 DEG C in six orifice plates of 1640 culture mediums, collects cell cracking cell extraction protein respectively, then with anti-
The antibody (buying from Santa Cruz company) of PHF6 carries out the albumen water of Western blot immunoblot experiment detection PHF6
Flat variation (Fig. 4 G).In the Western blot immunoblot experiment, with GAPDH (glyceraldehyde-3-phosphate dehydrogenase) for internal reference.
(2) striking the transcription initiation region the rDNA H3K9me3 level after low PHF6 in Jurkat cell significantly reduces
The Jurkat cell system of shPHF6 slow-virus infection and the Jurkat cell system of shNC slow-virus infection are inoculated with respectively
It cultivates 24 hours for 37 DEG C in six orifice plates equipped with 1640 culture mediums containing 10% fetal calf serum, is co-precipitated using chromatin immune
Method handled, the detection of the method for Real Time RT-PCR shows to strike rDNA transcription in Jurkat cell after low PHF6
The horizontal of initiation region H3K9me3 significantly reduces (Fig. 4 H).
SEQUENCE LISTING
<110>Shenzhen Graduate School of Tsinghua University
<120>substance and its application of the histone methylated level of rDNA gene chromatin are adjusted
<130> CP11801314C
<160> 19
<170> PatentIn version 3.3
<210> 1
<211> 68
<212> DNA
<213>artificial sequence
<400> 1
gatccgcaga atttggagac tttgatattc aagagatatc aaagtctcca aattctgttt 60
tttggaaa 68
<210> 2
<211> 49
<212> DNA
<213>artificial sequence
<400> 2
ttctccgaac gtgtcacgtt tcaagagaac gtgacacgtt cggagaatt 49
<210> 3
<211> 1098
<212> DNA
<213>artificial sequence
<400> 3
atgtcaagct cagttgaaca gaaaaaaggg cctacaagac agcgcaaatg tggcttttgt 60
aagtcaaata gagacaagga atgtggacag ttactaatat ctgaaaacca gaaggtggca 120
gcgcaccata agtgcatgct cttttcatct gctttggtat catcacactc tgataatgaa 180
agtcttggtg gattttctat tgaagatgtc caaaaggaaa ttaaaagagg cacgaagctg 240
atgtgttctt tgtgccattg tcctggagca acaattggtt gtgatgtgaa aacatgtcac 300
aggacatacc actaccactg tgcattgcat gataaagctc aaatacgaga gaaaccttca 360
caaggaattt acatggtcta ttgccgaaaa cacaagaaaa ctgcacataa ctccgaagct 420
gatttagaag aaagttttaa tgaacatgaa ctggagccct catcacctaa aagtaaaaag 480
aaaagtcgca aaggaaggcc aagaaaaact aattttaaag ggctgtcaga agataccagg 540
tccacatcct cccatggaac agatgaaatg gaaagtagtt cctatagaga taggtctcca 600
cacagaagca gccctagtga caccaggcct aaatgtggat tttgccatgt aggggaggaa 660
gaaaatgaag cacgaggaaa actgcatata tttaatgcca agaaggcagc tgcccattat 720
aagtgcatgt tgttttcttc tggcacagtc cagctcacaa caacatcaag agcagaattt 780
ggagactttg atattaaaac tgtacttcag gagattaaac gaggaaaaag aatgaaatgt 840
acactttgca gtcagcctgg tgctactatt ggatgtgaaa taaaagcctg tgttaagact 900
taccattacc actgtggagt acaagacaaa gctaaataca ttgaaaatat gtcacgagga 960
atttacaaac tatactgtaa aaatcatagt ggaaatgatg agagagatga agaagatgag 1020
gaacgagaga gtaaaagccg aggaaaagta gaaattgatc agcaacaact aactcagcag 1080
caacttaatg gaaactag 1098
<210> 4
<211> 20
<212> DNA
<213>artificial sequence
<400> 4
ggtatatctt tcgctccgag 20
<210> 5
<211> 20
<212> DNA
<213>artificial sequence
<400> 5
gacgacaggt cgccagagga 20
<210> 6
<211> 21
<212> DNA
<213>artificial sequence
<400> 6
ggcggtttga gtgagacgag a 21
<210> 7
<211> 21
<212> DNA
<213>artificial sequence
<400> 7
acgtgcgctc accgagagca g 21
<210> 8
<211> 21
<212> DNA
<213>artificial sequence
<400> 8
cgacgaccca ttcgaacgtc t 21
<210> 9
<211> 21
<212> DNA
<213>artificial sequence
<400> 9
ctctccggaa tcgaaccctg a 21
<210> 10
<211> 21
<212> DNA
<213>artificial sequence
<400> 10
agtcgggttg cttgggaatg c 21
<210> 11
<211> 21
<212> DNA
<213>artificial sequence
<400> 11
cccttacggt acttgttgac t 21
<210> 12
<211> 21
<212> DNA
<213>artificial sequence
<400> 12
acctggcgct aaaccattcg t 21
<210> 13
<211> 21
<212> DNA
<213>artificial sequence
<400> 13
ggacaaaccc ttgtgtcgag g 21
<210> 14
<211> 21
<212> DNA
<213>artificial sequence
<400> 14
gttgacgtac agggtggact g 21
<210> 15
<211> 21
<212> DNA
<213>artificial sequence
<400> 15
ggaagttgtc ttcacgcctg a 21
<210> 16
<211> 21
<212> DNA
<213>artificial sequence
<400> 16
ccttccacga gagtgagaag c 21
<210> 17
<211> 21
<212> DNA
<213>artificial sequence
<400> 17
tcgacctccc gaaatcgtac a 21
<210> 18
<211> 20
<212> DNA
<213>artificial sequence
<400> 18
cccgggggag gtatatcttt 20
<210> 19
<211> 18
<212> DNA
<213>artificial sequence
<400> 19
ccaacctctc cgacgaca 18
Claims (8)
1. the substance for regulating and controlling 6 expression of plant homeodomain zinc finger protein is tri-methylated in the positive regulation rDNA chromatin of preparation
Application in horizontal product.
2. application according to claim 1, the application is to improve the substance of PHF6 expression in preparation up-regulation rDNA
Application in the product of the tri-methylated level of chromatin, it is preferable that the substance for improving PHF6 expression is encoding regulator
The DNA molecular of plant homeodomain zinc finger protein 6, or the DNA containing encoding regulator plant homeodomain zinc finger protein 6 points
Recombinant vector, recombinant microorganism, recombinant plant cell or the recombinant animal cell of son.
3. application according to claim 1, the application is to reduce the substance of PHF6 expression in preparation downward rDNA
Application in the product of the tri-methylated level of chromatin, it is preferable that the substance for reducing PHF6 expression is shRNA, table
Up to the expression vector of the shRNA, recombinant microorganism cell, recombinant animal cell, recombinant plant cell, or reduce PHF6 expression
The expression vector of siRNA, the expression siRNA that horizontal shRNA is generated, recombinant microorganism cell, recombinant animal cell, again
Group plant cell.
4. application according to claim 3, the shRNA is the short hairpin RNA to form loop-stem structure, the stem ring knot
One article of sequence of stem is 772-795 of SEQ ID No.3 in structure, another chain-ordering of the stem in the loop-stem structure with
SEQ ID 772-795 reverse complementals of No.3；Preferably
shPHF6:
GATCCGCAGAATTTGGAGACTTTGATATTCAAGAGATATCAAAGTCTCCAAATTCTGTTTTTTGGAAA SEQ
ID No.1
Or
shNC:
TTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATT SEQ ID No.2。
5. application according to claim 1-4,6 sequence of regulation plant homeodomain zinc finger protein is such as
Described in SEQ ID No.3.
6. application according to claim 1-5, the tri-methylated rDNA chromatin is rDNA chromatin group egg
White H3K9me1, H3K9me2, H3K9me3, H3K27, H3K27me1, H3K27me2, H3K27me3, preferably H3K9me3.
7. the substance for regulating and controlling 6 expression of plant homeodomain zinc finger protein is treated in preparation since rRNA transcribes pre-RNA
Purposes in the drug of caused cancer, it is preferable that the cancer is leukaemia.
8. purposes according to claim 7, wherein the substance of regulation 6 expression of plant homeodomain zinc finger protein is
Increase the substance of PHF6 expression.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811038473.5A CN109172597B (en) | 2018-09-06 | 2018-09-06 | Substance for regulating methylation level of rDNA gene chromatin histone and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811038473.5A CN109172597B (en) | 2018-09-06 | 2018-09-06 | Substance for regulating methylation level of rDNA gene chromatin histone and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109172597A true CN109172597A (en) | 2019-01-11 |
| CN109172597B CN109172597B (en) | 2020-12-18 |
Family
ID=64914966
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811038473.5A Active CN109172597B (en) | 2018-09-06 | 2018-09-06 | Substance for regulating methylation level of rDNA gene chromatin histone and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109172597B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109876144A (en) * | 2019-04-03 | 2019-06-14 | 山东大学 | Purposes of the EMC8 gene inhibitor in preparation treatment gastric cancer medicament |
| WO2022025502A1 (en) * | 2020-07-30 | 2022-02-03 | 서울대학교산학협력단 | Method for screening histone h2b epigenetic regulator targeting phf6 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011106104A2 (en) * | 2010-02-26 | 2011-09-01 | Memorial Sloan-Kettering Cancer Center | Methods and compositions for the detection and treatment of cancer involving mirnas and mirna inhibitors and targets |
| CN104508143A (en) * | 2012-03-12 | 2015-04-08 | 纪念斯隆-凯特琳癌症中心 | Methods and compositions for the diagnosis, prognosis and treatment of acute myeloid leukemia |
| CN107893118A (en) * | 2017-12-25 | 2018-04-10 | 合肥艾迪康临床检验所有限公司 | Detect the method and primer of PHF6 point mutation |
-
2018
- 2018-09-06 CN CN201811038473.5A patent/CN109172597B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011106104A2 (en) * | 2010-02-26 | 2011-09-01 | Memorial Sloan-Kettering Cancer Center | Methods and compositions for the detection and treatment of cancer involving mirnas and mirna inhibitors and targets |
| CN104508143A (en) * | 2012-03-12 | 2015-04-08 | 纪念斯隆-凯特琳癌症中心 | Methods and compositions for the diagnosis, prognosis and treatment of acute myeloid leukemia |
| CN107893118A (en) * | 2017-12-25 | 2018-04-10 | 合肥艾迪康临床检验所有限公司 | Detect the method and primer of PHF6 point mutation |
Non-Patent Citations (5)
| Title |
|---|
| CORBIN E. MEACHAM ET AL.: "A genome-scale in vivo loss-of-function screen identifies Phf6 as a lineage-specific regulator of leukemia cell growth", 《GENES & DEVELOPMENT》 * |
| JIADONG WANG ET AL.: "PHF6 Regulates Cell Cycle Progression by Suppressing Ribosomal RNA Synthesis", 《THE JOURNAL OF BIOLOGICAL CHEMISTRY》 * |
| MATTHEW AM TODD ET AL.: "The sub-nucleolar localization of PHF6 defines its role in rDNA transcription and early processing events", 《EUROPEAN JOURNAL OF HUMAN GENETICS》 * |
| WEIJUN FENG ET AL.: "PHF8 activates transcription of rRNA genes through H3K4me3 binding and H3K9me1/2 demethylation", 《NATURE STRUCTURAL & MOLECULAR BIOLOGY》 * |
| 吴彦萍: "PHF6和SUV39H1相互作用调节rDNA转录的机制研究", 《中国博士学位论文全文数据库医药卫生科技辑》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109876144A (en) * | 2019-04-03 | 2019-06-14 | 山东大学 | Purposes of the EMC8 gene inhibitor in preparation treatment gastric cancer medicament |
| CN109876144B (en) * | 2019-04-03 | 2019-11-22 | 山东大学 | Purposes of the EMC8 gene inhibitor in preparation treatment gastric cancer medicament |
| WO2022025502A1 (en) * | 2020-07-30 | 2022-02-03 | 서울대학교산학협력단 | Method for screening histone h2b epigenetic regulator targeting phf6 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109172597B (en) | 2020-12-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109172597A (en) | Adjust substance and its application of the histone methylated level of rDNA gene chromatin | |
| Hao et al. | Isoleucine stimulates mTOR and SREBP-1c gene expression for milk synthesis in mammary epithelial cells through BRG1-mediated chromatin remodelling | |
| CN113384700B (en) | Target LY6E capable of effectively inhibiting Ebola virus infection and application thereof | |
| CN110960677B (en) | Use of SAGE1 inhibitor in preparation of medicine or kit | |
| Gong et al. | Peroxiredoxin 1 is involved in disassembly of flagella and cilia | |
| CN110974963B (en) | Use of a substance for modulating SAGE1-INTS3 complex expression and/or function | |
| Choi et al. | Elevated levels of stress proteins associated with bacterial symbiosis in Amoeba proteus and soybean root nodule cells | |
| CN110302197A (en) | A kind of lncRNA relevant to the miscellaneous Shandong amine therapeutic sensitivity of grace and its application in the miscellaneous Shandong amine treatment prostate cancer of grace | |
| CN110170051A (en) | Application of the KLF12 albumen in preparation treatment non-small cell lung cancer drug | |
| CN101309928A (en) | E2EPF ubiquitin carrier protein-VON HIPPEL-LINDAU interaction and uses thereof | |
| CN103215267B (en) | Suppress siRNA and its application of influenza virus related gene | |
| CN107970434A (en) | A kind of REG γ -20S proteasomes peptide inhibitors and its application | |
| KR20190015374A (en) | A fusion protein for improving the amount of protein expression from the target mRNA | |
| CN108339126A (en) | It is a kind of for the gene target drug for the treatment of cancer and its application | |
| CN103952410B (en) | The shRNA of a kind of effective suppression rat FoxO3a genetic expression and application thereof | |
| Luo et al. | Engagement of heterogeneous nuclear ribonucleoprotein M with listeriolysin O induces type I interferon expression and restricts Listeria monocytogenes growth in host cells | |
| CN112961826A (en) | Application of transcription factor ZHX2 in NK cell regulation | |
| CN110358765A (en) | Inhibit siRNA and its application of people TNFAIP1 gene expression | |
| Cai et al. | NS5 hijacks TRAF3 to inhibit type I interferon signaling during duck Tembusu virus infection | |
| Bravo et al. | Expression of exogenous proteins and short hairpin RNAs in human primary thyrocytes | |
| CN109701018B (en) | Application of targeted interference on GOLPH3 gene expression in improvement of radiotherapy sensitivity of non-small cell lung cancer | |
| CN117143921B (en) | Medicine for treating non-alcoholic fatty liver and related diseases, expression vector and application | |
| CN116832162A (en) | Application of CD244 in serving as gene editing target for resisting African swine fever | |
| EP4365294A1 (en) | Application of plant jaz proteins and derived polypeptides in prevention and treatment of human and animal tumors | |
| CN108338986A (en) | A kind of microRNA and its application for treating cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |