CN108338986A - A kind of microRNA and its application for treating cancer - Google Patents
A kind of microRNA and its application for treating cancer Download PDFInfo
- Publication number
- CN108338986A CN108338986A CN201710049669.3A CN201710049669A CN108338986A CN 108338986 A CN108338986 A CN 108338986A CN 201710049669 A CN201710049669 A CN 201710049669A CN 108338986 A CN108338986 A CN 108338986A
- Authority
- CN
- China
- Prior art keywords
- dhx33
- cancer
- cell
- myc
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of microRNA for treating cancer and its application, the small RNA molecular has the function of striking the protein content of low DHX33, and sequence is：TTGGGAAGCTGGTTGGCTATA.The microRNA has the function of that the protein content for striking low DHX33 makes up to basic horizontal, to reduce the carcinogenicity of c Myc and maintain the effect of cancerous characteristics, to achieve the purpose that treating cancer.
Description
Technical field
The present invention relates to biotechnology, a kind of microRNA for treating cancer and its application are related generally to.
Background technology
The past during the decade, the newly-increased number of Cancer in China patient is in ascendant trend year by year, and 5 years of cancer patient are flat
Equal survival rate is but less than one one-tenth, well below fifty percent or more level of developed country.It is shown according to recent statistics data：China
Cancer additional population has leaped into the front ranks of the world.The form of above-mentioned sternness so that controlling for cancer is understood and explored from completely new visual angle
Treatment becomes extremely urgent.
C-Myc is one of the oncogene of the high expression in kinds cancer, can occur gene magnification or easy in kinds cancer
Position (translocation)；Meanwhile the inhibition albumen Mga deletion mutants of Myc can also cause the overexpression of Myc.c-
Myc is mainly combined with Max in the cell, forms the transcription factor of c-Myc/Max dimer complex, plays regulation and control downstream gene
And then the function of hyperplasia and metabolism is stimulated, the imbalance of the function occurs nearly in all human cancers.For cancer cell
(oncogene addiction) is relied on to the growth of oncogene, it, can to patient using the medicine for targeting different cancer proteins
To inhibit the development of cancer in specific manner, extends patient's service life, realize accurate personalized treatment.Example wherein most outstanding is
The tyrosine kinase receptor inhibitor EGFR-TKI of EGFR achieves fine curative effect in clinic.However, although in mouse mould
In type inhibit c-Myc be proved to be able to effectively contain cancer occurrence and development, but due to c-Myc itself as one transcription because
Son is difficult to target, therefore medically there is no effective drug that can pointedly inhibit swashing for c-Myc signal pathways so far
It is living.
Since oncogene c-Myc itself is difficult to target control, then being screened for its upstream or downstream signaling pathway anti-
Cancer drug is then particularly important.Currently, to the upper of some more classical oncogenes or tumor suppressor gene approach in cancer research
It swims signal pathway to understand than more visible, but for oncogene/tumor suppressor gene downstream signaling pathway, people understand not
Comprehensively.These downstream molecules are most important to maintaining cancer cell character, can integrate a variety of stream signal accesses and carry out regulating cell
Growth is the potential source of the following anticancer drug exploitation.For example, protein translation be intracellular most conservative vital movement it
One, wherein 4E-BP (are the approach for maintaining cell normal function by being combined regulation and control cap-dependent protein translations with eIF4E
One of), and this important controlling soil moist is lacked of proper care in many cancers, and the growth of cancer cell, division is caused to close albumen
At there is very strong dependence, carcinobiology is had become to the research of the eIF4E protein translation regulatory mechanisms mediated at present
One research hotspot.Expression quantity of the albumen PKM2 of regulating cell metabolism in cancer cell is more much higher than in normal cell for another example
Times, it participates in the glycolysis Warburg effects of cancer cell, regulation and control metabolism recombination etc.；PKM2 is inhibited to be proved to that cancer can be inhibited thin
Born of the same parents' hyperplasia is bred, and does not have notable side effect to normal cell.It is considered as the conservative life of cell all the time that ribosomes, which generates,
The transcription of one of life activity (housekeeping), RNA polymerase I can be by a variety of oncogenes, the signal path tune of tumor suppressor gene
Control, shows the transcriptional activity of enhancing in many cancer cells.RNA polymerase I is considered as the another for the treatment of of cancer in recent years
A potential drug target spot, wherein CX5461 are that the inhibition RNA polymerase I of first I phase of entrance clinic transcribes drug, it is thin to cancer
The targeting of born of the same parents is single-minded, and the damage very little to normal cell, is that common chemotherapeutics is incomparable.
In conclusion protein translation, Warburg effects, ribosomes generate etc. in cancer cell the phenomenon that Showed Very Brisk
Research object is all can serve as, i.e., by inhibiting these downstream pathways equally to can reach the purpose of inhibition cancer development, Jin Erwei
The exploitation of potential anti-cancer therapies provides thinking.With the development of cancer individualized treatment, some drugs, which can reach, to be had
Effect inhibits the purpose of cancer development.But many cancers caused by being expanded by oncogene c-Myc or being activated still lack effectively so far
Medicine.The member DHX33 that we are previously found RNA helicase family takes part in protein translation and ribosomes
The generation of RNA, further investigation revealed that this albumen is actively engaged in inhibition Apoptosis.DHX33 is one of the downstreams c-Myc
Gene plays a crucial role in the development of cancer of c-Myc inductions.
Invention content
In view of above-mentioned deficiencies of the prior art, the purpose of the present invention is to provide a kind of small molecules for treating cancer
RNA and its application, it is desirable to provide a kind of drug of new treating cancer.
Technical scheme is as follows：
A kind of microRNA for treating cancer, wherein the small RNA molecular has the protein content for striking low DHX33
Effect, sequence is：
TTGGGAAGCTGGTTGGCTATA。
A kind of application of the microRNA as described above for treating cancer, wherein be used for the microRNA
The drug for the treatment of cancer is prepared, the cancer is cancer caused by being expanded or activated by oncogene c-Myc.
The application of the microRNA for treating cancer, wherein the cancer is adenocarcinoma of lung.
Advantageous effect：Many cancers still lack effective medicine so far caused by being expanded or activated by oncogene c-Myc
Object, the gene target drug, slow virus plasmid and slow virus and preparation method thereof for treating cancer of the invention are described to be used for
Tiny RNA sequence containing targeting DHX33 in the slow virus plasmid for the treatment of cancer：sh-DHX33-2:5’-
TTGGGAAGCTGGTTGGCTATACTCGAGTATAGCCAACCAGCTTCCCAA-3’.The microRNA is low with striking
The protein content of DHX33 makes up to the effect of basic horizontal, to reduce the carcinogenicity of c-Myc and maintain the work of cancerous characteristics
With to achieve the purpose that treating cancer.
Description of the drawings
Fig. 1 is the testing result figure of protein content in the embodiment of the present invention 1.
Fig. 2 is the testing result figure of the apoptosis situation of microscopically observation cell in the embodiment of the present invention 1.
Fig. 3 is the Apoptosis assay figure that flow cytomery is used in the embodiment of the present invention 1.
Fig. 4 is the testing result figure that BT549 protein contents are put in the embodiment of the present invention 2.
Fig. 5 is the testing result figure of H1299 protein contents in the embodiment of the present invention 2.
Fig. 6 is the testing result figure of apoptosis gene Bcl-2 and BAD messenger rna level in the embodiment of the present invention 2.
The chromosome that Fig. 7 is incorporated in Bcl-2 and BAD gene promoters for analysis DHX33 in the embodiment of the present invention 2 is immune altogether
The PCR product electrophoresis result figure of sedimentation experiment.
Fig. 8 is the real-time fluorescence PCR detection result figure of DHX33 mRNA amounts in the embodiment of the present invention 3.
Fig. 9 is the testing result figure of DHX33 protein contents in the embodiment of the present invention 3.
Figure 10 is each in the conservative region E-box that c-Myc transcription factors are combined with promoter DNA in the embodiment of the present invention 3
A base schematic diagram.
Figure 11 is the signal in the sites E-Box and sequence contained in DHX33 gene proximal promoters in the embodiment of the present invention 3
Figure.
Figure 12 is to prove that c-Myc albumen is directly incorporated in DHX33 gene promoters and generates electrophoresis shifting in the embodiment of the present invention 4
The analysis result of dynamic rate variation.
Figure 13 is the expression of normal lung tissue and the DHX33 in cancerous lung tissue example and c-Myc in the embodiment of the present invention 4
Express comparison diagram.
Figure 14 is the analysis chart of each protein content in the embodiment of the present invention 4.
Figure 15 is Cell migration assay in the embodiment of the present invention 4
Figure 16 is that BrdU cell proliferation experiments are in the embodiment of the present invention 4
Figure 17 is the soft agar suspension independent growths experimental comparison figure of cell in the embodiment of the present invention 4.
Figure 18 is pair for causing cellular migration inhibition in the embodiment of the present invention 4 in analysis lung adenocarcinoma cell after missing DHX33
Than figure.
Figure 19 is the comparison diagram for the ability that control group forms tumour with experimental group in Mice Body in the embodiment of the present invention 5.
Figure 20 is result of the control group with experimental group to the quantitative analysis of formation tumour in nude mice in the embodiment of the present invention 5
Figure.
Figure 21 is the small RNA molecular inhibition DHX33 protein expressions that various targeting DHX33 are analyzed in the embodiment of the present invention 6
Interpretation of result figure.
Specific implementation mode
The present invention provides a kind of microRNA for treating cancer and its application, to make the purpose of the present invention, technical side
Case and effect are clearer, clear, and the present invention is described in more detail below.It should be appreciated that specific reality described herein
It applies example to be only used to explain the present invention, be not intended to limit the present invention.
A kind of small RNA molecular for treating cancer is provided in the present invention, the small RNA molecular, which has, strikes low DHX33's
Protein content makes up to the effect of basic horizontal, to reduce the carcinogenicity of c-Myc and maintain the effect of cancerous characteristics, to reach
To the purpose for the treatment of cancer.
The small RNA molecular is children purpura nephritis, and sequence is：
TTGGGAAGCTGGTTGGCTATA(SEQ ID NO:17)。
A kind of gene target drug for treating cancer is provided in the present invention, the gene target drug, which is coding, to be had
The nucleic acid sequence of the microRNA of the protein content effect of low DHX33 is struck, nucleic acid sequence is as follows：
(5’-3’)sh-DHX33-2:5’-TTGGGAAGCTGGTTGGCTATACTCGAGTATAGCC
AACCAGCTTCCCAA。
The gene target drug is imported intracellular using existing slow virus.The cancer be expanded by oncogene c-Myc or
Cancer caused by activation, such as adenocarcinoma of lung.There is the gene target drug protein content for striking low DHX33 to make up to basic water
Flat effect, to reduce the carcinogenicity of c-Myc and maintain the effect of cancerous characteristics, to achieve the purpose that treat adenocarcinoma of lung.By
It is used as a transcription factor in c-Myc itself, is difficult to target, shows that DHX33 is c- by experimental study in the present invention
The target site in treatment of cancer that Myc causes, DHX33 regulation and control are one of the downstream pathways of oncogene c-Myc, and this hair
Bright, the gene target drug provided is then to prevent cancer occurrence and development from signal pathway downstream.Therefore, the present invention is gone back
The application for providing the small RNA molecular for treating cancer, the small RNA molecular for treating cancer is used to prepare and is controlled
Treat the drug of cancer.The cancer is cancer caused by being expanded or activated by oncogene c-Myc, and the more specifically described cancer is
Adenocarcinoma of lung.
A kind of slow virus plasmid for treating cancer is also provided in the present invention, the slow virus plasmid contains coding targeting
The gene of the tiny RNA sequence of DHX33, the tiny RNA have the function of striking low DHX33 protein expression levels, the slow virus matter
(wherein sh-DHX33-1 is open sequence in the past to tiny RNA sequence containing coding targeting DHX33 in grain, with putting into effect in the present invention
Test control)：
sh-DHX33-1:(5’-3’):GCTATCGCAAAGTGATCATTTCTCGAGAAATGATCACTTTGCGATAGC
(SEQ ID NO:1)；
sh-DHX33-2:(5’-3’):TTGGGAAGCTGGTTGGCTATACTCGAGTATAGCCAACCAGCTTCCCAA
(SEQ ID NO:2)。
Further, the slow virus plasmid preparation needs pLKO.1-vector, pCMV-VSV-G and pCMV-
DR8.2dvpr (can be obtained) by buying.In this application, the model of slow virus plasmid is not required and is limited, as long as
The slow virus of the gene of the tiny RNA sequence and energy transfectional cell can be expressed.
In the present invention using pLKO.1 plasmids as specific embodiment, the gene of the tiny RNA sequence passes through limit
Restriction enzyme site AgeI/EcoRI processed is cloned into pLKO.1 plasmids.All add the restriction site AgeI/ in pLKO.1 plasmids
EcoRI.In order to build the slow virus plasmid of sh-DHX33-1 and sh-DHX33-2, the DNA synthesized by Huada gene company, point
It is not：
Oligonucleotides before sh-DHX33-1-：5’-
CCGGGCTATCGCAAAGTGATCATTTCTCGAGAAATGATCACTTTGCGATAGCTTTTTG 3’(SEQ ID NO:3)；
Oligonucleotides after sh-DHX33-1-：5’–AATTCAAAAAGCTATCG
CAAAGTGATCATTTCTCGAGAAATGATCACTTTGCGATAGC 3’(SEQ ID NO:4)；
Oligonucleotides before sh-DHX33-2-：5’-
CCGGTTGGGAAGCTGGTTGGCTATACTCGAGTATAGCCAACCAGCTTCCCAATTTTTG-3’(SEQ ID NO:5)；
Oligonucleotides after sh-DHX33-2-：5’-AATTCAAAAA
TTGGGAAGCTGGTTGGCTATACTCGAGTATAGCCAACCAGCTTCCCAA-3’(SEQ ID NO:6)；.
Then, the RNA sequence of above-mentioned sequence is cloned into the restriction site AgeI/EcoR of pLKO.1 plasmids i.e.
Can, obtain plasmid pLKO.1-shRNA.
A kind of slow virus for treating cancer is also provided in the present invention, the slow virus is gene target drug, for tool
There is the slow virus for striking low DHX33 protein expression levels effect, contains above-mentioned slow virus plasmid in the slow virus.
The specific preparation method that the slow virus is also provided in the present invention, includes the following steps：
It is transfected in 293T cells with Lipofectamine 2000 (Life Technologies) liposome leading-in technique
Plasmid mixture：Concrete operation method is transfected using 10 centimetres of Tissue Culture Dish, waits for 293T cell growths to 90%
When degrees of fusion, following plasmids are mixed, including pLKO.1-shRNA (i.e. above-mentioned slow virus plasmid), pCMV-VSV-G, pCMV-
The ratio of dR8.2dvpr, plasmid mixing are 9：8：1, so that total DNA amount is reached 12 microgram of each culture dish；
It was replaced with the culture medium containing antibiotic (penicillin and streptomysin) by 16-18 hours, it is small after 24 or 48
When, with Sterile pipette collect cell culture medium, low-speed centrifugal, 1000~2000 revs/min, two minutes, virus using point
Loaded in 5 milliliters of sterile centrifugation tubes, depositing in subzero 80 degree of refrigerator.
It is described further by the following examples.
Embodiment 1：Apoptosis is rapidly resulted in after lacking DHX33 in cancer cell
Include the following steps：
1) according to target tiny RNA sequence, the gene order of the composite coding target tiny RNA sequence；The tiny RNA sequence is target
To the tiny RNA sequence of DHX33；
2) gene order is cloned into virus particle；
3) virus particle is transfected on viral vectors；
4) by viral vectors dip dyeing cancerous cell line BT549 (HTB-122) and HCC1806 (CRL-2335)；
5) after the completion of disseminating, more renew culture medium, carry out secondary culture；
6) after cultivating a period of time, total protein is extracted, the expression quantity of DHX33 albumen is analyzed with immunoblot assay.
1, the structure of slow virus plasmid：
Experimental group：The sequence for targeting the RNA of DHX33 is as follows:
sh-DHX33-1:(5’-3’):GCTATCGCAAAGTGATCATTT (as positive controls)；
sh-DHX33-2:(5’-3’):TTGGGAAGCTGGTTGGCTATA。
Control group：Tiny RNA (shScrambled) sequence as negative control is：
(5’-3’):CCTAAGGTTAAGTCGCCCTCG。
The children purpura nephritis sequence for encoding above-mentioned sequence is cloned into the restriction site of pLKO.1vector respectively
On AgeI/EcoRI.
It is specific as follows：
(1) nucleic acid oligomer is obtained into a concentration of 20 micromolar solution with water dissolution, by the preceding nucleic acid oligomer of pairing with after
Nucleic acid oligomer is added by formula below in sterile PCR tubules：Each 5 microlitres of preceding nucleic acid oligomer, 5 microlitres of 10XNEB buffer solutions
2 (purchase gained) and 35 microlitres of water.
(2) it is handled 10 minutes at 100 degrees Celsius.
(3) 70 degrees Celsius are then slowly cooled to handle 10 minutes, is then slowly cooled to be placed at room temperature for again 3 small
When.
(4) the pLKO.1 TRC plasmids of 6 micrograms (purchase gained) are added to 5 microlitres of (the purchase institute of 10XNEB buffer solutions 1
), 1 microlitre of limitation restriction endonuclease AgeI, then plus water is to 50 microlitres, cultivates 2 hours after mixing at 37 degrees Celsius.With
Plasmid fragments after Qiaquick gel extraction kit (purchase gained) purification cutting, are then added 5 microlitres
10XNEB buffer solutions (are directed to EcoRI), and 1 microlitre of EcoRI adds water to 50 microlitres, and 2 hours are cultivated at 37 degrees Celsius.
(5) with the isolated DNA fragmentation of 0.8% low melting-point agarose gel, it can be seen that two segments, cutting
The segment of 7KB, then purification measure DNA concentration.
(6) with the nucleic acid oligomer after 2 microlitres of ready annealing in front, the DNA fragmentation of the purification of 20 nanograms is added, is added
The DNA ligase buffer solution and 1 microlitre of DNAT4 ligases of 2 microlitres of 10X, then plus water is to 20 microlitres, is placed on ambient temperature overnight.
(7) second days, it is used to convert 50 microlitres of XL-10gold competent escherichia coli cells with 2 microlitres of attachments
(purchase gained).Converted product is taped against in the LB agar plates containing 100 micrograms per millilitre culture medium of ampicillin, so
After be placed on 37 C overnights cultivation.
(8) second days, with sterile toothpick picking single bacterium colony the ampicillin containing above-mentioned concentration LB culture mediums
In, 10 hours are cultivated at 37 degree, and the plasmid extraction kit of QIAGEN is then used to extract Plasmid DNA.
(9) with the Plasmid DNA of 500 nanograms, each 0.5 microlitre of EcoRI/NcoI is added, 2 microlitres of 10NEB buffer solutions (are directed to
EcoRI), add water to 20 microlitres.1 hour is cultivated at 37 degree.
(10) agarose gel electrophoresis screening positive clone is used, there are one the bands of 5KB and 2KB for positive colony, survey
Whether sequence analyzes and identifies nucleic acid sequence correct.
(11) positive colony is expanded, then extracts high-purity plasmid with the big pumping plasmid extraction kits of QIAGEN.
2, the preparation of slow virus：With Lipofectamine 2000 (Life Technologies) liposome leading-in technique
Plasmid mixture is transfected in 293T cells.Concrete operation method is transfected using 10 centimetres of Tissue Culture Dish, waits for 293T
When degrees of fusion of the cell growth to 90%, following plasmids are mixed, including pLKO.1-shRNA, pCMV-VSV-G, pCMV-
The ratio of dR8.2dvpr, plasmid mixing are 9：8：1, so that total DNA amount is reached 12 microgram of each culture dish.More by 16-18 hours
It changes the culture medium containing antibiotic (penicillin and streptomysin) into, after 24 or 48 hours, cell is collected with Sterile pipette
Culture medium, low-speed centrifugal, 2000 revs/min, two minutes, virus was deposited in using being sub-packed in 5 milliliters of sterile centrifugation tube
Subzero 80 degree of refrigerator.
3, cancerous cell line BT549 and HCC1806 is obtained from the ATCC in the U.S..Both cells are encoded bobby pin respectively
The slow virus of RNA is infected, and cell is collected after 72 hours and extracts total protein.The method of specific extraction albumen is to be suspended from cell carefully
In cellular lysate liquid (20 mMs of Tris-HCl, 150 mMs of NaCl, 1 mM of EDTA, 1%Triton-X-100,
1%SDS, and add the inhibitor of protease and phosphatase).Structure obtains DHX33 and stablizes missing and stable expression cell line.With
Immunoblot assay analyzes expression quantity of the DHX33 albumen in each sample, with the antibody analysis total protein loading of anti-GAPDH
Amount.
The results are shown in Figure 1, control group DHX33 stable expression system shSCR-BT549 and shSCR-HCC1806, can
Detect DHX33 albumen；Experimental group DHX33 stablizes missing system 1-sh-DHX33-BT549,1-sh-DHX33-HCC1806,2-
Sh-DHX33-BT549,2-sh-DHX33-HCC1806 are nearly no detectable DHX33 albumen.
4, it is seen under the microscope after having lacked DHX33 in cancer cell to analyze the phenotype after cancer cell missing DHX33
Examine the phenomena of mortality of cell.Shown in result figure 2, control group shSCR-BT549 and shSCR-HCC1806 do not lack DHX33's
Cell growth is vigorous, and degrees of fusion is high；And lack two groups of cells 1-sh-DHX33-BT549,1-sh-DHX33- of DHX33
HCC1806,2-sh-DHX33-BT549,2-sh-DHX33-HCC1806 show the obviously phenomena of mortality.Illustrate that cancer is thin
DHX33 has been lacked in born of the same parents can rapidly result in cell death.
Further to analyze whether cell has the phenomenon that apoptosis after lacking DHX33, cell is further used into Annexin
V is dyed.Specific method is that cell is suspended in phosphate buffer (137 mMs of NaCl, 2.7 mMs of KCl, 10 mmoles
Your Na2HPO4, 1.8 mMs of KH2PO4), so that concentration is reached every milliliter of 1*106A cell.Then add in the suspension of cell
Enter Annexin V-FITC and, by 70 microns of strainer filtering of cell, then carries out flow cytometer after room temperature is handled 15 minutes
Analysis.As a result as Fig. 3 shows that cell has apparent phenomena of apoptosis after lacking DHX33, and the apoptosis ratio of control group is very
It is small.
Embodiment 2：DHX33 has regulated and controled the important gene Bcl-2 and BAD of control Apoptosis
Apoptosis is the programmed death process that cell starts in the variation of the impression external world or internal environment.By internal cause
In caused apoptosis process, mitochondrial protein has served critically important.Bak/Bax on mitochondrial inner membrane forms polymerization
Body channel, discharges in Intramitochondrial cytochrome c to cytoplasm, has caused the generation of apoptotic body therewith with caspase's
Activation, and then cause the apoptosis of irreversible a series of proteolytic cleavage reactions and cell.There are two the poly- of protein regulation Bak/Bax
It closes or activates, Bcl-2 can inhibit the activation of Bak/Bax, and BAD inhibits the vigor of Bcl-2.Cancer cell generally has higher contain
The Bcl-2 albumen of amount or the BAD of reduced levels are to inhibit its apoptosis.
1, in order to analyze inhibiting effect of the DHX33 to apoptosis, in this experiment, it is thin that two kinds of eugonic cancers are had chosen
Born of the same parents.Cancerous cell line H1299 (CRL-5803) and BT549 (HTB-122) are obtained from the ATCC in the U.S..Both cells respectively by
(clone being prepared in the embodiment used here has sh-DHX33-1 or sh-DHX33- to the slow virus of coding children purpura nephritis
2 slow virus and control group shScrambled) processing, cell is collected after 96 hours and extracts total protein.Total protein carries
Take method as previously described.With expression of the immunoblot assay analysis Apoptosis important factor BAD and Bcl-2 in each sample
Amount.
The marker of the missing efficiency and reacting cells apoptosis of DHX33 is also analyzed in the present embodiment simultaneously：Cutting
PARP, with the antibody analysis total protein applied sample amount of anti-tubulin.As a result as shown in Figure 4 and Figure 5, control group shSCR-BT549
In, the expression quantity of BAD is low, and in shSCR-H1299, Bcl-2 expression quantity is high；And lack DHX33 1-sh-DHX33-BT549 and
In 2-sh-DHX33-H1299, the expression quantity of BAD is high, and in 1-sh-DHX33-H1299 and 2-sh-DHX33-BT549, Bcl-2
Expression quantity is low.Illustrate that DHX33 has regulating and controlling effect to the gene BAD and BCL-2 that control Apoptosis.
2, we analyze above-mentioned cell after lacking DHX33 simultaneously, the expression of BAD and Bcl-2 mRNAs.This
We are extracted the total serum IgE in cell with Clontech kits (Nucleospin RNA II) first in experiment.Use reverse transcription
MRNA reverse transcription is become corresponding complementary DNA by enzyme.Then Bcl-2 and BAD is analyzed by the method for quantitative PCR to believe
Make contents of the RNA in each sample.We select GAPDH as internal reference, while analyzing the mRNA content of DHX33 with true
Determine DHX33 to have lacked.
The PCR primer of use is as follows：
People Bcl-2 (preceding primer) -5'-ACAGTCCCATCAAAACTCCTG-3'(SEQ ID NO:7)；
People Bcl-2 (rear primer) -5'-TTACAGGCACAGAACATCCAG-3'(SEQ ID NO:8)；
People BAD (preceding primer) -5'-GACCTTCGCTCCACATCC-3'(SEQ ID NO:9)；
People BAD (rear primer) -5'-AGTACTTCCGCCCATATTCAAG-3'(SEQ ID NO:10).
The results are shown in Figure 6, and in messenger rna level, the reduction of DHX33 leads to the variation of the two genetic transcriptions；Moreover,
Clone has the slow virus of sh-DHX33-2 to have the slow virus of sh-DHX33-1 to compare than clone, inhibits the effect of DHX33 expression
It is more preferable.
3, in order to study the mechanism of this regulation and control, we further analyze DHX33 albumen whether direct regulation and control BAD and
The transcription of Bcl-2 genes.For this purpose, co-sedimentation is immunized to analyze whether DHX33 is incorporated in BAD and Bcl-2 using chromosome in we
Promoter on.We use human lung cancer cell line H1299, by 1*107After cells trypsinised, it is suspended in completely
10 milliliters of DMEM culture mediums in, 37% formaldehyde, which is added, makes concentration reach 1%, and mixing makes to crosslink after ten minutes, at once plus
Entering 2.5 mole of glycine makes concentration reach 0.125 mole, handles 5 minutes and terminates cross-linking reaction.Then 1000 turns of conditions per minute
Lower centrifugation removes supernatant in 2 minutes, cell precipitation is washed twice with phosphate buffer, centrifugal method is the same.Then cell is split
Solution, the specific lysate with 2 milliliters, lysate contain 1%SDS, 50 mMs of Tris-HCl, 2 mMs of EDTA, 150
MM NaCl and protease and phosphatase inhibitor.Cell cracks after ten minutes on ice, with the ultrasound of 40% output
Broken instrument fully cracks, and cutting short long chain DNA makes the size for reaching 500bp-1000bp.Cell pyrolysis liquid after high speed centrifugation,
Supernatant is extracted, then diluting five times with RIPA lysates is divided into uniform three parts, and 50 microlitres of Protein A-agarose is added
Pearl mixes 30 minutes at 4 degree, is then centrifuged for obtaining supernatant.It is separately added into the antibody (Santa that antibody includes anti-DHX33
), Cruz anti-TBP (Santa Cruz) and IgG are as negative control.At 4 degree, mixing is cultivated makes antibody and antigen knot overnight
It closing, 25 microlitres of Protein A-agarose, which is then added, makes antibody binding proteins A- agaroses, after being mixed 1 and a half hours at 4 degree, centrifugation
Remove supernatant.Precipitation is washed 5 times with the RIPA buffer solutions containing 0.5 mole of NaCl.Then use eluent (0.2 mole
NaOH, 1%SDS) elution immunoprecipitate, it 100 microlitres every time, washes altogether 2 times.6 moles are added in the solution eluted
NaCl makes its concentration reach 0.6 mole.Then going out reason overnight at 65 degree makes DNA and albumen solution be crosslinked.With PCR product extracts reagent
Box extracts after DNA fragmentation therein.The efficiency of BAD and Bcl-2 promoters is incorporated in the method for PCR analysis DHX33.
Analyze the primer sequence of BAD and Bcl-2 promoter sequences：
People BAD promoters (preceding primer) -5'-CCACGCTCCTCTCTCCTAT-3'(SEQ ID NO:11)；
People BAD promoters (rear primer) -5'-GGCTATGGGCGGAAGTTT-3'(SEQ ID NO:12)；
People Bcl-2 (preceding primer) -5'-GGGAATCGATCTGGAAATCCTC-3'(SEQ ID NO:13)；
People Bcl-2 (rear primer) -5'-CCCATCAATCTTCAGCACTCT-3 ' (SEQ ID NO:14).
The results are shown in Figure 7, and DHX33 regulates and controls the transcription of the two genes directly as transcription factor.
Embodiment 3：C-Myc can be with the mRNA and protein expression of positive regulation DHX33
It using NIH3T3 cells, is handled with the slow virus of coding c-Myc, screens to obtain to stablize with puromycin and express this
The cell of one albumen.After 96 hours, RNA and total protein are extracted, DHX33 mRNA and protein content is analyzed, internal reference is done with total GAPDH
Control.As a result as shown in Figure 8 and Figure 9, Fig. 8 is DHX33mRNA amounts, and Fig. 9 is DHX33 protein contents.As a result, it has been found that c-Myc processing
Cell has the DHX33. of high-content after oncogene c-Myc is expressed in cell, and cancerous transformation has occurred in cell, in this mistake
Cheng Zhong, it can be seen that rapid the phenomenon that increasing occurs in the albumen of DHX33.
Figure 10：C-Myc oncogenes identify that specific base sequence, these specific base sequences are ordered as transcription factor
Entitled E-box. is as shown in the figure.The guarantor of each base in the conservative region E-box that c-Myc transcription factors are combined with promoter DNA
Keep type (Y- axis).
Figure 11：Find that the proximal promoter of DHX33 nearby there are multiple E-box. as shown, DHX33 genes by analysis
The sites E-Box contained in proximal promoter and sequence.These analytic explanations, which are likely to c-Myc, can be directly incorporated in DHX33
Promoter around adjust DHX33 genetic transcription.
Figure 12：Whether EMSA experimental analysis c-Myc albumen is directly incorporated in the promoter of DHX33.1) probe to be marked
Preparation
It clones on the promoter region pGL3 control plasmids (purchase gained) of the 2kb of the proximal ends DHX33, then uses vertex
3 E-box of the proximal ends DHX33 are mutated to obtain the DHX33 promoters of wild type and saltant type by mutagenesis kit (purchase gained).
Respectively using pGL3 control DHX33 wild types and pGL3 control DHX33 saltant types as template, with 5 '-
CTAGCTAGCTAGTTTGGACAGAGAAGGGGAAAAC-3’(SEQ ID NO:And 5 ' -15)
CCGCTCGAGCGGCCCTCTCAGGTGCAGACAAC-3’(SEQ ID NO:16) it is primer, PCR prepares probe to be marked, so
PCR product Purification Kit is used afterwards.
2) biotinylated probe
(1) 95 DEG C of probe to be marked heats 2 minutes, and ice bath makes into single-stranded immediately；
(2) as follows 37 DEG C reaction 30 minutes carry out probe labels
(3) 2.5 microlitres of label terminate liquids are added and terminate reaction
(4) 52.5 microlitres of chloroform-isoamyl alcohols (24 are added:1) it, is vortexed, 12000~14000g is centrifuged 2 minutes, and supernatant is
SsDNA probe
(5) annealing buffer is added, is heated to 95 DEG C, the EMSA probes of biotin labeling are made in slow cooling to room temperature
3) EMSA detections are carried out as follows
(1) 4% 10 milliliters of polyacrylamide gel is prepared
(2) following each sample is prepared.Elder generation's mixing before the probe that mark is added, is placed at room temperature for 10 minutes, and allows cold probe
Preferential reaction, is then added the probe marked, and mixing is placed at room temperature for 20 minutes.1 μ L sample-loading buffer (10X, nothing is added
Color), mixing loading immediately.Testing result is as shown in table 1 below, and following number is microlitre.
Table 1
Embodiment 4
In order to further analyze the correlation that the expression of DHX33 is expressed with cancer protein c-Myc in cancerous tissue, to show
C-Myc may be the upstream regulating genes of DHX33, contaminate c-Myc and DHX33 altogether in cancerous lung tissue, and Figure 13 is shown
The expression and the expression of c-Myc of DHX33 is positively correlated in many cancerous lung tissues.Figure 13 in the cancerous lung tissue of the c-Myc positives,
DHX33 albumen shows positive ratio about 66% (10/15) simultaneously, and the first row normal tissue are normal lung groups in figure
It knits, the second~tetra- row lung cancer are that three cancerous lung tissue examples are shown in figure.
In order to show DHX33 to the carcinogenicity of c-Myc and maintain cancerous characteristics most important, it is overexpressed in c-Myc thin
The protein content that low DHX33 is struck in cell space system makes up to basic horizontal, it is seen that c-Myc is overexpressed thin after DHX33 missings
Whether its merisis of born of the same parents can be suppressed.Specifically operating process is：In NIH3T3 cells, slow disease is overexpressed with c-Myc
Poison processing cell, then in the case where c-Myc is overexpressed respectively with coding shSCR controls (shScrambled) and shDHX33
(sh-DHX33-2) slow virus processing makes DHX33 reach close to basic horizontal.Figure 14 be each protein content analysis chart.Figure
15 be the experimental result for the mobility for analyzing transformed cells.Figure 16 is BrdU cell proliferation experiments, and Figure 17 is the soft agar of cell
Suspension independent growths are tested.In from Figure 15 to Figure 17, it can be found that after DHX33 missings, the cancerous characteristics of cell and growth increase
It grows and is suppressed.Figure 18：After DHX33 being lacked in lung adenocarcinoma cell H1299 cells, it is seen that the mobility of cell has occurred obviously
Inhibition.DAPI labels to be the mobility of cell have higher blue markings cell in shSCR figures, and in shDHX33 samples
In be hardly visible cell migration, have seldom blue markings cell.The light field figure on the right side is all analyzed cell numbers,
Control group and experimental group are about the same.
Embodiment 5：The missing of DHX33 make cell reduce converted by c-Myc after in nude mice tumor formation ability
It is for proving that DHX33 is overexpressed the importance for causing cancer to occur to c-Myc in the present embodiment.With embodiment 1
In be prepared slow virus processing cancer cell, build DHX33 gene silencings stable cell lines.Cell subcutaneous injection is entered to exempt from
In epidemic disease deficient mice body, the growing state of tumour is then monitored.Cell containing higher c-Myc can form swollen in Mice Body
Tumor, but if after silence DHX33 to basic horizontal, cell greatly reduces the ability that tumour is formed in mouse.Figure 19 is
Cell loses the ability that tumour is formed in Mice Body after striking low DHX33.Figure 20 is to be formed to swell in nude mice to tumour cell
The quantitative analysis of tumor.
Embodiment 6：Compare it is of the invention used in sh-DHX3-2 with it is a kind of it is known targeting DHX33 tiny RNA (sh-
DHX33-1 the comparison of gene silencing efficiency).It can be seen that DHX33 albumen strikes poor efficiency clearly.
In conclusion studies have shown that DHX33 regulation and control are one of the downstream pathways of oncogene c-Myc, in fraction of nonsmall cell
In lung cancer, DHX33 protein expressions are very high, and (early period, basis, schemed DHX33 and c-Myc presentations common anode in part of cancerous tissue
13---, that is, embodiment 4).Cell experiment confirms that c-Myc can be with the transcription of positive regulation DHX33, in the cell converted by c-Myc
Middle DHX33 protein contents decline the inhibition that can cause cell growth and carcinogenicity (early period is basic, Figure 14-18--- i.e. embodiment 5).
DHX33 belongs to a kind of DEAH/DEAD RNA helicase family, all includes seven in their amino acid sequence
The amino acid sequence highly conserved to eight, DEAD/DEAH peptide fragments are one of important sections.DHX33 is in
Race --- RNA helicase family may participate in adjust RNA metabolism various aspects, including RNA montages, rna editing, RNA degradation,
MRNA translations, rRNA generation and rna transcription etc..People have found that many RNA helicase are sent out in cancer successively in recent years
Play an important role in exhibition, for example, DDX5 in kinds cancer such as high expression in breast cancer, prostate cancer and T cell leukaemia and right
Generation, the development of cancer play an important role.DHX9 (RNA helicase A) is in many cancers such as neuroblastoma and lymph cancer
It participates in the growth of cancer and mediates the resistance to anticancer drug.Our early-stage study shows that DHX33 plays very cell growth
Important facilitation, it can be with the transcriptional activity of rna regulation polymerase I, to promote the generation of intracellular rRNA
(bibliography MCB, 2011).DHX33 can also promote hyperplasia (bibliography MCB by regulating and controlling the translation of mRNA
2015) and by cancer protein Ras, Akt and cancer suppressor protein ARF, NF1 regulate and control (bibliography MCB 2013)
The application attempts to regulate and control importance of the angle research DHX33 to cancer occurrence and development of DHX33 from c-Myc.
In molecular mechanism, it has been found that DHX33 unwindases promote the repertoire of cell growth to be not merely embodied in promotion ribose
In body generation and protein translation, our research further discloses DHX33 and regulates and controls many important apoptosis factors.
To sum up, clear DHX33 serves vital in the occurrence and development of cancer in the present invention, and DHX33 is c-Myc
A potential target site in the treatment of cancer of initiation.The application be capture cancer provide new access and key molecule,
A new visual angle and theory and material base are provided for experimental development.
It should be understood that the application of the present invention is not limited to the above for those of ordinary skills can
With improvement or transformation based on the above description, all these modifications and variations should all belong to the guarantor of appended claims of the present invention
Protect range.
SEQUENCE LISTING
<110>Shenzhen Kai Yue Life Sciences Co., Ltd
<120>A kind of microRNA and its application for treating cancer
<160> 17
<170> PatentIn version 3.5
<210> 1
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223>The main nucleic acid sequence of the sh-DHX33-1 of gene target DHX33
<400> 1
gctatcgcaa agtgatcatt tctcgagaaa tgatcacttt gcgatagc 48
<210> 2
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223>The main nucleic acid sequence of gene target drug sh-DHX33-2
<400> 2
ttgggaagct ggttggctat actcgagtat agccaaccag cttcccaa 48
<210> 3
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>Oligonucleotide sequence before sh-DHX33-1-
<400> 3
ccgggctatc gcaaagtgat catttctcga gaaatgatca ctttgcgata gctttttg 58
<210> 4
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>Oligonucleotide sequence after sh-DHX33-1-
<400> 4
aattcaaaaa gctatcgcaa agtgatcatt tctcgagaaa tgatcacttt gcgatagc 58
<210> 5
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>Oligonucleotide sequence before sh-DHX33-2-
<400> 5
ccggttggga agctggttgg ctatactcga gtatagccaa ccagcttccc aatttttg 58
<210> 6
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>Oligonucleotide sequence after sh-DHX33-2-
<400> 6
aattcaaaaa ttgggaagct ggttggctat actcgagtat agccaaccag cttcccaa 58
<210> 7
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<223>Primer before people Bcl-2
<400> 7
acagtcccat caaaactcct g 21
<210> 8
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<223>Primer after people Bcl-2
<400> 8
ttacaggcac agaacatcca g 21
<210> 9
<211> 18
<212> DNA
<213>Artificial sequence
<220>
<223>Primer before people BAD
<400> 9
gaccttcgct ccacatcc 18
<210> 10
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223>Primer after people BAD
<400> 10
agtacttccg cccatattca ag 22
<210> 11
<211> 19
<212> DNA
<213>Artificial sequence
<220>
<223>Primer before people's BAD promoters
<400> 11
ccacgctcct ctctcctat 19
<210> 12
<211> 18
<212> DNA
<213>Artificial sequence
<220>
<223>Primer after people's BAD promoters
<400> 12
ggctatgggc ggaagttt 18
<210> 13
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223>Primer before people's Bcl-2 promoters
<400> 13
gggaatcgat ctggaaatcc tc 22
<210> 14
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<223>Primer after people's Bcl-2 promoters
<400> 14
cccatcaatc ttcagcactc t 21
<210> 15
<211> 34
<212> DNA
<213>Artificial sequence
<220>
<223>The PCR primer of DHX33 promoters
<400> 15
ctagctagct agtttggaca gagaagggga aaac 34
<210> 16
<211> 32
<212> DNA
<213>Artificial sequence
<220>
<223>The PCR primer of DHX33 promoters
<400> 16
ccgctcgagc ggccctctca ggtgcagaca ac 32
<210> 17
<211> 21
<212> RNA
<213>Artificial sequence
<220>
<223>Small RNA molecular sequence with the protein content effect for striking low DHX33
<400> 17
ttgggaagct ggttggctat a 21
Claims (3)
1. a kind of microRNA for treating cancer, which is characterized in that the small RNA molecular has the albumen for striking low DHX33
The effect of content, sequence are：
TTGGGAAGCTGGTTGGCTATA。
2. a kind of application of the microRNA as described in claim 1 for treating cancer, which is characterized in that will be described small
Molecule RNA is used to prepare the drug for the treatment of cancer, and the cancer is cancer caused by being expanded or activated by oncogene c-Myc.
3. the application of the microRNA according to claim 2 for treating cancer, which is characterized in that the cancer is
Adenocarcinoma of lung.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710049669.3A CN108338986B (en) | 2017-01-23 | 2017-01-23 | Small-molecule RNA for treating cancer and application thereof |
| PCT/CN2018/072441 WO2018133733A1 (en) | 2017-01-23 | 2018-01-12 | Small-molecule rna of rna-targeting helicase dhx33 and applications thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710049669.3A CN108338986B (en) | 2017-01-23 | 2017-01-23 | Small-molecule RNA for treating cancer and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108338986A true CN108338986A (en) | 2018-07-31 |
| CN108338986B CN108338986B (en) | 2020-04-03 |
Family
ID=62974638
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710049669.3A Active CN108338986B (en) | 2017-01-23 | 2017-01-23 | Small-molecule RNA for treating cancer and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108338986B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116036282A (en) * | 2022-12-30 | 2023-05-02 | 深圳开悦生命科技有限公司 | Application of RNA helicase DHX33 inhibitor in preparation of medicine for treating prostate cancer |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1509292A (en) * | 2001-05-17 | 2004-06-30 | AVI������ҩ��˾ | Combination apparoach to treatment of cancer using C-MYC antisense oligomer |
| WO2008022806A2 (en) * | 2006-08-22 | 2008-02-28 | Fraunhofer Gesellschaft Für Angewandte Forschung E.V. | Methods for identifying therapeutical targets in tumors and for determining and targeting angiogenesis and hemostasis related to andenocarcinomas of the lung |
| US20110064739A1 (en) * | 2008-03-28 | 2011-03-17 | Borlak Juergen | Medicament, compositions, and substances for treating and identifying adenocarcinoma of the lung |
| US20140294979A1 (en) * | 2007-11-22 | 2014-10-02 | National Yang-Ming University | Methods and pharmaceutical compositions for regulation of g- and/or gc-rich nucleic acid expression |
| US20150071932A1 (en) * | 2013-09-09 | 2015-03-12 | Samsung Electronics Co., Ltd. | Combination therapy using c-met inhibitor and c-myc inhibitor |
-
2017
- 2017-01-23 CN CN201710049669.3A patent/CN108338986B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1509292A (en) * | 2001-05-17 | 2004-06-30 | AVI������ҩ��˾ | Combination apparoach to treatment of cancer using C-MYC antisense oligomer |
| WO2008022806A2 (en) * | 2006-08-22 | 2008-02-28 | Fraunhofer Gesellschaft Für Angewandte Forschung E.V. | Methods for identifying therapeutical targets in tumors and for determining and targeting angiogenesis and hemostasis related to andenocarcinomas of the lung |
| US20140294979A1 (en) * | 2007-11-22 | 2014-10-02 | National Yang-Ming University | Methods and pharmaceutical compositions for regulation of g- and/or gc-rich nucleic acid expression |
| EP2918272A1 (en) * | 2007-11-22 | 2015-09-16 | Sophia Shu Fen Wu | Methods and pharmaceutical compositions for regulation of G- and/or GC-rich nucleic acid expression |
| US20110064739A1 (en) * | 2008-03-28 | 2011-03-17 | Borlak Juergen | Medicament, compositions, and substances for treating and identifying adenocarcinoma of the lung |
| US20150071932A1 (en) * | 2013-09-09 | 2015-03-12 | Samsung Electronics Co., Ltd. | Combination therapy using c-met inhibitor and c-myc inhibitor |
Non-Patent Citations (2)
| Title |
|---|
| BAOLEI YUAN ET AL: "DHX33 Transcriptionally Controls Genes Involved in the Cell Cycle", 《MOLECULAR AND CELLULAR BIOLOGY》 * |
| 许晶晶: "肺腺癌中miRNA34a和c_myc的表达及意义", 《临床与实验病理学杂志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116036282A (en) * | 2022-12-30 | 2023-05-02 | 深圳开悦生命科技有限公司 | Application of RNA helicase DHX33 inhibitor in preparation of medicine for treating prostate cancer |
| CN116036282B (en) * | 2022-12-30 | 2023-12-26 | 深圳开悦生命科技有限公司 | Application of RNA helicase DHX33 inhibitor in preparation of medicine for treating prostate cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108338986B (en) | 2020-04-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bolce1 et al. | Ventral ectoderm of Xenopus forms neural tissue, including hindbrain, in response to activin | |
| CN108342365A (en) | A kind of slow virus for treating cancer and preparation method thereof is applied | |
| Moschos et al. | SAGE and antibody array analysis of melanoma-infiltrated lymph nodes: identification of Ubc9 as an important molecule in advanced-stage melanomas | |
| Yao et al. | LncRNA JPX overexpressed in oral squamous cell carcinoma drives malignancy via miR‐944/CDH2 axis | |
| van der Gun et al. | Targeted DNA methylation by a DNA methyltransferase coupled to a triple helix forming oligonucleotide to down-regulate the epithelial cell adhesion molecule | |
| CN104017868B (en) | SETD4 is the purposes in preparation treatment pancreatic cancer drug in the purposes prepared in diagnosis of pancreatic cancer and/or prognosis kit and SETD4 blocker | |
| Gurler Main et al. | Emergent role of the fractalkine axis in dissemination of peritoneal metastasis from epithelial ovarian carcinoma | |
| Yang et al. | Biological effects of decreasing RBM15 on chronic myelogenous leukemia cells | |
| Jevtic et al. | SMARCA5 interacts with NUP98-NSD1 oncofusion protein and sustains hematopoietic cells transformation | |
| Huang et al. | Thermal stress involved in TRPV2 promotes tumorigenesis through the pathways of HSP70/27 and PI3K/Akt/mTOR in esophageal squamous cell carcinoma | |
| CN108339126A (en) | It is a kind of for the gene target drug for the treatment of cancer and its application | |
| Wang et al. | Silencing of TPD52 inhibits proliferation, migration, invasion but induces apoptosis of pancreatic cancer cells by deactivating Akt pathway. | |
| Lee et al. | Regulation of cancer stem cell activity by thyroid hormone receptor β | |
| Sun et al. | Loss of the receptors ER, PR and HER2 promotes USP15-dependent stabilization of PARP1 in triple-negative breast cancer | |
| CN108338986A (en) | A kind of microRNA and its application for treating cancer | |
| CN110172462A (en) | Gene and its expression product and application of the occurrence and development of a kind of pair of tumour with facilitation | |
| CN110960677B (en) | Use of SAGE1 inhibitor in preparation of medicine or kit | |
| Li et al. | ITGB3 promotes cisplatin resistance in osteosarcoma tumors | |
| CN108342415A (en) | It is a kind of for the slow virus plasmid for the treatment of cancer and its application | |
| CN104531760B (en) | The short hairpin RNA interference plasmid and its application process of Dp71 albumen | |
| CN111254130A (en) | Method for inhibiting tumor growth by DDX24 helicase point mutation and application thereof | |
| CN109172597A (en) | Adjust substance and its application of the histone methylated level of rDNA gene chromatin | |
| CN110302197A (en) | A kind of lncRNA relevant to the miscellaneous Shandong amine therapeutic sensitivity of grace and its application in the miscellaneous Shandong amine treatment prostate cancer of grace | |
| Hu et al. | Expression and functional implications of USP17 in glioma | |
| Xiaojiang et al. | Adeno-associated virus harboring fusion gene NT4-ant-shepherdin induce cell death in human lung cancer cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |