CN109172597B - Substance for regulating methylation level of rDNA gene chromatin histone and application thereof - Google Patents

Abstract

The invention relates to and discloses application of a substance for regulating and controlling PHF6 expression. The invention provides an application of a substance for regulating the expression level of PHF6 in preparing a substance for regulating the level of an rDNA transcription initiation region H3K9me3 in animal cells. Experiments in the application prove that the level of an rDNA transcription initiation region H3K9me3 can be influenced by regulating the expression quantity of PHF6, the level of H3K9me3 can be obviously improved by over-expressing PHF6, and the level of H3K9me3 can be obviously reduced by reducing PHF6, so that the apparent modification effect on rDNA histone is realized.

Description

Substance for regulating methylation level of rDNA gene chromatin histone and application thereof

Technical Field

The invention relates to the field of molecular biology, in particular to a novel application of a substance for regulating the methylation level of rDNA chromatin histone by regulating PHF 6.

Background

The Plant Homeodomain zinc Finger Protein 6(Plant Homeodomain Finger Protein 6, PHF6) gene is located on the X chromosome and consists of 11 exons. Wherein exons 2-10 are encoded to contain 365 amino acids and have a molecular weight of 41 kDa. The PHF6 protein is widely present in human tissues, with the highest expression levels in thymus, ovary and thyroid, and was originally identified as closely related to the X-linked familial hereditary disease "bur-foley" trisomy (BFLS). With intensive studies on PHF6, some BFLS patients were found to have T cell leukemia at the same time, and the mutation of PHF6 gene was also found in non-BFLS leukemia patients, and these studies indicate that the mutation of PHF6 gene may be related to the development of leukemia. Yet another study has indicated that many genes encoding ribosomal proteins are mutated in T cell leukemia, revealing a close link between abnormalities in ribosome production and the development and progression of leukemia. In ribosome production, RNA polymerase I is first required to bind to rDNA to transcribe pre-rRNA, which is often significantly elevated in cancer. Related studies have demonstrated that PHF6 has significant nucleolar localisation and is capable of negatively regulating rDNA transcription. The above results suggest that PHF6 regulates rDNA transcription and is likely involved in the development and progression of leukemia.

Based on the characteristic that the PHF6 comprises two ZaP sequences, the PHF6 protein is also considered to have the functions of transcriptional control and chromatin structure change, and the change of the chromatin structure relates to the modification of histone in chromatin. Histones are important protein components of chromatin and are capable of undergoing a variety of apparent modifications, including methylation, acetylation, phosphorylation, and ubiquitination. These apparent modifications often occur at the histone tails which extend out of the nucleosome, and these modifications alter the interaction of the histone tails with DNA and can affect the structure of chromatin. In addition, these apparent modifications can be recognized and bound by specific factors as histone codes. In most cases, specific apparent modifications are closely related to some biological functions such as chromatin condensation, transcriptional regulation and DNA replication, and abnormal apparent modification of histones is a common feature of tumor cells. Methylation of lysine 27 and 9 of H3 and ubiquitination of histone H2A at 119 are both markers of suppressed gene transcription, and are often found in silent gene regions. H3K27me3 and H2AK119ul are involved in the formation of any heterochromatin, while H3K9me2/3 can also regulate the expression of genes during development, in addition to playing a role in the formation of constitutive heterochromatin. Therefore, the research on the modification of PHF6 and chromatin histone is of great significance for the deep understanding of the treatment of PHF6 related leukemia.

Disclosure of Invention

The invention aims at providing a substance for regulating and controlling PHF6 to influence the trimethylation level of rDNA chromatin and an application thereof, and the specific contents are as follows:

one aspect of the invention provides an application of a substance for regulating and controlling the expression level of a plant homologous domain zinc finger protein 6 in preparing a product for regulating and controlling the trimethylation level of rDNA chromatin.

In the technical scheme of the invention, the application is the application of a substance for improving the expression level of PHF6 in preparing a product for up-regulating the trimethylation level of rDNA chromatin, preferably, the substance for improving the expression level of PHF6 is a DNA molecule for coding and regulating a plant homeodomain zinc finger protein 6, or a recombinant vector, a recombinant microorganism, a recombinant plant cell or a recombinant animal cell containing the DNA molecule for coding and regulating the plant homeodomain zinc finger protein 6.

In the technical scheme of the invention, the application is an application of a substance for reducing the expression level of PHF6 in preparing a product for reducing the trimethylation level of rDNA chromatin, preferably, the substance for reducing the expression level of PHF6 is shRNA, an expression vector for expressing the shRNA, a recombinant microorganism cell, a recombinant animal cell, a recombinant plant cell, or siRNA generated by shRNA for reducing the expression level of PHF6, an expression vector for expressing the siRNA, a recombinant microorganism cell, a recombinant animal cell, a recombinant plant cell.

In the technical scheme of the invention, the shRNA is short hairpin RNA forming a stem-loop structure, one sequence of a stem in the stem-loop structure is 772-795 bits of SEQ ID No.3, and the other strand sequence of the stem in the stem-loop structure is reversely complementary with 772-795 bits of SEQ ID No. 3; preferably, it is

shPHF6:

GATCCGCAGAATTTGGAGACTTTGATATTCAAGAGATATCAAAGTCTCCAAATTCTGTTTTTTGGAAA SEQ ID No.1

Or

shNC:

TTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATT SEQ ID No.2。

In the technical scheme of the invention, the sequence of the zinc finger protein 6 of the regulatory plant homeodomain is shown in SEQ ID No. 3.

ATGTCAAGCTCAGTTGAACAGAAAAAAGGGCCTACAAGACAGCGCAAATGTGGCTTTTGTAAGTCAAATAGAGACAAGGAATGTGGACAGTTACTAATATCTGAAAACCAGAAGGTGGCAGCGCACCATAAGTGCATGCTCTTTTCATCTGCTTTGGTATCATCACACTCTGATAATGAAAGTCTTGGTGGATTTTCTATTGAAGATGTCCAAAAGGAAATTAAAAGAGGCACGAAGCTGATGTGTTCTTTGTGCCATTGTCCTGGAGCAACAATTGGTTGTGATGTGAAAACATGTCACAGGACATACCACTACCACTGTGCATTGCATGATAAAGCTCAAATACGAGAGAAACCTTCACAAGGAATTTACATGGTCTATTGCCGAAAACACAAGAAAACTGCACATAACTCCGAAGCTGATTTAGAAGAAAGTTTTAATGAACATGAACTGGAGCCCTCATCACCTAAAAGTAAAAAGAAAAGTCGCAAAGGAAGGCCAAGAAAAACTAATTTTAAAGGGCTGTCAGAAGATACCAGGTCCACATCCTCCCATGGAACAGATGAAATGGAAAGTAGTTCCTATAGAGATAGGTCTCCACACAGAAGCAGCCCTAGTGACACCAGGCCTAAATGTGGATTTTGCCATGTAGGGGAGGAAGAAAATGAAGCACGAGGAAAACTGCATATATTTAATGCCAAGAAGGCAGCTGCCCATTATAAGTGCATGTTGTTTTCTTCTGGCACAGTCCAGCTCACAACAACATCAAGAGCAGAATTTGGAGACTTTGATATTAAAACTGTACTTCAGGAGATTAAACGAGGAAAAAGAATGAAATGTACACTTTGCAGTCAGCCTGGTGCTACTATTGGATGTGAAATAAAAGCCTGTGTTAAGACTTACCATTACCACTGTGGAGTACAAGACAAAGCTAAATACATTGAAAATATGTCACGAGGAATTTACAAACTATACTGTAAAAATCATAGTGGAAATGATGAGAGAGATGAAGAAGATGAGGAACGAGAGAGTAAAAGCCGAGGAAAAGTAGAAATTGATCAGCAACAACTAACTCAGCAGCAACTTAATGGAAACTAG SEQ ID No.3

In the technical scheme of the invention, the rDNA chromatin is trimethylated into rDNA chromatin histones H3K9me1, H3K9me2, H3K9me3, H3K27, H3K27me1, H3K27me2 and H3K27me3, preferably H3K9me 3.

The substance for regulating the expression level of PHF6 can be specifically a substance for reducing the expression level of PHF6 or a substance for increasing the expression level of PHF 6. The substance for reducing the expression level of PHF6 can be any substance capable of reducing the expression level of PHF6 in cells, such as siRNA for reducing the expression level of PHF6, DNA molecules encoding the siRNA for reducing the expression level of PHF6, expression vectors for expressing the siRNA for reducing the expression level of PHF6, recombinant microorganisms for expressing the siRNA for reducing the expression level of PHF6, recombinant plant cells for expressing the siRNA for reducing the expression level of PH, and recombinant animal cells for expressing the siRNA for reducing the expression level of PHF 6; the substance for reducing the expression level of PHF6 can also be any shRNA for reducing the expression level of PHF6, a DNA molecule for coding the shRNA for reducing the expression level of PHF6, an expression vector for expressing the shRNA for reducing the expression level of PHF6, a recombinant microorganism for expressing the shRNA for reducing the expression level of PHF6, a recombinant plant cell for expressing the shRNA for reducing the expression level of PHF6 and a recombinant animal cell for expressing the shRNA for reducing the expression level of PHF 6.

The substance for improving the expression level of the PHF6 can be a DNA molecule encoding PHF6, or a recombinant vector, a recombinant microorganism, a recombinant plant cell or a recombinant animal cell containing the DNA molecule encoding PHF 6.

The recombinant microorganism may be bacteria, yeast, algae, fungi or virus, the recombinant plant cell does not include propagation material of plant, and the recombinant animal cell does not include propagation material of animal.

The modulating PHF6 expression level may be modulating the transcription level of PHF6 and/or modulating the protein translation level of PHF 6.

In the application, the PHF6 is a protein with an amino acid sequence shown as SEQ ID No. 3.

Experiments prove that PHF6 is a new target for regulating the trimethylation level of rDNA chromatin histone, the trimethylation level of rDNA chromatin histone can be reduced by reducing the expression of PHF6, and the trimethylation level of rDNA chromatin histone can be increased by over-expressing PHF 6.

Drawings

FIG. 1 shows the chromatin co-immunoprecipitation method detecting the binding of wild-type PHF6 to the pre-rRNA transcribed region of rDNA, wherein FIG. 1A shows the position of the primer sequence in the pre-rRNA transcribed region of rDNA, indicating that both the position of the detection primer used in HeLa cells (FIG. 1B) and Jurkat cells (FIG. 1C) can detect the DNA fragment bound by PHF6 antibody, indicating that PHF6 binds to the pre-rRNA transcribed region of rDNA.

FIG. 2 shows that the co-immunoprecipitation method detects that wild-type PHF6 can bind to histone H3 methylated mimic peptide, and the results indicate that PHF6 binds to H3K9me1/H3K9me2/H3K9me3, wherein the binding to H3K9me1 and H3K9me2 is weaker, and the binding to H3K9me3 is more for PHF6 (FIG. 2A); PHF6 bound to both H3K27/H3K27me1/H3K27me2/H3K27me3 (FIG. 2B).

FIG. 3 shows that the combination of PHF6 and H3K9me1/H3K9me2/H3K9me3 of the rDNA transcription initiation region (FIG. 3A) and the combination of PHF6 and H3K27me1/H3K27me2/H3K27me3 of the rDNA transcription initiation region (FIG. 3B) are detected by chromatin co-immunoprecipitation method when wild-type PHF6 binds to the sites of H3K9(me1/2/3)/H3K27(me 1/2/3).

FIG. 4 shows that the chromatin co-immunoprecipitation method detects the level of wild-type PHF6 regulating rDNA transcription initiation region H3K9me3, and the results show that in HeLa cells, the expression of PHF6 can be detected after the plasmid expressing PHF6 is transfected (FIG. 4A), and the level of H3K9me3 is significantly increased (FIG. 4B); while knock-down PHF6 (fig. 4E) significantly reduced the level of H3K9me3 (fig. 4F); also overexpression of PHF6 in Jurkat cells (fig. 4C) was able to significantly increase the level of H3K9me3 (fig. 4D); while knock-down PHF6 (fig. 4G) significantly reduced the level of H3K9me3 (fig. 4H).

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The quantitative tests in the following examples, unless otherwise specified, were set up in triplicate. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The human cervical cancer cell line HeLa cells, the human embryonic kidney cell line HEK 293 and the human embryonic kidney cell line HEK 293T in the following examples are cells stored in this laboratory. Human peripheral blood leukemia cell line Jurkat cells were purchased from the shanghai cell bank.

The DMEM medium containing 10% fetal bovine serum in the following examples is a culture medium obtained by adding fetal bovine serum (Hyclone) to a DMEM medium (Gibco) to a volume concentration of 10% fetal bovine serum.

The 1640 medium containing 10% fetal bovine serum in the following examples is a medium obtained by adding fetal bovine serum (Hyclone) to 1640 medium (Gibco) to a volume concentration of 10% fetal bovine serum.

In the present application, PHF6 is a protein having an amino acid sequence shown in SEQ ID No. 3.

Example 1 binding of PHF6 to the rDNA pre-rRNA transcribed region

1. The detection primers were designed based on the sequence of the pre-rRNA transcribed region on rDNA, and a total of 8 pairs of primers, H0, H1, H4, H8, H13, H18, H23, and H42.9, were distributed over the entire pre-rRNA transcribed region (FIG. 1A).

The sequences of the H0 primers are SEQ ID No.4 and SEQ ID No.5 respectively

F:GGTATATCTTTCGCTCCGAG SEQ ID No.4

R:GACGACAGGTCGCCAGAGGA SEQ ID No.5

The sequences of the H1 primers are SEQ ID No.6 and SEQ ID No7 respectively

F:GGCGGTTTGAGTGAGACGAGA SEQ ID No.6

R:ACGTGCGCTCACCGAGAGCAG SEQ ID No7

The sequences of the H4 primers are SEQ ID No.8 and SEQ ID No.9 respectively

F:CGACGACCCATTCGAACGTCT SEQ ID No.8

R:CTCTCCGGAATCGAACCCTGA SEQ ID No.9

The sequences of the H8 primers are SEQ ID No.10 and SEQ ID No.11 respectively

F:AGTCGGGTTGCTTGGGAATGC SEQ ID No.10

R:CCCTTACGGTACTTGTTGACT SEQ ID No.11

The sequences of the H13 primers are SEQ ID No.12 and SEQ ID No.13 respectively

F:ACCTGGCGCTAAACCATTCGT SEQ ID No.12

R:GGACAAACCCTTGTGTCGAGG SEQ ID No.13

The sequences of the H18 primers are SEQ ID No.14 and SEQ ID No.15 respectively

F:GTTGACGTACAGGGTGGACTG SEQ ID No.14

R:GGAAGTTGTCTTCACGCCTGA SEQ ID No.15

The sequences of the H23 primers are SEQ ID No.16 and SEQ ID No.17 respectively

F:CCTTCCACGAGAGTGAGAAGC SEQ ID No.16

R:TCGACCTCCCGAAATCGTACA SEQ ID No.17

The primer sequences of H42.9 are SEQ ID No.18 and SEQ ID No.19 respectively

F:CCCGGGGGAGGTATATCTTT SEQ ID No.18

R:CCAACCTCTCCGACGACA SEQ ID No.19

2. PHF6 can bind to the pre-rRNA transcribed region of rDNA

The detection is carried out by utilizing a chromatin co-immunoprecipitation method and a real-time quantitative reverse transcription PCR method. To HeLa cells, formaldehyde (final concentration of 1%) was added and crosslinked at room temperature for 10min, and after terminating the crosslinking, the cells were washed three times with cold PBS solution. Mu.l of a lysate (150mM NaCl, 20mM Tris (pH 7.4), 1mM EGTA, 1% NP-40, 1mM EDTA, and Roche cocktail) was added thereto, and the lysate was collected and placed in a 1.5ml EP tube and then subjected to ultrasonication (ultrasonic power: 20%, ultrasonic working time: 10s, ultrasonic interval: 50s, and repetition five times). The sonicated sample was cryocentrifuged at 12,000rpm for 15min and the supernatant collected for use. The remaining supernatant was stored at-80 ℃ for analysis in the Input group, and the remaining equal amount of the supernatant of the experimental group was incubated overnight at 4 ℃ with the primary antibody against PHF6, followed by incubation for 2h at 4 ℃ with 15. mu.l of Dynabeads protein G. And (3) absorbing the magnetic beads in the sample to the bottom of the EP tube by using a magnetic frame, absorbing the supernatant, adding cell lysis solution to wash for three times, wherein each time is 10min, and absorbing the magnetic beads to the bottom of the EP tube after washing to remove the washing solution. The Input group was placed at-80 ℃ for 30min, then centrifuged at 12,000rpm for 15min and the supernatant removed. Adding 40 mul of 10% Chelex into the Input group and the experimental group, tapping the tube wall to mix uniformly, then placing the mixture in 100 ℃ to heat for 10min, taking out the mixture to cool, adding 1 mul of proteinase K, tapping the tube wall to mix uniformly, then placing the mixture in 100 ℃ to heat for 10min, centrifuging the mixture, taking the supernatant to perform real-time quantitative reverse transcription PCR operation, wherein the primer is the primer in the figure 1A. The results of the experiments showed that the position of the detection primers used was able to detect the DNA fragment bound by the PHF6 antibody, indicating that in HeLa cells, PHF6 binds to both the pre-rRNA transcribed region of rDNA (FIG. 1B).

The experiment results that formaldehyde (1% final concentration) was added to Jurkat cells, room temperature crosslinking was carried out for 10min, cells were collected by centrifugation at 1200rpm after termination of crosslinking, and then the chromatin co-immunoprecipitation procedure of HeLa cells was carried out using the primers shown in FIG. 1A as a partial primer, showed that the position of the detection primer used was capable of detecting a DNA fragment to which PHF6 antibody binds, indicating that PHF6 binds to the pre-rRNA transcription region of rDNA in Jurkat cells (FIG. 1C).

In summary, experiments have shown that PHF6 can bind to the pre-rRNA transcribed region of rDNA.

Example 2 PHF6 was able to bind to histone H3 methylated mimetics

The detection is carried out by using a co-immunoprecipitation method and an immunoblotting method. Some methylation modification site simulation peptides of histone H3 are artificially synthesized, including H3K9, H3K9me1, H3K9me2, H3K9me3, H3K27, H3K27me1, H3K27me2 and H3K27me3, and the simulation peptides carry Biotin (Biotin) labels and can be detected by using a primary antibody of avidin. Transferring the plasmid Flag-PHF6 into HEK 293 cells to express Flag-PHF6 protein, extracting cell lysate after 48 hours, adding a primary anti-Flag antibody and synthesized H3K9, H3K9me1, H3K9me2, H3K9me3, H3K27, H3K27me1, H3K27me2 and H3K27me3 mimic peptides to respectively incubate overnight, precipitating a Flag antibody conjugate by using protein A/G beads, and analyzing by using an immunoblotting method. The experimental results show that Flag-PHF6 has binding to H3K9me1/H3K9me2/H3K9me3, wherein the binding to H3K9me1 and H3K9me2 is weaker, and the binding to H3K9me3 is more for PHF6 (FIG. 2A); Flag-PHF6 bound to both H3K27/H3K27me1/H3K27me2/H3K27me3 (FIG. 2B).

Example 3 PHF6 was able to bind to the H3K9(me1/2/3) and H3K27(me1/2/3) sites of the rDNA transcription initiation region

HeLa cells are selected and an experiment is carried out by utilizing a Re-ChIP method, namely, two chromatin co-immunoprecipitation steps are required. Firstly, fixing by using formaldehyde, collecting cell lysate, carrying out ultrasonic disruption and centrifugation, collecting supernatant, incubating the supernatant by using primary antibody of anti-PHF 6, and adding magnetic beads to obtain a DNA small fragment combined with the primary antibody of anti-PHF 6; adding 10mM Dithiothreitol (DL-Dithiothreitol, DTT) into the magnetic beads combined with the anti-PHF 6 primary anti-binding DNA small fragments obtained in the previous step for elution operation, dividing the eluent into required equal parts, adding cell lysate for dilution to a proper volume, and then respectively adding corresponding primary antibodies of negative control IgG, anti-PHF 6/H3K9me1/H3K9me2/H3K9me3/H3K27me1/H3K27me2/H3K27me3 for immune co-precipitation experiments, and finally obtaining the corresponding primary anti-binding DNA small fragments. For the convenience of research, we selected H0 primer as representative, and detected the obtained small DNA fragment by real-time quantitative reverse transcription PCR method. The results of the chromatin co-immunoprecipitation experiments showed that PHF6 bound to H3K9me1/H3K9me2/H3K9me3 in the rDNA transcription initiation region (FIG. 3A), and PHF6 bound to H3K27me1/H3K27me2/H3K27me3 in the rDNA transcription initiation region (FIG. 3B).

Example 4 PHF6 was able to regulate the level of rDNA transcription initiation region H3K9me3

1. The over-expression of PHF6 can obviously improve the level of rDNA transcription initiation region H3K9me3

1.1 overexpression of PHF6 can obviously improve the level of rDNA transcription initiation region H3K9me3 in HeLa cells

Overexpression after introducing a PHF6 expression plasmid Flag-PHF6 (a Flag-PHF expression plasmid obtained by inserting a gene encoding PHF6 between BamHI and EcoRI sites of pFLAg-CMV 2) into HeLa cells using a Lipofectamine 2000transfection reagent (Invitrogen), expression of Flag-PHF6 was detected by immunoblotting (FIG. 4A); the expression of Flag-PHF6 was detected to significantly increase rDNA transcription initiation region H3K9me3 levels by chromatin co-immunoprecipitation and real-time quantitative reverse transcription PCR (FIG. 4B).

1.2 overexpression of PHF6 significantly increased the level of rDNA transcription initiation region H3K9me3 in Jurkat cells

Packaging experiments of lentiviruses were performed using the human embryonic kidney cell line HEK 293T cells. The specific experimental method is as follows: the experiment of transfecting virus packaging plasmid can be carried out when 293T cells are cultured in a 10cm cell culture dish and the growth density of the 293T cells is observed to reach 80%. It should be noted that changing fresh DMEM medium containing 10% fetal bovine serum 1h before transfection requires gentle changes in medium because 293T cells do not adhere well. Transfection experiments of lentiviral plasmids were performed using calcium phosphate. The ratio of lentiviral packaging plasmids added to each dish was as follows: the two packaged viruses were 5. mu.g each, and the target/negative control plasmid was 10. mu.g. After 12h of transfection, cell supernatant needs to be collected and stored at 4 ℃, a DMEM medium containing 30% fetal bovine serum is added into the cells for continuous culture for 24h, then the cell supernatant is collected again and mixed with the supernatant collected for the first time, and the cell supernatant is subpackaged into a cell freezing tube and placed at-80 ℃ for later use, so as to obtain the slow virus with over-expression PHF6 and the slow virus with negative control.

Cells were infected with the two lentiviruses described above, as follows: culturing the cells in a six-well plate, replacing with fresh culture medium, adding a proper amount of lentivirus resuspension (20-100 μ l) according to the packaging condition of the virus, simultaneously adding Polybrene with the concentration of 5 μ g/ml, mixing uniformly, and placing in a cell culture box for culturing. After 12h, the culture medium was replaced with fresh medium, after 24h puromycin (final concentration of 1ug/ml) was added, the drug was screened for three days, and the survival of the cells was observed. The cell without virus infection is dead, in our experiment, the infection rate of lentivirus to HeLa cell can reach more than 90%, and Jurkat cell line over expressing PHF6 and negative control Jurkat cell line are obtained.

These two cell lines were inoculated into six-well plates containing 1640 medium containing 10% fetal bovine serum, and cultured at 37 ℃ for 24 hours, and the proteins were extracted from the respective cell-lysed cells, which were then subjected to Western blot analysis using an antibody against PHF6 (purchased from Santa Cruz Co.) to detect changes in the protein level of PHF6 (FIG. 4C). In the Western blot immunoblotting experiment, GAPDH (glyceraldehyde-3-phosphate dehydrogenase) is used as an internal reference.

The two cell lines are respectively inoculated into a six-well plate filled with 1640 culture medium containing 10% fetal calf serum and cultured for 24 hours at 37 ℃, the six-well plate is treated by a chromatin co-immunoprecipitation method, and the detection of a real-time quantitative reverse transcription PCR method shows that the level of rDNA transcription initiation region H3K9me3 in Jurkat cells is obviously improved after the PHF6 is over-expressed (FIG. 4D).

2. The knock-down of PHF6 can reduce the level of rDNA transcription initiation region H3K9me3

2.1 knockdown of PHF6 significantly reduced the level of the rDNA transcription initiation region H3K9me3 in HeLa cells

(1) The shRNA targeting PHF6 can significantly reduce the expression of PHF6 protein of HeLa cells. First, a lentivirus (named shPHF6 lentivirus) expressing an shRNA (named shPHF6) targeting PHF6, and another lentivirus (named shNC lentivirus) expressing an shRNA (named shNC) of random sequence were packaged as negative controls. Then HeLa cells were infected with the shPHF6 lentivirus and the shNC lentivirus respectively, and the results show that the interference sequence shPHF6 of the PHF6 can significantly reduce the expression of the PHF6 protein of the HeLa cells (FIG. 4).

The experimental method comprises the following steps:

2.1.1 packaging of protein expression knockdown lentiviruses

The sequences of these two shrnas for shPHF6 and shNC are as follows:

shPHF6:

GATCCGCAGAATTTGGAGACTTTGATATTCAAGAGATATCAAAGTCTCCAAATTCTGTTTTTTGGAAA(SEQ ID No.1)

shNC:

TTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATT(SEQ ID No.2)

inserting the shPHF 6-encoded DNA into pGPH1/GFP/Neo to obtain an shPHF6 expression vector, and inserting the shNC-encoded DNA into pGPH1/GFP/Neo to obtain an shNC expression vector. The expression vector of shPHF6 was packaged as a lentivirus expressing shPHF6 (named shPHF6 lentivirus), and the expression vector of shNC was packaged as a lentivirus expressing shNC (named shNC lentivirus). shPHF6 lentivirus and shNC lentivirus were prepared by Shanghai Jima pharmaceutical technology, Inc. using a lentivirus packaging system having catalog number D01001. shPHF6 lentivirus and shNC lentivirus share the same shRNA sequence except that the shRNA sequence is expressed.

2.1.2 HeLa cells were infected with two lentiviruses of 2.1.2, respectively. The infection method is as follows: HeLa cells were seeded on a six-well plate, cultured in DMEM medium containing 10% fetal bovine serum at 37 ℃ for 24 hours, and then 5. mu.g/ml Polybrene (Sigma) was added, followed by 1X 10 cells⁸TU/ml shPHF6 lentivirus venom and shNC lentivirus venom. After 12 hours, removing the virus-containing culture solution, replacing a fresh DMEM culture medium containing 10% fetal calf serum to continuously culture virus-infected HeLa cells at 37 ℃, and after culturing for 36 hours, respectively obtaining two cell lines which are successfully infected by the lentivirus, namely a HeLa cell line infected by the shPHF6 lentivirus and a HeLa cell line infected by the shNC lentivirus. These two cell lines were inoculated into six-well plates containing DMEM medium containing 10% fetal bovine serum and cultured at 37 ℃ for 24 hours, and the proteins were extracted from the lysed cells, respectively, and then the change in protein level of PHF6 was examined by Western blot immunoblotting using an antibody against PHF6 (purchased from Santa Cruz Co., Ltd.) (FIG. 4E). In the Western blot immunoblotting experiment, GAPDH (glyceraldehyde-3-phosphate dehydrogenase) is used as an internal reference.

(2) rDNA transcription initiation region H3K9me3 level in HeLa cells significantly decreased after knock-down of PHF6

The shPHF6 lentivirus-infected HeLa cell line and the shNC lentivirus-infected HeLa cell line are respectively inoculated into a six-well plate filled with a DMEM medium containing 10% fetal calf serum and cultured for 24 hours at 37 ℃, the six-well plate is treated by a chromatin co-immunoprecipitation method, and the detection of a real-time quantitative reverse transcription PCR method shows that the level of a rDNA transcription initiation region H3K9me3 in the HeLa cell is obviously reduced after PHF6 is knocked down (FIG. 4F).

2.2 knockdown of PHF6 significantly reduced the level of rDNA transcription initiation region H3K9me3 in Jurkat cells

(1) shRNA targeting PHF6 was able to significantly reduce PHF6 protein expression in Jurkat cells. Jurkat cells were infected with shPHF6 lentivirus, shNC lentivirus, and both lentivirus, and a Jurkat cell line infected with shPHF6 lentivirus and a Jurkat cell line infected with shNC lentivirus were prepared. These two cell lines were inoculated into six-well plates containing 1640 medium containing 10% fetal bovine serum, and cultured at 37 ℃ for 24 hours, and the proteins were extracted from the respective cell-lysed cells, which were then subjected to Western blot immunoblotting using an antibody against PHF6 (purchased from Santa Cruz Co., Ltd.) to detect the change in protein level of PHF6 (FIG. 4G). In the Western blot immunoblotting experiment, GAPDH (glyceraldehyde-3-phosphate dehydrogenase) is used as an internal reference.

(2) Significant reduction in rDNA transcription initiation region H3K9me3 levels in Jurkat cells following knockdown of PHF6

The shPHF6 lentivirus-infected Jurkat cell line and the shNC lentivirus-infected Jurkat cell line are respectively inoculated in a six-well plate filled with 1640 culture medium containing 10% fetal bovine serum and cultured for 24 hours at 37 ℃, the treatment is carried out by a chromatin co-immunoprecipitation method, and the detection of a real-time quantitative reverse transcription PCR method shows that the level of rDNA transcription initiation region H3K9me3 in the Jurkat cell is obviously reduced after the PHF6 is knocked down (FIG. 4H).

SEQUENCE LISTING

<110> Shenzhen institute of Qinghua university college of graduates

<120> substance for regulating methylation level of chromatin histone of rDNA gene and application thereof

<130> CP11801314C

<160> 19

<170> PatentIn version 3.3

<210> 1

<211> 68

<212> DNA

<213> Artificial sequence

<400> 1

gatccgcaga atttggagac tttgatattc aagagatatc aaagtctcca aattctgttt 60

tttggaaa 68

<210> 2

<211> 49

<212> DNA

<213> Artificial sequence

<400> 2

ttctccgaac gtgtcacgtt tcaagagaac gtgacacgtt cggagaatt 49

<210> 3

<211> 1098

<212> DNA

<213> Artificial sequence

<400> 3

atgtcaagct cagttgaaca gaaaaaaggg cctacaagac agcgcaaatg tggcttttgt 60

aagtcaaata gagacaagga atgtggacag ttactaatat ctgaaaacca gaaggtggca 120

gcgcaccata agtgcatgct cttttcatct gctttggtat catcacactc tgataatgaa 180

agtcttggtg gattttctat tgaagatgtc caaaaggaaa ttaaaagagg cacgaagctg 240

atgtgttctt tgtgccattg tcctggagca acaattggtt gtgatgtgaa aacatgtcac 300

aggacatacc actaccactg tgcattgcat gataaagctc aaatacgaga gaaaccttca 360

caaggaattt acatggtcta ttgccgaaaa cacaagaaaa ctgcacataa ctccgaagct 420

gatttagaag aaagttttaa tgaacatgaa ctggagccct catcacctaa aagtaaaaag 480

aaaagtcgca aaggaaggcc aagaaaaact aattttaaag ggctgtcaga agataccagg 540

tccacatcct cccatggaac agatgaaatg gaaagtagtt cctatagaga taggtctcca 600

cacagaagca gccctagtga caccaggcct aaatgtggat tttgccatgt aggggaggaa 660

gaaaatgaag cacgaggaaa actgcatata tttaatgcca agaaggcagc tgcccattat 720

aagtgcatgt tgttttcttc tggcacagtc cagctcacaa caacatcaag agcagaattt 780

ggagactttg atattaaaac tgtacttcag gagattaaac gaggaaaaag aatgaaatgt 840

acactttgca gtcagcctgg tgctactatt ggatgtgaaa taaaagcctg tgttaagact 900

taccattacc actgtggagt acaagacaaa gctaaataca ttgaaaatat gtcacgagga 960

atttacaaac tatactgtaa aaatcatagt ggaaatgatg agagagatga agaagatgag 1020

gaacgagaga gtaaaagccg aggaaaagta gaaattgatc agcaacaact aactcagcag 1080

caacttaatg gaaactag 1098

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence

<400> 4

ggtatatctt tcgctccgag 20

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence

<400> 5

gacgacaggt cgccagagga 20

<210> 6

<211> 21

<212> DNA

<213> Artificial sequence

<400> 6

ggcggtttga gtgagacgag a 21

<210> 7

<211> 21

<212> DNA

<213> Artificial sequence

<400> 7

acgtgcgctc accgagagca g 21

<210> 8

<211> 21

<212> DNA

<213> Artificial sequence

<400> 8

cgacgaccca ttcgaacgtc t 21

<210> 9

<211> 21

<212> DNA

<213> Artificial sequence

<400> 9

ctctccggaa tcgaaccctg a 21

<210> 10

<211> 21

<212> DNA

<213> Artificial sequence

<400> 10

agtcgggttg cttgggaatg c 21

<210> 11

<211> 21

<212> DNA

<213> Artificial sequence

<400> 11

cccttacggt acttgttgac t 21

<210> 12

<211> 21

<212> DNA

<213> Artificial sequence

<400> 12

acctggcgct aaaccattcg t 21

<210> 13

<211> 21

<212> DNA

<213> Artificial sequence

<400> 13

ggacaaaccc ttgtgtcgag g 21

<210> 14

<211> 21

<212> DNA

<213> Artificial sequence

<400> 14

gttgacgtac agggtggact g 21

<210> 15

<211> 21

<212> DNA

<213> Artificial sequence

<400> 15

ggaagttgtc ttcacgcctg a 21

<210> 16

<211> 21

<212> DNA

<213> Artificial sequence

<400> 16

ccttccacga gagtgagaag c 21

<210> 17

<211> 21

<212> DNA

<213> Artificial sequence

<400> 17

tcgacctccc gaaatcgtac a 21

<210> 18

<211> 20

<212> DNA

<213> Artificial sequence

<400> 18

cccgggggag gtatatcttt 20

<210> 19

<211> 18

<212> DNA

<213> Artificial sequence

<400> 19

ccaacctctc cgacgaca 18

Claims (5)

1. The application of the substance for regulating the expression level of the plant homologous structure domain zinc finger protein 6 in preparing a product for positively regulating the trimethylation level of rDNA chromatin histone H3K9 in human cells;

the plant homologous structure domain zinc finger protein 6 is shown in SEQ ID No. 3.

2. The use according to claim 1, wherein the use is the use of a substance for increasing the expression level of a plant homeodomain zinc finger protein 6 in the preparation of a product for up-regulating the trimethylation level of rDNA chromatin histone H3K9, and the substance for increasing the expression level of a plant homeodomain zinc finger protein 6 is a DNA molecule encoding a regulatory plant homeodomain zinc finger protein 6, or a recombinant vector, recombinant animal cell containing a DNA molecule encoding a regulatory plant homeodomain zinc finger protein 6.

3. The use according to claim 1, wherein the use is the use of a substance for reducing the expression level of a plant homeodomain zinc finger protein 6 in the preparation of a product for down-regulating the trimethylation level of rDNA chromatin histone H3K9, the substance for reducing the expression level of a plant homeodomain zinc finger protein 6 is an shRNA, an expression vector for expressing the shRNA, a recombinant animal cell, or an siRNA generated by an shRNA for reducing the expression level of PHF6, an expression vector for expressing the siRNA, a recombinant animal cell.

4. The use according to claim 3, wherein the shRNA is a short hairpin RNA forming a stem-loop structure, one sequence of the stem in the stem-loop structure is 772-795 of SEQ ID No.3, and the other sequence of the stem in the stem-loop structure is reverse complementary to the 772-795 of SEQ ID No. 3.

5. The use of claim 4, wherein the shRNA is shPHF6, and the sequence of shRNA is shown in SEQ ID No: 1, and the following components: GATCCGCAGAATTTGGAGACTTTGATATTCAAGAGATATCAAAGTCTCCAAATTCTGTTTTTTGGAAA are provided.

Images