CN110974963B

CN110974963B - Use of a substance for modulating SAGE1-INTS3 complex expression and/or function

Info

Publication number: CN110974963B
Application number: CN201911282487.6A
Authority: CN
Inventors: 雷鸣; 邓玮; 张燕捷; 郑超
Original assignee: Ninth Peoples Hospital Shanghai Jiaotong University School of Medicine
Current assignee: Ninth Peoples Hospital Shanghai Jiaotong University School of Medicine; Shanghai Jiaotong University School of Medicine
Priority date: 2019-12-13
Filing date: 2019-12-13
Publication date: 2021-05-18
Anticipated expiration: 2039-12-13
Also published as: CN110974963A

Abstract

The invention relates to the technical field of biology, in particular to application of a substance for regulating the expression and/or function of SAGE1-INTS3 complex in preparing a medicine or a kit. The invention provides the use of a substance for modulating the expression and/or function of SAGE1-INTS3 complex in the manufacture of a medicament or kit for the treatment of tumours. The SAGE1-INTS3 compound provided by the invention can be used as a target to be applied to tumor drugs, and can effectively target all kinds of tumors with positive SAGE1 expression.

Description

Use of a substance for modulating SAGE1-INTS3 complex expression and/or function

Technical Field

The invention relates to the technical field of biology, in particular to application of a substance for regulating the expression and/or function of SAGE1-INTS3 complex in preparing a medicine or a kit.

Background

The advent of targeted drugs has enabled numerous cancer patients to avoid the huge side effects brought by chemotherapy and greatly prolong the life span, targeted therapy is based on the gene mutation of tumor cells to carry out precise hit, and based on the specific conduction signal path on the surface of the tumor cells, the normal metabolism of the cells is inhibited, and the tumor cells with certain gene mutation are directly killed. For example, a recent breakthrough in the field of tumor-targeted therapy is the NTRK targeting drug Larotrectinib (code: LOXO-101). Although NTRK gene fusion is a broad spectrum cancer driver gene, expressed in almost all types of cancer, it is very rare, detected only in < 1% of patients with malignant solid tumors. NTRK gene fusion is due to chromosomal variation, resulting in fusion of NTRK gene family members (NTRK1, NTRK2, NTRK3) with another unrelated gene. The TRK fusion protein is a product of abnormal expression of NTRK fusion gene, and is in a continuous active state to trigger a permanent signal cascade reaction to drive the diffusion and growth of TRK fusion tumor. NTRK fusion cancer can occur anywhere in the human body and can occur in all types of tumors. Although the occurrence probability is low, once the fusion mutation is detected, the effective rate of the targeted therapy is very high no matter what kind of cancer (tissue/cell/site), and the defect is that the targeted drug for NTRK has the same disease as other targeted drugs at present and has drug resistance. Research shows that the drug resistance mechanism is similar to that of EGFR, mainly the target (NTRK gene) generates new mutation, and NTRK gene fusion is rare in most cancer types, and the total incidence of all tumor types is about: 0.21% (statistics for 11,116 patients).

Disclosure of Invention

In view of the above-mentioned drawbacks of the prior art, the present invention aims to provide the use of a substance for modulating the expression and/or function of SAGE1-INTS3 complex in the preparation of a medicament or a kit for solving the problems of the prior art.

To achieve the above and other related objects, the present invention provides, in one aspect, the use of a substance for modulating the expression and/or function of SAGE1-INTS3 complex in the manufacture of a medicament or kit for the treatment of tumors.

In some embodiments of the invention, the agent for modulating the expression and/or function of SAGE1-INTS3 complex is a single active ingredient.

In some embodiments of the invention, the agent that modulates the expression and/or function of SAGE1-INTS3 complex is selected from a nucleic acid molecule, a protein molecule, or a compound.

In some embodiments of the invention, the agent that modulates SAGE1-INTS3 complex expression and/or function is selected from an SAGE1 inhibitor.

In some embodiments of the invention, the inhibitor of SAGE1 is selected from the group consisting of interfering RNA for SAGE1, antisense oligonucleotide for SAGE1, an agent for knocking out or knocking down SAGE1 expression.

In some embodiments of the invention, the SAGE1 inhibitor is selected from a substance that competes with SAGE1 for binding to INTS 3.

In some embodiments of the invention, the SAGE1 inhibitor is selected from the group consisting of INTS6, INTS6L, in combination, or a combination of two or more thereof.

In some embodiments of the invention, the tumor is a SAGE1 positive tumor.

In some embodiments of the invention, the tumor is selected from a solid tumor or a hematological tumor, preferably selected from intestinal cancer, lung cancer, liver cancer, breast cancer, esophageal cancer, head and neck cancer, skin cancer, kidney cancer, leukemia, colon cancer, hepatocellular cancer, ovarian serous cystadenocarcinoma, endometrial cancer, thyroid cancer, cutaneous melanoma, lung adenocarcinoma, head and neck squamous cell carcinoma, glioblastoma multiforme, prostate cancer, thymus cancer, brain low-grade glioma, rectal adenocarcinoma, pheochromocytoma and paraganglioma, esophageal cancer, renal clear cell carcinoma, cervical squamous cell carcinoma and adenocarcinoma, bladder urothelial carcinoma, renal papillary cell carcinoma, pancreatic cancer, gastric cancer, renal chromophobe carcinoma, breast infiltrating carcinoma, lung squamous carcinoma, sarcoma, acute myeloid leukemia.

In another aspect of the invention there is provided a composition comprising a substance which modulates the expression and/or function of SAGE1-INTS3 complex for use in the treatment of tumours.

Drawings

FIG. 1A is a diagram showing the results of sequencing analysis in example 1 of the present invention.

FIG. 1B is a schematic diagram showing the proportion analysis of SAGE 1-positive expression cancer patients in example 1 of the present invention.

FIG. 1C is a graph showing the comparison of SAGE1 expression between tumor tissue and para-carcinoma tissue in example 1 of the present invention.

FIG. 1D is a graphical representation of the overall survival of SAGE1 positive and SAGE1 negative expressing patients of example 1 of the present invention.

FIG. 1E is a graphical representation of the overall survival of patients with high expression of SAGE1 compared to low expression of SAGE1 according to example 1 of the present invention.

FIG. 2A is a schematic representation of tumor immunoimaging of tissue according to example 2 of the present invention.

FIG. 2B is a schematic view showing the QPCR detection result in embodiment 2 of the present invention.

FIG. 2C is a schematic diagram showing the detection results of example 2 of the present invention for the universal cell lines LO2, 293T, K562, Hutu80 and U2 OS.

FIG. 2D is a schematic view showing the QPCR detection result in embodiment 2 of the present invention.

FIG. 2E is a graph showing the results of the evaluation of the correlation between SAGE1 expression and CRC prognostic factor in example 2 of the present invention.

FIG. 3A is a schematic diagram showing the proliferation of A375 tumor cells by SAGE1 in example 3 of the present invention.

FIG. 3B is a graph showing the effect of SAGE1 on Hutu80 tumor cell proliferation in example 3 of the present invention.

FIG. 3C is a schematic diagram showing the effect of SAGE1 on CaCO2 tumor cell proliferation in example 3 of the present invention.

FIG. 3D is a schematic representation of the experiment of the formation of soft agar clones after the sorting of the recovered SAGE1 cells in example 3 of the present invention.

FIG. 3E is a schematic diagram showing the experimental results of the transplanted tumor of duodenal cancer in nude mice according to example 3 of the present invention.

FIG. 3F is a schematic diagram showing the experimental results of a transplanted carcinoma of large intestine according to example 3 of the present invention.

FIG. 4A is a graph showing the inhibition of SAGE1 positive PDX model of hepatoma tumor by shRNA adenovirus against SAGE1 in example 4 of the present invention.

FIG. 4B is a graph showing the inhibition results of SAGE1 positive poorly differentiated non-small cell epithelial derived lung cancer PDX tumor model by shRNA adenovirus against SAGE1 in example 4 of the present invention.

FIG. 4C is a graph showing the inhibition of SAGE1 negative PDX model of hepatoma tumor by shRNA adenovirus against SAGE1 in example 4 of the present invention.

FIG. 5A is a schematic diagram showing the analysis results of silver staining gel in example 5 of the present invention.

FIG. 5B is a schematic diagram showing the result of mass spectrometric identification in example 5 of the present invention.

FIG. 5C is a schematic representation of the cellular endogenous interaction between SAGE1 and INTS3 in example 5 of the present invention.

FIG. 5D is a schematic diagram showing the results of in vitro purification of SAGE1-INTS3 complex protein in example 6 of the present invention.

FIG. 5E is a schematic diagram showing the results of in vitro expression of purified INTS6-INTS3 complex in example 6 of the present invention.

FIG. 5F is a graph showing the result of the analysis of the relationship between the actions of INTS3 and INTS6 in the 293T cell line in the absence of SAGE1 in example 5.

FIG. 5G shows a schematic protein sequence alignment of SAGE1 and INTS6 according to the present invention.

FIG. 5H is a schematic diagram showing the results of in vivo cell competition experiments performed on SAGE1, INTS3 and INTS6 proteins in the present invention.

FIG. 5I is a schematic diagram showing the results of the in vitro protein complex competition formation experiment of example 6 of the present invention.

FIG. 5J is a schematic diagram showing the crystal structure analysis result of SAGE1-INTS3 composite of example 6 of the present invention.

FIG. 6A is a graph showing the measurement results of the binding constants of wild-type SAGE1 and INTS3 in example 7 of the present invention.

FIG. 6B is a graph showing the measurement results of the binding constants of SAGE1mutant and INTS3 mutant according to example 7 of the present invention.

FIG. 6C is a schematic diagram showing the results of CO-IP experiments in 8293T cells of this invention.

FIG. 6D is a graph showing the results of the reversion experiment of wild type SAGE1 and SAGE1 mutants in intestinal cancer tumor cells knocked down SAGE1 in example 9 of the present invention.

FIG. 6E is a graph showing the results of the reversion experiment of wild type SAGE1 and SAGE1 mutants in esophageal cancer tumor cells with knockdown of SAGE1 in example 9 of the present invention.

FIG. 6F is a graph showing the results of a reversion experiment of wild-type SAGE1 and SAGE1 mutants in duodenal tumor cells with SAGE1 knocked out in example 9 of the present invention.

FIG. 6G is a graph showing the tumor volume results of the experimental transplantation of tumors in example 10 of the present invention.

Fig. 6H is a graph showing tumor weight results of the transplanted tumor experiment in example 10 of the present invention.

FIG. 6I is a schematic diagram showing RNAseq significantly changed genes and consistency of change direction after knocking down SAGE1 or INTS3 respectively in HUTU80 of example 11.

FIG. 6J is a schematic diagram showing the signaling pathways associated with RNAseq significant change differential gene enrichment in reverting wild type SAGE1 from CaCO2 knocked-down SAGE1 in example 11 of the invention.

FIG. 6K is a schematic diagram showing the related signaling pathways for RNAseq significant change differential gene enrichment of reversion mutant SAGE1 in CaCO2 of example 11 knock-down SAGE1 of the invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments, and other advantages and effects of the present invention will be apparent to those skilled in the art from the disclosure of the present specification.

The inventor of the invention unexpectedly discovers in a large amount of research work that CT-X cancer testis antigen SAGE1 located on X chromosome (X: 135895410-, the present invention has been completed based on this finding.

In a first aspect, the invention provides the use of an agent for modulating the expression and/or function of SAGE1-INTS3 complex in the manufacture of a medicament or kit for the treatment of a tumour. The inventors found that in SAGE1 negative cells, the SAGE1-INTS3 complex was not present, while in SAGE1 positive cells, the expression of which occurred, INTS3 bound to SAGE1 to form INTS3-SAGE1 complex. In addition, the reduction of SAGE1 expression level is consistent with the change of the significantly different gene caused by the reduction of INTS3 expression level, namely, the up-regulated gene in the significantly variable gene of SAGE1 is also up-regulated in the significantly variable gene of INTS3, and the down-regulated gene in the significantly variable gene of SAGE1 is also down-regulated in the significantly variable gene of INTS3, so that SAGE1 can change the expression of the tumor-related gene through the regulation and control of a compound formed by the SAGE1 and the INTS3, and the INTS3 and SAGE1 in the compound are in positive and synergistic relationship and should act as a whole. Moreover, the disruption of the interaction between INTS3-SAGE1 can completely destroy SAGE1 to promote the growth of tumor cells and obviously inhibit the growth of xenograft tumors. Thereby verifying that the SAGE1-INTS3 complex can be used as a target for inhibiting the growth of tumor cells and used for preparing a medicament or a kit for treating tumors.

In the present invention, SAGE1-INTS3 complex generally refers to the complex formed between SAGE1 and INTS3 by protein-protein interaction. The INTS3 may typically form a dimer (e.g., in solution), and the formed dimer may further form SAGE1-INTS3 complex with SAGE1, which may interact with each other through hydrogen bonds, salt bridges, etc. The crystal structure of the SAGE1-INTS3 complex may generally have the unit cell parameters shown below:

α is 90 ± 0.1 °, β is 113.280 ± 0.1 °, and γ is 90 ± 0.1 °. In the SAGE1-INTS3 complex, the key amino acids between SAGE1 and INTS3 to form the complex may generally include F838, F873, K874, R872, M832, Q840 and the like.

In the present invention, the term "treatment" includes prophylactic, curative or palliative treatment which results in the desired pharmaceutical and/or physiological effect. Preferably, the effect is a medical treatment that reduces one or more symptoms of the disease or eliminates the disease altogether, or blocks, delays the onset of the disease and/or reduces the risk of developing or worsening the disease.

In the invention, the substance for regulating the expression and/or function of SAGE1-INTS3 complex can be a substance for inhibiting the expression and/or function of SAGE1-INTS3 complex. For example, the substance for inhibiting the expression and/or function of SAGE1-INTS3 complex may be partial inhibition, i.e., reducing the expression and/or function of SAGE1-INTS3, or complete inhibition, i.e., completely eliminating the expression and/or function of SAGE1-INTS 3. The substance for inhibiting the expression and/or function of SAGE1-INTS3 complex may be various substances capable of performing the above functions, for example, the above substances may be nucleic acid molecules, protein molecules, compounds, or the like.

In the invention, the substance for inhibiting the expression and/or function of SAGE1-INTS3 complex can be SAGE1 inhibitor, the SAGE1 inhibitor can partially inhibit, namely reduce the expression and/or function of SAGE1, and can completely inhibit, namely completely eliminate the expression and/or the function of SAGE1, and the function can be the function of SAGE1 combining with INTS3 to form SAGE1-INTS3 complex. The class of suitable substances capable of acting as SAGE1 inhibitors should be known to those skilled in the art, for example, the inhibitors can be antagonists, blockers, etc., and further for example, the inhibitory function of the SAGE1 inhibitor can be inhibition of the expression level at the SAGE1 gene nucleic acid molecule level (e.g., mRNA level, DNA level) and/or protein molecule level, and further for example, the SAGE1 inhibitor can also be a substance that competes with SAGE1 for binding to INTS 3. More specifically, the SAGE1 inhibitor may be a nucleic acid molecule, a protein molecule, a compound or the like, for example, the nucleic acid molecule may be selected from an interfering RNA against SAGE1, an antisense oligonucleotide against SAGE1, a substance for knocking out or knocking down expression of SAGE1, more specifically, siRNA, miRNA, shRNA, a knock-out vector, a gene expression vector (e.g., capable of expressing siRNA, shRNA, interfering RNA or the like), or the like; for another example, the protein molecule may be selected from anti-SAGE 1 antibodies, which may be monoclonal antibodies, polyclonal antibodies, and the like; as another example, the SAGE1 inhibitor can be a substance capable of competing with SAGE1 for binding to INTS3 to competitively inhibit the formation of SAGE1-INTS3 complex, and specifically can be INTS6(DDX26, Access: NP-036273.1), INTS6L (DDX26b, Access: Q8BND4.1), and the like. In one embodiment of the present invention, the target sequence of the nucleic acid molecule may include a sequence shown in any one of SEQ ID Nos. 1 to 9. In another embodiment of the present invention, the polynucleotide sequence of the nucleic acid molecule may comprise the sequence shown in one of SEQ ID Nos. 10 to 18. In another embodiment of the invention, the polynucleotide sequence of the nucleic acid molecule may comprise the sequence shown in one of SEQ ID Nos. 19 to 22.

In the medicament or the kit provided by the invention, the SAGE1 inhibitor can be used as a single effective component, and can also be combined with other active components to be jointly used for treating tumors.

In the medicine or the kit provided by the invention, the tumor is generally SAGE1 positive tumor. The SAGE1 positive generally indicates that SAGE1 expression, or SAGE1 expression is above a certain level, for example, SAGE1 positive may be the expression of mRNA in tumor tissue from which SAGE1 is detectable, and further for example, SAGE1 positive may be the expression of protein in tumor tissue from which SAGE1 is detectable, for example, SAGE1 positive may be the expression of mRNA in SAGE1 in tumor tissue above its surrounding healthy tissue, and further for example, SAGE1 positive may be the expression of SAGE1 protein in tumor tissue above its surrounding healthy tissue. The tumor may be a variety of solid or hematological tumors, more particularly intestinal, lung, liver, breast, esophageal, head and neck, skin, kidney, leukemia, coad (colon), lihc (hepatocellular), ov (ovarian serous cystadenocarcinoma), ucec (endometrial), thca (thyroid), skcm (cutaneous melanoma), luad (lung adenocarcinoma), hnsc (head and neck squamous cell carcinoma), gbm (glioblastoma multiforme), prad (prostate), thym (thymus), lgg (brain low-grade glioma), read (rectal adenocarcinoma), pc (pheochromocytoma and paraganglioma), esca (esophageal), kirc (renal clear cell carcinoma), cec (cervical squamous cell carcinoma and adenocarcinoma), blca (urothelial carcinoma), kirta (renal papillary cell carcinoma), paad (pancreatic carcinoma), gastric carcinoma, kich (renal chromophocyte carcinoma), brca (breast infiltrating carcinoma), lucc (lung squamous carcinoma), sarcomas, LAML (acute myeloid leukemia), and the like.

In a second aspect, the present invention provides a composition comprising a substance for modulating the expression and/or function of SAGE1-INTS3 complex, said composition being for: treating tumor. In the composition, the substance for regulating the expression and/or function of SAGE1-INTS3 complex may be any of the various substances for regulating the expression and/or function of SAGE1-INTS3 complex provided in the first aspect of the present invention.

In a third aspect the invention provides a method of treatment comprising: administering to the subject a therapeutically effective amount of an agent for modulating the expression and/or function of SAGE1-INTS3 complex, or a composition provided by the second aspect of the invention. The treatment provided by the present invention may be used to treat indications including, but not limited to, tumors and the like. The tumour may be a solid tumour or a haematological tumour, more particularly intestinal, lung, liver, breast, oesophageal, head and neck, skin, kidney, leukaemia, coad (colon), lihc (hepatocellular), ov (ovarian serous cystadenocarcinoma), ucec (endometrial), thca (thyroid), skcm (cutaneous melanoma), luad (lung adenocarcinoma), hnsc (head and neck squamous cell carcinoma), gbm (glioblastoma multiforme), prad (prostate), thym (thymus), lgg (brain low-grade glioma), read (rectal adenocarcinoma), pcpg (pheochromocytoma and paraganglioma), esca (oesophageal), kirc (renal clear cell carcinoma), etc (cervical squamous cell carcinoma and adenocarcinoma), blca (bladder urothelial carcinoma), kista (renal papillary cell carcinoma), paad (pancreatic carcinoma), d (gastric carcinoma), kich (renal chromophocyte carcinoma), brca (breast infiltrating carcinoma), lucc (lung squamous carcinoma), sarcomas, LAML (acute myeloid leukemia), and the like.

In the present invention, "subject" generally includes humans, non-human primates, such as mammals, dogs, cats, horses, sheep, pigs, cows, etc., which would benefit from treatment with the formulation, kit or combined formulation.

In the present invention, a "therapeutically effective amount" generally refers to an amount which, after an appropriate period of administration, is capable of achieving the effect of treating the diseases as listed above.

The SAGE1-INTS3 compound provided by the invention can be applied to tumor drugs as a target, as SAGE1 peptide antigen is expressed on the cell surface of tumor tissues such as melanoma, bladder cancer, liver cancer, epidermoid cancer, non-small cell lung cancer, squamous cell cancer and the like, but is not expressed in most normal tissues except testis, the SAGE1 peptide antigen can effectively target tumors with positive expression of all kinds of SAGE1, and the overall rate of the positive expression is relatively high, different from other target mechanisms found to be applied to targeted therapy, SAGE1/SAGE1-INTS3 gene/protein is taken as a target and is not based on the gene mutation of tumor cells, but is based on the interaction of a newly discovered compound of SAGE1-INTS3 gene/protein, the principle of the special targeted strategy is based on that the expression mode of SAGE1 is only expressed in testis and other reproductive systems under normal physiological conditions or has low-level expression in brain, it is not expressed in other normal tissues, and only has different frequency expression in various tumor tissues specifically, because both testis and brain are tissues with barriers, and the specific targeting of SAGE1/SAGE1-INTS3 gene/protein does not affect normal tissues.

The invention of the present application is further illustrated by the following examples, which are not intended to limit the scope of the present application.

Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ techniques conventional in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related arts. These techniques are well described in the literature, and may be found in particular in the study of the MOLECULAR CLONING, Sambrook et al: a LABORATORY MANUAL, Second edition, Cold Spring Harbor LABORATORY Press, 1989and Third edition, 2001; ausubel et al, Current PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987and periodic updates; the series METHODS IN ENZYMOLOGY, Academic Press, San Diego; wolffe, CHROMATIN STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; (iii) METHODS IN ENZYMOLOGY, Vol.304, Chromatin (P.M.Wassarman and A.P.Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol.119, chromatography Protocols (P.B.Becker, ed.) Humana Press, Totowa, 1999, etc.

Example 1

Sequencing data of RNAseq of a human normal Tissue in a GTEX database (Genotype-Tissue Expression (GTEx) Program, http:// common fund. nih.gov/GTEx /) are used for sequencing RNAseq sequencing data, the mRNA Expression quantity of SAGE1 is analyzed by a sequencing TPM value, and the sequencing analysis results of 30 parts of a normal human body show that SAGE1 gene is mainly and specifically highly expressed in testis, slightly expressed in cerebral nerve Tissue and basically not transcribed in other human body tissues, and the figure is 1A.

Analysis was performed using TCGA (the cancer genome atlas, https:// www.cancer.gov/about-nci/organization/ccg/research/structural-genomics/TCGA) patient public database (download link https:// www.cbioportal.org) in 26 solid tumors (coad (colon carcinoma), lich (hepatocellular carcinoma), ov (ovarian serous cystadenocarcinoma), ucec (endometrial carcinoma), thaca (thyroid carcinoma), tgct (testicular carcinoma), skcm (cutaneous melanoma), luer (lung adenocarcinoma), hnsc (head and neck squamous cell carcinoma), gbm (glioblastoma multiforme), prad (prostate carcinoma), thym (thymus carcinoma), lgg (brain low-grade glioma), read (rectal adenocarcinoma), pc (pheochromocytoma and paraneuroma), escale (esophageal carcinoma), kidney carcinoma (squamous cell carcinoma), cervical adenocarcinoma (squamous cell carcinoma and renal adenocarcinoma), in patients with blca (urothelial carcinoma of the bladder), kirp (renal papillary cell carcinoma), pad (pancreatic carcinoma), stad (gastric carcinoma), kich (renal chromophobe carcinoma), brca (breast infiltration carcinoma), lucc (lung squamous carcinoma), sarc (sarcoma)) and 1 hematologic carcinoma (laml (acute myeloid leukemia)), SAGE1 positive expression (SAGE1 positive is defined by SAGE1FPKM >0 for this case, SAGE1 negative is defined by the proportion of patients with SAGE1FPKM ═ 0 for this case) cancer, see fig. 1B.

Analysis was performed using TCGA (the cancer genome atlas, https:// www.cancer.gov/about-nci/organization/ccg/research/structural-genetics/TCGA) patient public database (download link https:// www.cbioportal.org) in 25 solid tumors (coad (colon carcinoma), lihc (hepatocellular carcinoma), ov (ovarian serous cystadenocarcinoma), ucec (endometrial carcinoma), thaca (thyroid carcinoma), skcm (cutaneous melanoma), luad (lung adenocarcinoma), hnsc (head and neck squamous cell carcinoma), gbm (glioblastoma multiforme), prad (prostate carcinoma), thym (thymus carcinoma), lgg (brain low-grade glioma), read (rectal adenocarcinoma), pc (pheochromocytoma and paraneuroma), esca (esophageal carcinoma), kirc (clear carcinoma), cervical (squamous cell carcinoma and cervical (cervical carcinoma), in patients with blca (urothelial carcinoma of the bladder), kirp (renal papillary cell carcinoma), pad (pancreatic carcinoma), stad (gastric carcinoma), kich (renal chromophobe carcinoma), brca (breast infiltration carcinoma), lucc (lung squamous carcinoma), sarc (sarcoma)) and 1 blood cancer (laml (acute myeloid leukemia)), positive expression of SAGE1 was plotted according to the sequenced FPKM, and expression of SAGE1 and expression of para-carcinoma tissues in pan-carcinoma patients were plotted, showing that SAGE1 is expressed in tumor tissues higher than in para-carcinoma tissues, as shown in fig. 1C.

Using TCGA (the cancer genome atlas，https://www.cancer.gov/about-nci/ organization/ccg/research/structural-genomics/tcga) Pan-cancer patient public databases (download links https:// www.cbioportal.org) were analyzed in 25 solid tumors (coad (colon carcinoma), lihc (hepatocellular carcinoma), ov (ovarian serous cystadenocarcinoma), ucec (endometrial carcinoma), thca (thyroid carcinoma), skcm (cutaneous melanoma), luad (lung adenocarcinoma), hnsc (head and neck squamous cell carcinoma), gbm (glioblastoma multiforme), prad (prostate carcinoma), thym (thymus carcinoma), lgg (brain low-grade glioma), read (rectal adenocarcinoma), pcpg (pheochromocytoma and paraganglioma), esca (esophageal carcinoma), kirc (renal clear cell carcinoma), cec (cervical squamous cell carcinoma and adenocarcinoma), bla (bladder urothelial carcinoma), kita (renal papillary cell carcinoma), paad (pancreatic carcinoma), gastric carcinoma, kich (renal squamous cell carcinoma), brca (breast infiltrating carcinoma), a total of 8979 patients with Lusc (squamous cell lung carcinoma), sarcomas (sarcomas) and 1 hematological carcinoma (laml (acute myeloid leukemia)), had SAGE1 positive expression (SAGE1 positive definition based on SAGE1FPKM in this case>0, SAGE1 negative was defined based on the case SAGE1FPKM ═ 0) cancer patients (4483 cases) showed short overall survival and poor prognosis (p ═ 1.389031 e-14) within 96 months of observation time, with specific results as shown in fig. 1D.

Analysis was performed using TCGA (the cancer genome atlas, https:// www.cancer.gov/about-nci/organization/ccg/research/structural-genetics/TCGA) patient public database (download link https:// www.cbioportal.org) in 25 solid tumors (coad (colon carcinoma), lihc (hepatocellular carcinoma), ov (ovarian serous cystadenocarcinoma), ucec (endometrial carcinoma), thaca (thyroid carcinoma), skcm (cutaneous melanoma), luad (lung adenocarcinoma), hnsc (head and neck squamous cell carcinoma), gbm (glioblastoma multiforme), prad (prostate carcinoma), thym (thymus carcinoma), lgg (brain low-grade glioma), read (rectal adenocarcinoma), pc (pheochromocytoma and paraneuroma), esca (esophageal carcinoma), kirc (clear carcinoma), cervical (squamous cell carcinoma and cervical (cervical carcinoma), bla (bladder urothelial cancer), kirp (renal papillary cell carcinoma), pad (pancreatic cancer), stad (gastric cancer), kich (renal chromophobe cancer), brca (mammary infiltration cancer), lucc (lung squamous carcinoma), sarc (sarcoma)) and 1 blood cancer (laml (acute myeloid leukemia)) SAGE1 positive expression (SAGE1 positive definition according to SAGE1FPKM >0 of the case, SAGE1 negative definition according to SAGE1FPKM ═ 0 of the case) cancer patients (4483 cases) distinguished by high and low SAGE1 expression according to median (SAGE1 high expression 2242 case, SAGE1 low expression case 2241), showed short overall survival of SAGE1 high expression patients within 96 months of observation time, and in advance (p 1.244621E-11), with specific results as shown in FIG. 1E.

Example 2

Immunohistochemistry on tissues using antibodies specific for SAGE1 was used as tumor immunoimaging of tissues: as shown in FIG. 2A, normal testis, intestinal cancer, esophageal cancer, skin cancer, larynx cancer, kidney cancer and lung cancer slices were obtained from Oncology department of northern institute of Nonshima, the ninth Hospital of Shanghai, and liver cancer and lung cancer slices were obtained from the human PDX tumor model of Oncology department of northern institute of Nonshima, the ninth Hospital of Shanghai.

1. Reagent: PBST buffer solution, hematoxylin staining solution, antigen renaturation agent, DAB solution, primary anti-dilution solution, SAGE1 primary Antibody (NOVUS, NBP1-84355SAGE1 Antibody rabbit anti-human), HRP labeled secondary Antibody (anti-rabbit).

2. Experimental operating procedure

1) Reagent preparation

Xylene, 100% ethanol, 95% ethanol, 75% ethanol, 50% ethanol

Inactivating the enzyme reagent: 3% H2O 2-methanol solution, 1mL 30% H2O2 was added to 9mL methanol

PBST washing solution: 1000mL of pH7.4 PBS +3mL of Triton were mixed well

Primary anti-dilution solution: 3% BSA-PBST solution, 0.03g BSA in 1mL PBST

1% hydrochloric acid-ethanol solution: 1mL of hydrochloric acid is dissolved in 99mL of ethanol

Antigen renaturation agent ph6.0 citric acid buffer: 810mL of 0.1M citric acid solution +190mL of 0.1M trisodium citrate solution

DAB solution: prepared as-is when used in the dark, and used up within 3 minutes after preparation, 85% ddH2O + 5% DAB buffer (20X) + 5% DAB substrate (20X) + 5% DAB chromogen (20X)

2) Baking the slices: before dewaxing, the tissue paraffin sections are placed in a thermostat, and the temperature is adjusted to 60 ℃ for baking for 30 minutes.

3) Dewaxing and rehydration: respectively operate according to the following steps

Two cylinders of xylene, 10 minutes each;

two cylinders of absolute ethyl alcohol, each cylinder for 7 minutes;

1 jar with 95% alcohol for 5 minutes;

1 jar with 75% alcohol for 5 minutes;

1 jar with 50% alcohol for 5 minutes;

ddH2O was soaked for 5 minutes and washed 3 times.

4) Antigen retrieval:

a citric acid high-temperature high-pressure repairing method: putting the citric acid repairing liquid into a high-temperature high-pressure sterilization pot in advance, covering a high-pressure pot cover, stopping heating after 5 minutes of air outlet, putting the dewaxed and rehydrated tissue slices into the preheated antigen repairing liquid, reheating the sterilization pot, closing an air release valve after 5 minutes of air outlet, starting timing 5 minutes when the temperature is increased to 121 ℃, stopping heating, slowly exhausting air when the temperature is slightly reduced to 100 ℃, and opening the sterilization pot cover to naturally cool the sterilization pot for more than 30 minutes.

5) Washing: ddH2O was soaked for 5min and washed 2 times, PBST was soaked for 5min and washed 2 times.

6) Inactivating the enzyme: 50 μ L of the inactivated enzyme reagent was added dropwise to each section, and the sections were protected from light at room temperature for 15 minutes.

7) Washing: PBST was soaked for 5 minutes and washed 3 times.

8) And (3) sealing: each section was blocked with 50. mu.L of PBST blocking solution containing 3% BSA at room temperature for 30 minutes in a wet box.

9) Adding a primary antibody: the blocking solution was discarded and each section was added dropwise with 50. mu.L of sage primary antibody and incubated overnight in a wet box at 4 ℃ or for 2 hours at 37 ℃. Once the sage antibody is diluted according to the ratio of 1:3000, a parafilm layer can be lightly attached to prevent the liquid on the surface of the glass slide from volatilizing.

10) Rewarming: after incubation overnight at 4 ℃ the next day was removed and rewarmed for 1 hour at room temperature.

11) Washing: PBST was soaked for 5 minutes and washed 3 times. (first quick pour)

12) Adding an enzyme-labeled secondary antibody: HRP-labeled secondary antibody (anti-rabbit) was added dropwise to each section, and incubated at 37 ℃ for 30 minutes.

13) Washing: PBST was soaked for 5 minutes and washed 3 times. (first quick pour)

14) Color development (DAB method): 50 mu.L of color developing solution is dripped into each slice, and the slices are developed for 5 minutes in a wet box.

15) And (3) stopping color development: the color reaction was stopped with distilled water. And (5) observing whether the color development is obvious and the background is dark and light by using an inverted microscope, and photographing and storing the image.

16) Counterdyeing: 50 μ L of hematoxylin cell staining solution is added dropwise to each section, staining is carried out for 5-10 minutes, and the section is washed clean by ddH 2O.

17) Decoloring and returning blue: each slice is added with 1% hydrochloric acid-ethanol in turn and quickly added with ddH2O within 3 seconds to terminate, and then is added into PBST to return blue for 5-30 minutes.

18) Sealing: soaking in 75% ethanol and anhydrous ethanol for 2 min, soaking in xylene for 2 min and 2 times, dripping neutral gum on the slices, and covering with glass slide.

19) And (4) observation: and observing the photographed images under a microscope in a color mode of 10 times and 20 times.

The experimental results of the tissues are shown in fig. 2A, and it can be seen from fig. 2A that positive expression of SAGE1 in normal testis tissues and various tumor tissues (liver cancer and lung cancer derived from the ninth national institute of oncology, department of oncology in northern hospital, PDX tumor section, esophageal cancer, head and neck cancer, skin cancer and kidney cancer derived from the section of oncology in northern hospital) was found by immunohistochemical staining using an antibody specific for SAGE 1. A PDX tumor model was constructed by taking tumor tissues of nine different kinds of patients (HCC 15: primary hepatocellular carcinoma, Q003: lung adenocarcinoma, LU 1030: poorly differentiated squamous carcinoma, CRC 31: colon carcinoma, HCC 7: primary hepatocellular carcinoma, Q003: squamous carcinoma, LU 1062: lung adenocarcinoma, CRC 1: colon carcinoma, CRC 44: colon carcinoma) from the ninth national Hospital affiliated to Shanghai transportation university: PDX P0 operation:

1) under aseptic conditions, fresh human tumor tissue is placed in RPMI1640 cell culture medium (double antibody is added) for pruning, and necrotic tissue is removed

2) Cutting the tumor into small pieces with the diameter of about 5mm, and fully soaking the small pieces in matrigel

3) Clamping tissue block with forceps, and placing into puncture trocar

4) Disinfecting the skin of the chest and abdomen of the nude mouse with alcohol, and cutting a 3-5 mm incision at the manubrium of the chest with scissors to a depth of subcutaneous part

5) Using a puncture needle, the tumor tissue is inoculated subcutaneously near the inguinal region of the abdomen by entering from the incision

6) Sealing wound with tissue glue, and placing back into cage box for continuous breeding

7) And (5) regularly observing, recording a growth curve, and tracing clinical information.

8) The tumor grew to the appropriate size, passage P0.

QPCR detection of SAGE1 in 9 tumor tissues derived from the human PDX tumor model, and showed the presence of SAGE1 transcriptional expression in 4 of them (fig. 2B); the QPCR detection of SAGE1 was performed on paracarcinoma and tumor tissues of 60 intestinal cancer patients (FIG. 2D) as follows:

experimental material used in this example tumor tissue of the humanized PDX tumor model was derived from nine oncology departments in shanghai, 60 cases of intestinal cancer patients with paracarcinoma and tumor tissue from tianjin tumor hospital, approved by tianjin cancer institute and hospital ethics committee, and tissue containing colorectal cancer and adjacent normal colon tissue specimens were obtained from patients (N60) who underwent surgical resection after histopathological diagnosis of colorectal cancer at this institution (N60).

The RNA extraction Kit used was RNeasy Mini Kit (50) (QIANGEN Cat number/ID: 74104) and GOMag Blood and Tissue RNA Kit (Zhi On Bio Cat. # GO-MNTR), and the RNA reverse transcription Kit used was PrimeScript^TM1st strand cDNA Synthesis Kit (TaKaRa Cat. #6110A), the Q-PCR Kit used was TB Green^TM Premix Ex Taq^TM II(Tli RNaseH Plus)(TaKaRa Cat.#RR820A)。

(1) RNA extraction:

RNA extraction was performed using the following two methods:

centrifugal column method:

1) collecting the cells (selected to 1a or 1b depending on the case)

1a) Suspension of cells: determining the number of cells (total amount not exceeding 1X 10)⁷) Cells were collected into centrifuge tubes by centrifugation (5min, 300 Xg), all supernatants carefully aspirated and discarded, and washed twice with PBS.

1b) Adherent cells in monolayer (total amount not exceeding 1X10 in case of 10cm dish)⁷): the cells were washed twice with PBS, PBS was discarded, 500. mu.l pancreatin (0.25%) was added, mixed well, incubated in a37 ℃ incubator (incubation times vary widely depending on cell lines, typical cell lines are such as A375 for about 3 minutes, HUTU80 for about 3-5 minutes), 1ml of 10% serum-containing medium was added to stop digestion when cells started to fall off from the dish, cells were collected in a centrifuge tube, centrifuged for 5 minutes at 300 Xg, the supernatant was discarded, and washed twice with PBS for use.

2) Add 175. mu.l of precooled (4 ℃ C.) buffer RLN to the centrifuge tubes and incubate for 5 minutes on ice.

3) Centrifuge at 4 degrees 300 Xg for 2 minutes, transfer the supernatant to a new centrifuge tube, and discard the precipitate.

4) To the supernatant was added 600. mu.l of buffer RLT and mixed by vigorous vortexing.

5) 430 microliters of ethanol (96-100%) was added and blown with a gun to mix well (without centrifugation).

6) Transfer 700. mu.l of sample (transferred together with the pellet if any) to RNeasy spin column, gently cover the lid, centrifuge at 10000 Xg for 30 seconds, and discard the flow-through. This procedure was repeated until all samples had flowed through the spin column.

7) 700 microliters of buffer RW1 was added to the RNeasy spin column, the lid was gently closed, centrifuged at 10000 Xg for 30 seconds, and the flow-through liquid was discarded.

8) To RNeasy spin column was added 500. mu.l of buffer RPE, covered gently with a lid, centrifuged at 10000 Xg for 30 seconds, and the flow-through was discarded.

9) To RNeasy spin column was added 500. mu.l of buffer RPE, capped gently, and centrifuged at 10000 Xg for 2 minutes.

10) RNeasy spin column was transferred to a clean 2ml collection tube, the original tube was discarded and centrifuged at maximum speed for 1 minute.

11) The collection tube was discarded, the RNeasy spin column was transferred to a new 1.5ml collection tube, 30-50. mu.l of RNase-free water was added thereto, the cap was gently closed, and centrifugation was carried out at 10000 Xg for 1 minute to elute the RNA from the column.

Magnetic bead method:

sample preparation:

a. blood sample: mu.l of fresh whole blood or white membrane is taken, 350. mu.l of lysis solution Lr is added, and the mixture is evenly mixed for 2 minutes by vortex oscillation.

b. Animal tissue: about 10mg of animal tissue is taken and added with 400. mu.l of lysis solution Lr, and the tissue is fully ground or homogenized.

1) Incubating the sample prepared according to the step of sample preparation at room temperature for 10 minutes, wherein the sample can be subjected to vortex oscillation for 1-2 times, and the oscillation time is 1 minute.

2) And (3) after the incubation is finished, performing instantaneous centrifugation, then adding 510 mu l of absolute ethyl alcohol and 60 mu l of magnetic beads, performing vortex oscillation, uniformly mixing, standing at room temperature for 5 minutes, wherein the vortex oscillation can be performed for 1-2 times, and the oscillation is performed for 1 minute each time. After room temperature adsorption, vortex oscillation and uniform mixing are carried out, the centrifugal tube is placed on a magnetic frame, and magnetic attraction is carried out for 1 minute or the solution is clarified. Carefully discard the liquid in the centrifuge tube completely, taking care not to touch the magnetic beads.

3) Adding 750 mu l of washing liquid DW added with beta-ME, covering a centrifugal tube cover, carrying out vortex oscillation and uniform mixing for 1 minute, putting the centrifugal tube cover back on a magnetic frame, repeatedly reversing the magnetic frame under the condition that the centrifugal tube does not leave the magnetic frame, cleaning the centrifugal tube cover (avoiding the influence of residual lysate on the tube cover on subsequent experiments), and carrying out magnetic attraction for 1 minute or until the solution is clarified. The liquid in the tube cap is sucked away first and then all the liquid is sucked away.

4) 850. mu.l of washing solution DW to which β -ME has been added was added, and washed 1 time in accordance with the method of step 3.

5) Add 850. mu.l of 80% ETr and wash 1 time as per step 3).

6) Adding 1-5 mul DNase and 55 mul solution DB, fully and uniformly mixing, standing for 10 minutes at room temperature, and uniformly mixing for 2 times by vortex oscillation during the period.

7) After the DNA digestion is finished, vortex oscillation is carried out to mix the DNA evenly, the centrifugal tube is placed on a magnetic frame, and the DNA is magnetically absorbed for 1 minute or the solution is clarified. Care was taken to completely aspirate the liquid from the centrifuge tube, taking care not to touch the beads.

8) Add 850. mu.l of 80% ETr and wash 1 time as per step 3).

9) And (4) placing the centrifugal tube on a magnetic frame, and uncapping and drying at room temperature for 5-10 minutes.

10) Add 50. mu.l of the eluent DE, mix well by vortexing and elute at room temperature for 5 minutes. And (3) uniformly mixing the magnetic beads by vortex oscillation again, magnetically sucking the magnetic beads on a magnetic frame for 1 minute, and then sucking the supernatant, or performing a downstream experiment, or storing the supernatant at-80 ℃ for later use, wherein the repeated freeze thawing of the purified RNA is avoided.

(2) Reverse transcription of RNA

1) A mixture of the following systems was prepared in a PCR tube:

TABLE 1

2) The sample was heated at 65 ℃ for 5 minutes and then immediately placed on ice to cool.

3) 20 microliter of reaction liquid is prepared, and the specific system of the reaction liquid is as follows:

TABLE 2

The mixed liquid of the step 1	10 microliter
		5X PrimeScript Buffer	4 microliter
RNase Inhibitor
		20 units of
PrimeScript RT			100 to 200 units
	RNase-free ddH₂O	Make up to 20. mu.l

4) And (5) mixing the mixture gently.

5) The reaction was carried out according to the reaction conditions shown below:

TABLE 3

42 degree	30-60 minutes
		70 degree	15 minutes

After the reaction was completed, the reaction mixture was placed on ice for further use.

(3)RT-PCR

The process is carried out using a LightCycler/LightCycler 480 System.

The primer sequence used is a forward primer Sage-F: GGAAGAGTATGTCCTCGTGGTT (SEQ ID NO.23), reverse primer Sage-R: GCATCAGGCCATGGTGGAG (SEQ ID NO. 24).

Internal control GAPDH forward primer GAPDH-F: ATCATCCCTGCCTCTACTGG (SEQ ID NO.25), reverse primer GAPDH-R: GTCAGGTCCACCACTGACAC (SEQ ID NO. 26).

1) Preparing a PCR mixed solution, wherein the mixed solution system is as follows:

TABLE 4

2) Setting a machine program:

TABLE 5

After the experiment, data were derived and analyzed, and the specific results are shown in FIG. 2B (HCC 15: primary hepatocellular carcinoma, Q003: adenocarcinoma of lung, LU 1030: poorly differentiated squamous carcinoma, CRC 31: colon cancer, HCC 7: primary hepatocellular carcinoma, Q003: squamous carcinoma of lung, LU 1062: adenocarcinoma of lung, CRC 1: colon cancer, CRC 44: colon cancer), SAGE1 was positively expressed in some tumors (HCC15, Q003, LU1030, CRC31) and negatively expressed in some tumors.

In 60 cases of intestinal cancer, as shown in FIG. 2D, the tumor tissues of 48 patients had higher levels of SAGE1 mRNA expression than the tissues around the cancer, further demonstrating that SAGE1 was specifically expressed in tumor tissues.

To determine the pathological significance of SAGE1 expression on CRC progression, the correlation between SAGE1 expression and CRC (intestinal cancer) prognostic factors was further assessed. Statistical analysis the t-test of the paired data was used to compare the mean, the analysis of variance was used to test two sets of data with continuous variables, and the classified data was analyzed using the FisherExact or χ 2 test, statistical analysis using the SPSS software program (version 21.0; IBM corporation). Results PCR experiment detects the expression of SAGE1 in human colorectal cancer and paracarcinoma normal colon tissues, and the expression of SAGE1 in colorectal cancer tissues is obviously higher than that of normal tissues (P)<0.001) (fig. 2D). To determine the pathological significance of SAGE1 expression in CRC progression, the phase between SAGE1 expression and CRC prognostic factors was further assessedAnd (5) correlation (results are shown in FIG. 2E). In CRC patients, no correlation was found between expression of SAGE1 and gender, histological grade, and tumor size. However, in colorectal cancer specimens, SAGE1 expression was positively correlated with lymph node metastasis (χ)²＝9.586,P<0.01,r＝0.421)。

Using an antibody against SAGE1 to specifically detect whether SAGE1 was positively expressed in tumor cells:

1) preparation of samples: rinsing 10cm dish cells twice with PBS, sucking up residual PBS liquid as much as possible, adding 300-400 mul of 1 xSDS protein lysate per dish, gently scraping the cells with a cell curette, collecting the cells into a 1.5ml EP tube, and after the cells are fully lysed, blowing the viscous substance up and down with a 1ml syringe until the lysate becomes hanging drop; (for tissue samples, we have previously treated by adding liquid nitrogen, grinding to powder, adding SDS protein lysate, and the same thereafter)

1 xSDS protein lysate formula: 50mM Tris-HCl (pH 6.8)

2% SDS electrophoresis grade

10% of glycerol;

2) quantifying BCA (standard curve) protein, and calculating the concentration of a sample to be detected;

3) protein denaturation: adding the protein sample into beta-mercaptoethanol, and boiling in a water bath kettle at 98 ℃ for 10min to denature the protein;

4) electrophoresis: the sample loading amount is 80 ug;

5) electric conversion: soaking the PVDF membrane in methanol, ddH2O and a membrane transferring buffer solution in sequence, and then performing bio-rad semi-dry transfer for 20V for 30 min;

preparation of electrotransfer buffer solution

Weighing 2.9g of glycine, 5.8g of Tris alkali and 0.37g of SDS, adding deionized water until the total amount is 700ml, fully and uniformly mixing, then adding 200ml of methanol, and finally fixing the volume to 1L;

6) immune response and result display;

a) soaking the PVDF membrane in prepared 5% skimmed milk, sealing at 4 deg.C overnight;

b) primary antibody incubation: SAGE1 antibody (Novus: NBP1-84355) was diluted with 1/500, and the PVDF membrane was immersed in the diluted primary antibody and gently shaken overnight at 4 ℃;

c) taking out the PVDF membrane, washing the PVDF membrane for 3 times by using TBST, and washing the PVDF membrane for 10min each time;

d) HRP-linked secondary antibodies (goat anti-mouse or goat anti-rabbit 1: 3000) soaking the PVDF membrane in a diluted secondary antibody, and slowly shaking for 1 hour at room temperature;

e) washing the membrane with TBST for 3 times, 10min each time;

f) chemiluminescence and color development.

The results of the relevant assays for the universal cell lines LO2, 293T, K562, Hutu80, U2OS are shown in fig. 2C, and it can be seen from fig. 2C that WB assays using antibodies specific for SAGE1 were performed on normal hepatocyte LO2, normal human renal epithelial cell line 293T cell, human myeloid leukemia cell K562, human osteosarcoma cell U2OS, and human duodenal adenocarcinoma cell line Hutu80, respectively, and it was found that SAGE1 expression was not detected in normal cells LO2 and 293T, and SAGE1 was specifically expressed only in some tumor cell lines such as K562, U2OS, Hutu 80.

Example 3

A lentivirus knockdown cell line or a Cas9 knockout cell line aiming at SAGE1 is screened from three different tumor cell lines respectively, and compared with a wild-type cell, a cell proliferation experiment is carried out, so that SAGE1 has a crucial effect on tumor cell proliferation (FIG. 3A, FIG. 3B and FIG. 3C).

Lentiviruses carry foreign genes introduced into the A375 (malignant melanoma cell line) and CaCO2 (large intestine adenocarcinoma cell line) cell lines.

1. Preparation of Lentivirus (Lentivirus) carrying exogenous Gene of interest or shRNA

SAGE 1shRNA interference lentiviral vector plasmid, the patent provides 9 target sequences which are screened from a high-throughput commercial library and can efficiently knock down SAGE1 expression, and the sequences are respectively shown in Table 6, wherein SEQ ID NO. 1-9 are target sequences, SEQ ID NO. 10-18 are polynucleotide sequences of shRNA aiming at the target sequences:

TABLE 6

Lentiviral packaging A MISSION Lentiviral packaging mixture from Sigma (cat # SHP001) was used, and the actual target protocols used in the examples were sh-1 and sh-2 in Table 6.

1) Cells HEK-293T cultured and passaged packaging lentivirus: at 3-5x 10⁶cells/10cm culture dish density passage, 24 hours later, when the cell adherence rate reaches 60-80%, then transfection is carried out.

2) 26ul of lentiviral packaging mixture and 2.6 ug of lentiviral expression plasmid were added to 500ul of Opti-MEM and mixed well, 16ul of X-treme transfection reagent was added and mixed well, and left at room temperature for 15 minutes. Taking out HEK-293T cells from a37 ℃ incubator, uniformly dripping the mixed solution of the plasmids and the transfection reagent into the culture solution of the HEK-293T by using a 1ml pipette, slightly mixing the culture solution while dripping in a circle shape, and finally slightly shaking the culture solution back and forth to uniformly distribute the transfection solution.

3) Taking out HEK-293T cells from a37 ℃ incubator, uniformly dripping the mixed solution of the plasmids and the transfection reagent into the culture solution of the HEK-293T by using a 1ml pipette, slightly mixing the culture solution while dripping in a circle shape, and finally slightly shaking the culture solution back and forth to uniformly distribute the transfection solution.

4) After the culture box is placed at 37 ℃ for 5-6 hours, taking out HEK-293T cells, discarding the culture medium containing the transfection solution, carefully adding 8-10ml of fresh culture medium (liquid is not added opposite to the cells so as not to wash out the cells), and continuously placing the culture box at 37 ℃ for culture;

2. collection of supernatant of Lentivirus virus

48 hours after transfection, the medium containing the Lentivirus supernatant was collected using a 10ml syringe while 8-10ml of fresh medium was added to the HEK-293T dish for further culture. Filtering the virus supernatant by a 0.45-micron filter, marking the filtered virus supernatant, and storing the virus supernatant in a refrigerator at 4 ℃; lentivirus supernatant was collected 72 hours after transfection (retrovirus was collected every 24 hours) and was stopped if cells coiled into clumps to begin apoptosis.

3. Lentivirus virus supernatant infects target cells

At 2.5x 10⁵Carrying out density passage on cells to be infected in a culture dish of 6cm, taking out filtered virus supernatant in a refrigerator at 4 ℃ after 24 hours, sucking a proper amount of virus liquid into a culture medium of the cells to be infected, and culturing in an incubator at 37 ℃. After 24 hours, the virus solution was replaced with fresh one and cells were infected continuously. And (5) placing the residual virus supernatant in a refrigerator at the temperature of-80 ℃, and subpackaging and storing.

4. Positive selection after infection of cells by Lentivirus

And (3) adding Puromycin to the virus carrying the gene expressing the antibiotic for screening positive clones for 5-7 days 24-48 hours after the infection is finished.

5. Identification of Stable cell lines

And collecting the total protein of the cells infected by the virus and screened, and carrying out western blot to detect the expression condition of the transcription and translation levels of the target gene in the cells so as to identify the establishment of a stable cell strain for over-expressing the exogenous gene or shRNA to silence the endogenous gene.

Western detection:

1) performing SDS electrophoresis, washing the gel by using a transfer buffer after running, washing the gel for 5min by using a shaker, twice, and wetting the filter paper by using the transfer buffer;

2) activating the PVDF membrane by using ethanol, then transferring the membrane, arranging filter paper, the PVDF membrane, glue and the filter paper from bottom to top, and driving out bubbles in the PVDF membrane, the glue and the filter paper by using a roller, wherein the membrane transferring time is 7-9 minutes;

3) the PVDF membrane was blocked with 5% skim milk, blocked on a shaker for one hour at room temperature, the interesting part of the PVDF membrane was cut into small strips, int3 (rabbit, novus,NBP1-19091) As a primary antibody (2 uL,1:2000 in 4mL milk) and incubated for one hour at room temperature;

4) pouring off milk containing primary antibody, washing with TBST solution for 5 times 5min, adding secondary antibody (goat anti-rabbit, 0.6uL in 3mL TBST, 1:5000), and incubating at room temperature for 45 min;

5) wash 5 times 5min with TBST solution, pour off all TBST solution and develop with ECL.

Construction of HUTU80 (duodenal adenocarcinoma) CRISPR-Stable knockout SAGE1 cell lines KO-1 and KO-2 1.sgRNA design

Selecting the high specificity site of the exon region as the target site, analyzing the sequence by bioinformatics, and scoring the screened site. The 2 highest scoring sites were selected as target sites and 2 sgRNA sequences were designed to be cloned into the Px330 vector plasmid (purchased from addrene).

Hum SAGE1 sg1-Up：ACCGaaggaagagtatgtcctcg(SEQ ID NO.19)

Hum SAGE1 sg1-D：AAACCGAGGACATACTCTTCCTT(SEQ ID NO.20)

Hum SAGE1 sg2-Up：ACCGaagtaaatctggttgcaac(SEQ ID NO.21)

Hum SAGE1 sg2-D：AAACGTTGCAACCAGATTTACTT(SEQ ID NO.22)

2. Transfection and cell pool establishment/sequencing validation

The transfection reagent is preheated at 37 ℃ for 10-20 min. The DNA-transfection reagent mixture was added to hutu80 cells (step as described above) and placed in an incubator for culture. Culturing for 2-3 days after transfection, diluting, centrifuging more than 1000 transfected cells, removing supernatant, extracting DNA and detecting by PCR. And (3) purifying the target gene, sequencing, and comparing the detected sequence with the original sequence to confirm that the gene is knocked out.

3. Monoclonal screening and sequencing validation

And (4) waiting for the cells to grow to a certain number, digesting the cells, and counting the cells. The cells were diluted and 100. mu.l of the cell dilution was seeded in a 96-well plate. And (3) continuously adding medicine for screening after the cells adhere to the wall, screening positive clones by using a mutation detection kit when the confluence degree of the cells reaches over 70 percent, carrying out sequencing analysis on the screened positive clones, comparing sequencing results, and analyzing the gene knockout condition. And (4) selecting positive gene knockout clones, transferring the positive gene knockout clones to 48-well plates, 24-well plates, 12-well plates and 6-well plates in sequence, and carrying out amplification culture.

4. Identification of Stable cell lines

The total protein of the screened monoclonal cells is collected, and western blot is carried out to detect the expression condition of the target gene in the cells so as to identify the establishment of stable cell strains which over-express exogenous genes or shRNA silence endogenous genes (the method is as described above).

Cell proliferation experiments were performed using the RTCA xcelligene system:

1. cell suspension preparation:

1) and (4) sucking the old culture solution in the culture dish in a clean bench under aseptic conditions.

2) After washing 1-2 times with PBS, 1mL (T75 flask) of EDTA-containing trypsin solution was added to the petri dish. Covering the cover, placing in a37 deg.C incubator for 2-6min, observing the digestion condition of the cells under an inverted microscope, and stopping digestion if the cytoplasm retracts and the cells intermittently grow.

3) Gently removing the digestive juice, adding 10mL of culture medium into a culture bottle, and gently blowing the adherent cells by using a pipette repeatedly to form a cell suspension. The cell suspension was transferred to a 50mL centrifuge tube, centrifuged at 1000x rpm for 5min, the supernatant removed, fresh medium added, and the cells pipetted evenly. The cell suspension concentration is counted by a counting plate and then prepared into the cell concentration required by the experiment.

E-Plate 96 preparation:

1) 50. mu.l of the medium was added to the wells of E-Plate 96.

2) The E-Plate 96 is placed on the RTCA Station.

3) The RTCA system will automatically Scan ("Scan Plate") - > check if the contact is good (Connection OK is shown on the "Message" page).

4) The initial baseline (Background) of detection determines that the selected wells are touching normally and the Cell Index is below 0,063 for all wells.

5) The E-Plate 96 was removed and 100. mu.l of the well-mixed A549 cell suspension was added to each well so that the number of cells per well was 2500 cells/100. mu.l. After addition of the cells to E-Plate 96, there is no need to mix the cells with the original medium in the wells.

6) The E-Plate 96 was placed in a clean bench at room temperature for 30 min.

7) E-Plate 96 was placed on the RTCA Station in the incubator.

8) After the system automatically scans the "Scan Plate", Step2 was started (cell proliferation curve was measured for 120 hours).

3. Experiment Layout and data analysis

The RTCA xcelligene system automatically reads the Cell index (CI value), calculates the relative absorbance of cells based on the CI value of each group of cells on the first day, plots the relative absorbance of cells per group against culture time, and plots Cell growth curves (fig. 3A, 3B, 3C, where PLKO represents a blank control, i.e., wild-type cells a375, Hutu80, Caco2 cells were run against empty control plasmids that do not contain shRNA sequences). Proliferation experimental results show that SAGE1 knockdown or knockout significantly inhibits tumor cell proliferation in different tumor cell lines.

HUTU80-KO1 reverted SAGE1 cell sorting and soft agar colony formation experiments (shown in FIG. 3D):

HUTU80 reply SAGE cell sorting:

1. packaging lentivirus by using a 293T cell line, passaging 293T cells to 10cm dish in advance, and preparing for lentivirus packaging when the 293T cells are cultured to the density of about 50% in the 10cm dish;

2. to a 1.5mL EP tube, 800 microliters of Opti-MEM medium (gibco) was pipetted, 8ug of the target plasmid PCDH-GFP-SAGE1 (with PCDH-GFP plasmid ligated to the codon optimized SAGE1 gene synthesized in Kirgill, Nanjing), or PCDH-GFP (purchased from addge, full name pCDH1-MCS2-EF1-copGFP) was mixed with the lentiviral packaging mixture, and 10uL of Transfection Reagent (X-tremeGENE HP DNA Transfection Reagent, Roche) was added. Incubating at room temperature for 15-30 minutes, dropwise adding all the liquid in an EP tube into 10cm dish, uniformly mixing, putting into a 37-DEG carbon dioxide incubator for culturing for 6-8 hours, changing the liquid, and continuously culturing for 36-72 hours;

3. sucking out all liquid in 10cm dish by using an injector, filtering by using a 0.45 micron filter membrane, collecting a virus-containing culture medium, and storing for one week at 4 ℃ or subpackaging and freezing at-80 ℃ for later use;

4. culturing a cell line HUTU80-KO-1/CaCo2 needing virus infection in a 6-well plate until the density is 30% -50%, sucking out all culture media, adding 1ml of fresh culture medium and 1ml of virus-containing culture medium into the culture medium, adding polybrene into the culture medium to enable the final concentration to be 10-20 micrograms/ml, uniformly mixing, putting the culture medium into a 37-degree carbon dioxide incubator for culturing, changing the culture medium after 12-24 hours, observing fluorescence under a fluorescence microscope for 36-72 hours, and judging the cell infection condition;

5. digesting adherent cells from a 6-well plate by using 0.25% trypsin, centrifuging to remove the trypsin, adding 1ml of a culture medium containing 1% Penicillin/Streptomyces Solution (gibco), carrying out cell sorting by using a BD Influx flow cytometer to obtain a cell line with GFP expression, centrifuging to remove PBS, carrying out heavy suspension by using 1ml of a fresh culture medium, transferring the cell line into a new six-well plate for culture, and culturing the obtained cells for freezing storage and subsequent experiments.

Soft agar colony formation assay

1) 1.2% and 0.7% agarose were prepared, autoclaved and placed in a 55 ℃ water bath to keep it molten.

2) 2 XRPMI 1640 medium containing 20% FBS and 2 Xantibiotics was prepared and preheated at 37 ℃.

3) Pouring lower layer glue: 1.2% agarose gel was mixed with 2 Xmedium 1:1, added to 6-well plates, 3ml per well, and left at room temperature until it solidified.

4) While waiting for the lower gel to solidify, HUTU80+ PCDH-GFP, HUTU80-KO1+ PCDHGFP and HUTU80-KO1+ PCDH-GFP-SAGE1 cells were digested separately (cell line construction method described above), counted, and adjusted to a concentration of 5X 10 with serum-free medium⁴Perml, 100. mu.l of cells per well, 3 parallel wells.

5) Pouring the upper glue after the lower glue is solidified: 0.7% agarose gel was mixed with 2 Xmedium 1:1 (temperature about 40 ℃), 100. mu.l of cell suspension, i.e., 5000 cells, was added, mixed well, and added to a well plate at 3ml per well.

6)37℃5％CO₂Culture, harvest cells for about 2-3 weeks, stain with 0.1% crystal violet, count and compare 3 groups of clones formed. As shown by the results in fig. 3D, knockout SAGE1 significantly inhibited anchorage-independent growth of HUTU80 tumor cells, while expression of reverted SAGE1 significantly restored tumor cell growth.

Nude mouse duodenal cancer (HUTU80, FIG. 3E) and colorectal cancer (CaCO2, FIG. 3F) transplantation tumor experiments prove the importance of SAGE1 expression on the growth of xenograft tumors, and prove that SAGE1 knockdown can obviously inhibit the growth of xenograft tumors, and SAGE1 overexpression can obviously promote the growth of xenograft tumors.

1) Cell culture before inoculation: the cells to be inoculated are expanded and cultured (the cells expressing the foreign gene are prepared as described above):

hutu80 group: hutu80-KO1 (i.e., the CRISPR-stable knockout SAGE1 cell line KO-1 in this example), Hutu80-KO1-SAGE1 (i.e., the cell line reverting to wild-type SAGE1 expression in example 9);

caco2 group: caco2 (i.e., the lentiviral knockdown Caco2 cell line for SAGE1 in this example, targeted at sh-1 for SAGE), Caco2-SAGE1 (i.e., the cell line in Caco-sh-1 that reverts to wild-type SAGE1 expression);

the cells in the logarithmic growth phase were digested, counted, resuspended in 1XPBS and adjusted to a final concentration of 1XP 10⁸The cells were placed on ice for inoculation into nude mice.

2) Subcutaneous inoculation: operating in a sterile environment, resuspending the cells well and mixing them, the injection dose is 100. mu.l/cell, i.e. 1X10⁷Cell/cell. The same nude mice were inoculated subcutaneously in the anterior axilla, 6 nude mice per group.

3) And (3) observing the tumor formation condition of the nude mice: the date of the tumor appearance of each nude mouse was recorded by observation, and once the tumor formation was found, the size of the tumor was measured every other day with a vernier caliper to observe the nude mice for the presence or absence of cachexia.

4) Sacrifice of nude mice and isolation treatment of tumor: after 23 days, all nude mice were sacrificed by cervical spondylolysis, pathologically dissected, tumors from each nude mouse were completely isolated, weighed, recorded and photographed. Tumors were soaked in formalin and fixed overnight.

Example 4

Tumor injection treatment was performed with adenovirus shRNA specifically for SAGE1 gene knockdown against the SAGE1 positive liver cancer tumor PDX model (HCC15, FIG. 4A), SAGE1 positive poorly differentiated non-small cell epithelial derived lung cancer PDX tumor model (Lu1030, FIG. 4B), and SAGE1 negative liver cancer tumor PDX model (HCC7, FIG. 4C), respectively. The results show that the injection of shRNA adenovirus against SAGE1 has strong therapeutic effect of inhibiting tumor growth for SAGE1 positive tumors, the injection of shRNA adenovirus against SAGE1 has no therapeutic effect of inhibiting tumor growth for SAGE1 negative tumors, and SAGE1 is a very specific therapeutic target.

The consumables used were as follows: RPMI1640 cell culture medium (GBICO), penicillin + streptomycin 100 × (GBICO), PBS (HYCLONE), SAGE-1 monoclonal antibody, Ki67 monoclonal antibody, BALB/C nude mouse, male, 4-6 weeks old.

PDX operation steps:

1) the tumors were stripped from the nude mice under sterile conditions, washed in PBS

2) Transferring the tumor to RPMI1640 cell culture medium (adding double antibody), and removing envelope, blood vessel and necrotic tissue

3) Shearing the tumor into small pieces with diameter of about 3mm, transferring into new RPMI1640 cell culture medium (adding double antibody)

4) Clamping the small tissue blocks with forceps, and placing into a puncture trocar

5) Disinfecting the skin of the chest and abdomen of the nude mouse with alcohol, and cutting a 3-5 mm incision at the manubrium of the chest with scissors to a depth of subcutaneous part

6) Using a puncture needle, the tumor tissue is inoculated subcutaneously near the inguinal region of the abdomen by entering from the incision

7) Sealing wound with tissue glue, and placing back into cage box for continuous breeding

8) Observing every other day until the tumor grows to about 5mm in diameter, and giving treatment

9) Control adenovirus and SAGE-1shRNA adenovirus (control adenovirus and SAGE-1shRNA adenovirus produced by Shanghai and Yuan organisms using adenovirus-generating packaging vector, see Table 6 for the sequence of SAGE 1) were diluted in PBS, 5X 108CFU/100ul, injected intratumorally, and injected once every 1-2 days

10) Tumor volume was measured every 2 days using a vernier caliper and the experiment was terminated by the time tumor growth reached the ethical end point (maximum diameter 1.5cm)

11) Nude mice were sacrificed by the marrow-cutting method, tumors were peeled from the nude mice subcutaneously, photographed and weighed

12) A part of the tissue is fixed in formalin, and a part of the tissue is put in liquid nitrogen for quick freezing and is used for subsequent analysis.

The IHC operation steps are as follows:

1) paraffin embedding, anti-dropping film making, 4um slice thickness

2) Baking the slices in a thermostat at 60 ℃ for 30 minutes

3) Dewaxing and hydrating: 1) soaking the slices in xylene for 10 minutes, and then soaking for 10 minutes after replacing the xylene; 2) soaking in absolute ethyl alcohol for 5 minutes; 3) soaking in 95% ethanol for 5 min; 4) soaking in 70% ethanol for 5min

4) Washing with PBS for 5 minutes for 2-3 times; 3% H2O2 (80% methanol) was added dropwise to TMA, and the mixture was allowed to stand at room temperature for 10 minutes; PBS washing for 5 minutes for 2-3 times

5) Sodium citrate antigen retrieval

6) Immunohistochemical staining: washing with PBS for 5 minutes for 2-3 times; normal goat serum confining liquid is added dropwise, and the temperature is 20 minutes. And throwing off the redundant liquid. Dripping 50 mul of primary antibody at 4 ℃ overnight; rewarming at 37 ℃ for 45 minutes

7) PBS wash 3 times for 5 minutes each

8) Dripping 40-50 mu l of second antibody for 1 hour at 37 DEG C

9) PBS wash 3 times for 5 minutes each

10) DAB color development for 5-10 minutes

11) Rinsing with PBS or tap water for 10min

12) Counterstaining with hematoxylin for 2 min, and differentiation with hydrochloric acid and ethanol

13) Washing with tap water for 10-15 minutes

14) Dehydrating, transparentizing, sealing, microscopic examination and taking a picture.

Example 5

Specific antibody co-immunoprecipitation experiments against SAGE1 were performed in various tumor cell lines HUTU80 (duodenal adenocarcinoma), U2OS (osteosarcoma), K562 (chronic myelogenous leukemia cell), KYSE30 (human esophageal squamous carcinoma cell) that specifically express SAGE1, SAGE1 was found to specifically bind to INTS3 protein in midtumor by silver staining gel analysis and mass spectrometry (INIP tightly bound to INTS3 and hssb1/2 were identified by mass spectrometry), and the specific result of silver staining gel analysis is shown in FIG. 5A, wherein IP-Rb-IgG represents that the endogenous co-immunoprecipitation experiment was performed with IgG rabbit Antibody without specific affinity as a control, IP-SAGE1 represents that the endogenous co-immunoprecipitation experiment was performed with rabbit Antibody specifically binding to SAGE1 (novus, NBP1-84355SAGE1 Antibody) as a sample group, and the mass spectrometry results are shown in FIG. 5B, wherein control is IgG and each tumor cell line has three replicates. The results demonstrate that SAGE1 and INTS3 have specific endogenous interactions in all experimental group samples. Further IP-WB was performed with antibodies specific for SAGE1 and INTS3, respectively, verifying the presence of interaction between SAGE1 and INTS3 (fig. 5C).

Endogenous IP was performed against INTS3 protein in 293T cells normally without SAGE1 expression (human renal epithelial cell line), the experimental protocol was as described above, and the results show that in cell lines normally without SAGE1, INTS3 bound to INTS6 and other INTS proteins, present in the integrator complex, consistent with previous scientific reports (fig. 5F). Taken together, the above results indicate that in SAGE1 negative cells, INTS3 binds to INTS6 to form the integrator complex, and SAGE1-INTS3 complex is absent. And when SAGE1 appears to express, in the positive cells, INTS3 and SAGE1 are combined to form INTS3-SAGE1 complex.

1) Washing HUTU80/293T cells collected from 10cm dish with PBS for 2 times, adding 0.5mL IP lysine buffer, and crushing on a non-contact ultrasonic crusher for 25 cycles, performing ultrasonic treatment for 5s and stopping for 5s, wherein the power mode is High;

IP lysis buffer：

20mM Tris.HCl(pH 7.4)

150mM NaCl

10％Glycerol

0.5％TritonX-100

1mM EDTA

1mM EGTA

2) placing the crushed liquid after ultrasonic treatment into a freezing table type centrifuge, centrifuging for 15min at 14000rpm, taking supernatant after centrifugation, and removing precipitate;

3) the supernatant was divided into two EP tubes, 250uL each, and 5uL of sage1 rabbit antibody (NOVUS, NBP-84355, 0.5mg/mL) and 2uL of igg rabbit antibody (1.4mg/mL) were added to the supernatant separately and placed in a 4-degree suspension overnight;

4) respectively adding 10-20uL of protein G beads balanced by using an IP lysine buffer into the two tubes, placing the mixture in suspension at 4 ℃ for 1 hour, taking out the mixture, placing the EP tube on a magnetic frame, standing the mixture for about 30 seconds, carefully sucking out the supernatant by using a 1mL gun head after the beads are all adsorbed on the wall of the EP tube, adding 1mL buffer again, placing the mixture in a 4-degree suspension instrument for suspension for 5 minutes, and repeating the process for 3 times;

all supernatants were blotted dry, 60uL of Elute buffer (0.2M Glycine, 0.1% NP40, pH2.2) was added to each tube, left on ice for 10min and aspirated, added to an EP tube containing 20uL of Tris buffer (1M TRIS pH8.0), blown up with a gun, 10-20uL was used for silver-stained gel identification, 10uL was used for WB detection of SAGE1 and INTS3, and the remainder was sent to mass spectrometry for identification.

Endogenous IP-WB was also performed in several of the above tumor cell lines with antibodies specific for INTS3 (Novus, NBP1-19091, INTS3 Antibody), confirming that intracellular SAGE1 functions specifically to INTS3 (FIG. 5C).

Specific experiments for WB detection of endogenous IP samples:

western detection:

3) sealing the PVDF membrane by 5% skimmed milk, sealing for one hour at room temperature on a shaker, cutting the interested part on the PVDF membrane into small strips, adding int3 (rabbit) as a primary antibody (2 uL,1:2000 is added into 4mL of milk), and incubating for one hour at room temperature;

Example 6

The protein sequences of SAGE1 and INTS6 were aligned by CLUSTALW software (https:// www.genome.jp/tools-bin/CLUSTALW), and it was found that the C-terminus of INTS6 (790-887aa) was highly identical in amino acid sequence to the C-terminus of SAGE1(817-904 aa) (FIG. 5G), indicating that the C-terminus of SAGE1 and the C-terminus of INTS6 may have the same function. Since both SAGE1 and INTS6 were able to bind INTS3, the C-termini of both proteins were thought to be responsible for binding to INTS 3.

This was further confirmed by in vitro protein complex co-purification experiments.

The in vitro purified SAGE1-INTS3 complex protein confirmed the presence of the brand new complex SAGE1-INTS3 (FIG. 5D), and the in vitro expression purified INTS6-INTS3 complex confirmed that INTS3 also interacted with INTS6 (FIG. 5E).

1) Plasmid construction: two strategies are adopted for constructing the complex co-expression plasmid, genes of int 3-C (access: Q68E01.1, 572-978aa) and SAGE1 (access: Q9NXZ1.2, 817-904aa)/INTS6 (access: Q9UL03.1, 790-887aa) can be respectively constructed into a pET28a vector (kana) and a pGEX6p1 vector for co-expression and purification.

2) Initial seed culture: positive clones were picked up in 10mL of liquid LB medium containing Amp antibiotics and cultured with shaking overnight at 37 ℃.

3) And (3) amplification culture: inoculating the initial seed into 1L liquid culture medium containing antibiotic, performing shake culture at 37 deg.C until the bacterial concentration OD600 is 0.6-0.8, and cooling to 15 deg.C or 20 deg.C; one hour later, IPTG was added to a final concentration of 0.6mM and expression was induced overnight.

4) And (3) collecting thalli: centrifuging at 4200rpm at 4 deg.C for 15min, discarding supernatant, and collecting thallus; adding a heavy suspension solution (25mM Tris-HCl pH8.0, 100mM NaCl) to suspend the somatic cells; the protease inhibitor PMSF (phenyl sulfonyl fluoride, benzoate sulfonyl fluoride) was added to a final concentration of 2mM before cell disruption.

5) Cell disruption by ultrasonication: at 400W, the ultrasonic wave is carried out for 3s at intervals of 6s, and the work is carried out for 60 times.

6) Ultracentrifugation: the cell lysate was centrifuged at 14000rpm at 4 ℃ for 50min, and the supernatant was collected and subjected to the next separation and purification.

7) Ni-NTA affinity chromatography: the supernatant was poured into a Ni-NTA column. After washing, 10 column volumes were washed with wash buffer (25mM Tris-HCl pH8.0, 100mM NaCl, 15mM imidazole) to remove contaminating proteins; finally, the target protein was eluted using an elution buffer (25mM Tris-HCl pH8.0, 100mM NaCl, 250mM imidazole). The solubility of the protein, the efficiency of the hanging column and the concentration of the protein were examined by SDS-PAGE. In order to obtain a purer protein without a label, after the wash buffer is used for washing and removing the foreign protein, 5ml of a heavy suspension buffer is added into each nickel column, then 100-.

8) And (3) anion exchange chromatography purification: first, the ion exchange column is equilibrated. The protein eluted in the previous step was then diluted 4-6 times with solution A (25mM Tris-HCl, pH8.0), loaded onto ion exchange column Source Q, and eluted using a linear gradient of solution A with solution B (25mM Tris-HCl, pH8.0, 1M NaCl). The collection tubes were collected near each peak position (absorbance at 280 nm). And performing SDS-PAGE electrophoresis to detect the position, purity and concentration of the peak of the target protein.

9) And (3) ultrafiltration concentration: the eluate containing the target protein was concentrated to 2ml with an ultrafiltration cup.

10) And (3) purifying by molecular sieve column chromatography: the sample was injected onto a gel filtration chromatography column Superdex 200 which had been equilibrated with solution C (10mM Tris-HCl, pH8.0, 100mM NaCl). Elution was performed with solution C. The location of the outward peak is related to the size and shape of the protein. And collecting protein peaks, performing SDS-PAGE electrophoresis, and detecting the purity and the properties of the protein. All protein purification steps were performed at 4 ℃. Finally, the relatively pure protein with the concentration of about 5-10mg/ml is quickly frozen by liquid nitrogen, subpackaged and stored in a refrigerator at minus 80 ℃.

Since INTS3 interacts with both INTS6 and SAGE1 to form a complex and INTS6 interacts with SAGE1 to a high degree of similarity in C-terminal amino acids, it is possible that these two complexes interact exclusively competitively, i.e., INTS3 inhibits the presence of INTS3-INTS6 if it interacts with SAGE1 and reduces the presence of INTS3-SAGE1 if INTS6 is overexpressed.

Competition experiments in vivo and in vitro were performed for three proteins, SAGE1, INTS3, and INTS6, respectively. As shown in FIG. 5H, co-immunoprecipitation experiments against antibodies specific to the INTS3 protein were performed separately in 293T cell lines in the absence of SAGE1 and in 293T cell lines over-expressing SAGE1 (cell line construction methods described previously), 3 replicates per group were performed, and the final product was detected by mass spectrometry. The results show that in the absence of SAGE1, INTS3 binds to INTS6 to form a complex; in the presence of SAGE1 in cells, INTS3 bound SAGE1 to form the INTS3-SAGE1 complex, competing to inhibit the formation of INTS3-INTS 6.

Competition between SAGE1 and INTS6 for binding to INTS3 was further confirmed by in vitro protein complex competition formation experiments, and the results are shown in FIG. 5I. The GST-SAGE1(817-904aa, purification method as described above) protein obtained by purification, 1:1 was added purified INTS3-INTS6 complex protein (no GST tag, purification method as described previously). After incubation for 1 hour at 4 ℃ after mixing, affinity purification is carried out by GST magnetic beads, and the final product is subjected to SDS-PAGE gel detection, and SAGE1 competes for INTS6 and binds to INTS3 to form an SAGE1-INTS3 complex.

SAGE1-INTS3 compound crystal structure analysis results are shown in FIG. 5J, and key amino acids of the compound interaction are found out by the following specific method:

the structure of the complex is analyzed by crystallography, and the key amino acids (F838, F873, K874, R872, M832 and Q840) formed by the SAGE1-INTS3 complex are found by the structural analysis, and the specific results are shown in tables 7, 8 and 9, wherein the table 7 is the crystal parameter analysis result, the table 8 is the amino acid site of the interaction between the INTS3 dimer, and the table 9 is the amino acid site of the interaction between the INTS3 dimer and SAGE 1.

TABLE 7

Values in parentheses refer to the highest resolution shell.

R factor＝Σ||F(obs)-F(calc)||/Σ|F(obs)|.

Rfree＝R factor calculated using 5.0％of the reflection data randomly chosen and omitted from the start of refinement.

TABLE 8

TABLE 9

Example 7

Mutant SAGE1(F838A, F873A, K874A, R872A, M832A, Q840A) was designed according to the crystal structure for key interacting amino acids between SAGE1 and INTS3, and the effectiveness of the mutant in losing the binding ability of INTS3 was demonstrated by determining the binding constant of wild type SAGE1 to mutant SAGE1 and INTS3 by in vitro ITC (isothermal titration calorimetry), respectively (FIGS. 6A and 6B).

1. The INTS3 (Access: Q68E01.1, 568aa-981aa) protein, SAGE1 (Access: Q9NXZ1.2, 815aa-905aa), SAGE1mutant (Access: Q9NXZ1.2, 815aa-905aa, F838A, F873A, K874A, R872A, M832A, Q840A) were expressed recombinantly in vitro in E.coli BL21DE 3. The recombinant protein expression vector uses a commercial PET28A plasmid, and the protein expression and purification process is carried out according to the conventional expression and purification steps (refer to molecular cloning experimental guidelines (third edition)).

2. The instrument ITC200 device is opened, the wash tool is inserted into the sample cell to form a closed flow path, and the injection needle is assembled. And cleaning the sample pool and the injection needle.

3. The sample, buffer (2mL), ultrapure water (2mL)500 and 600mmHg were degassed for 10 min.

4. Sample application

1) The sample cell was rinsed 2 times with 300. mu.L of degassed ultrapure water,

2) a300. mu.L aliquot of INTS3 protein was aspirated and the syringe wall flicked to expel air bubbles (note: effective volume was 190. mu.L, but the addition volume was less than 300. mu.L, the apparatus was unstable)

3) The syringe was inserted into the cuvette (left hole), gently touched to the bottom, lifted by about 1mm, and slowly pushed into the needle (50. mu.L)

4) The empty injection needle is screwed into the black handle and placed on the instrument (the handle is slightly deviated from the right measuring range, and is placed in the groove, and then the needle is forced downwards, rotated left and clamped in the groove)

5) Calibrating the range of the injection needle (52 μ L), observing the black point in the handle moving up and down, and finally returning to the fixed part

6) Taking out the injection needle, firstly rinsing for 2 times by using buffer, removing bubbles, and absorbing samples SAGE1/SAGE1-mutant50 mu L

7) The injection needle is screwed into the black handle and placed on the instrument.

5. Setting parameters, selecting the Incremental Titration and clicking 'Insert':

1) the time interval between two titrations is set, typically 120(s)

2) Sample single injection volume: 2(μ L)

3) Total number of injections: 25

4) Click "OK"

6. Set the Syring Concentration (Concentration of liquid in Syringe), Cell Concentration (Concentration of sample in Cell)

Clicking a triangular blue key behind the Stimng Rate option, clicking a triangular green key at the uppermost part, storing data to a corresponding position, sucking out a sample after the experiment is finished, and cleaning the instrument according to the step of cleaning the instrument when the experiment is started. After the experiment is finished, the data analysis shows that the binding constant of wild type SAGE1 and INTS3 is 39nM (FIG. 6A), and SAGE1mutant and INTS3 are not bound any more after the mutation of key amino acid (FIG. 6B). The effectiveness of the tightly bound and resolved crystal structure of the new complex SAGE1-INTS3 was well documented.

Example 8

The inability of SAGE1mutant to bind INTS3 was confirmed by CO-IP experiments in 293T cells (FIG. 6C) as follows:

the key amino acids of site-directed mutations (F838A, F873A, K874A, R872A, M832A and Q840A) were verified by 293T cell Co-IP experiments to be able to interrupt the binding between the INTS3-SAGE1 complex, as shown in FIG. 6C, the upper part of the picture + and-represents the loading scheme in the runway, + represents the addition of the protein, -represents the non-addition of the protein, INTS3 represents the wild-type INTS3 protein, SAGE1 represents the wild-type SAGE1 protein, SAGE1-C-del represents the wild-type SAGE1 protein with 100 amino acid residues deleted from the C-terminal, and SAGE1-mu represents mutant SAGE1 (F46838, F873, K874A, R A, M58832 23, Q840A). The specific method comprises the following steps:

1. 293T cells transfected with the flag-SAGE 1/flag-SAGAEmutant and strep-INTS3 plasmids, respectively, were seeded in 3X 10cm dishes.

2. Washing the cells with ice-cold 1XPBS 2-3 times, and adding 0.67ml of 1xlysis buffer solution into each 10cm culture dish; the plates were frozen for 5min, and then the cells were resuspended in 2ml EP tubes (total 2ml cell lysate).

3. Centrifuging at 13000rpm for 10 minutes at 4C 5, collecting the supernatant; each sample was divided into three portions: a. as a comparison input; b. (negative ctrl: none, addition of Potein G beads); (add primary antibody 2g, add Potein A beads).

4. Mix overnight at 4 ℃.

5. Washing/equilibrating beads in lysis buffer: 38ul of Potein G beads were added to a 1.5ml EP tube, 750ul of lysis buffer was added to the tube, vortexed, centrifuged at 8200G for 30s, and 50ul of lysis buffer was added to resuspend.

6. For samples-b and-C, washed protein a beads were added and mixed at 4C for 2 hours.

7. Centrifuge at 3000rpm for 2 minutes, wash beads 2 times with 1 × lysis buffer, take 15ul for WB blot. The remainder was centrifuged at 3000rpm for 2 minutes to remove the suspension.

8. For samples b and c, elution buffer was added and samples were taken for WB validation.

Example 9

In intestinal cancer tumor cells (CaCO2) with knockout of SAGE1 (i.e., the lentiviral knockout Caco2 cell line for SAGE1 in example 3, targeting SAGE1 and Caco2-sh-1), the recovery experiments of wild-type SAGE1 and SAGE-mutat carrying amino acid mutations critical for interaction with INTS3 were performed, respectively, and data show that recovery of wild-type SAGE1 significantly promotes the proliferation of cancer cells, while recovery of SAGE1 mutants unable to interact with INTS3 loses the function of promoting the proliferation of tumor cells (FIG. 6D).

Wild type SAGE1 and SAGE-mutant with amino acid mutation critical to interaction with INTS3 were respectively performed in esophageal cancer tumor cells with reduced SAGE1 (TE1, cell line construction method with reduced SAGE1 referring to Caco2 cell line experiment method with reduced lentivirus of SAGE1 in example 3), and data show that the restored wild type SAGE1 can remarkably promote the proliferation of cancer cells, while the restored SAGE1mutant which cannot interact with INTS3 loses the function of promoting the proliferation of tumor cells (FIG. 6E).

In a duodenum tumor cell (HUTU80-KO1) with SAGE1 knocked out (namely CRISPR stable knockout SAGE1 cell line KO-1 in example 3), constructing wild type SAGE1 and a recovery cell line of SAGE-mutant carrying amino acid mutation critical for interaction with INTS3 (referring to the experimental operation of constructing HUTU80 recovery SAGE cell line in example 3) respectively shows that the recovery wild type SAGE1 can remarkably promote the proliferation of cancer cells, and the recovery of SAGE1mutant which cannot interact with INTS3 loses the function of promoting the proliferation of tumor cells (FIG. 6E).

Screening to obtain stable over-expression cell lines was performed as follows, followed by cell proliferation experiments performed in the same manner as SAGE1 knockdown in tumor cells.

2. the resulting mixture was pipetted into a 1.5mL EP tube with 800. mu.l of Opti-MEM medium (gibco), to which was added 8ug of the target plasmid PCDH-GFP-SAGE1 (synthesized codon-optimized SAGE1 from Nanjing Kimura ligated into pCDH-MCS2-EF1-copGFP vector), PCDH-GFP-SAGE-mutant (synthesized codon-optimized SAGE1mutant gene from Nanjing Kimura was ligated into pCDH-MCS2-EF1-copGFP vector containing the mutation F838A, F873A, K874A, R872A, M832A, Q840A), PCDH-GFP (purchased from addge, pCDH-MCS2-EF1-copGFP), lentiviral packaging solution, mixed, and 10uL of Transfection Reagent (X-emefectFeHP DNA Transfection Reagent HP, Rodgeon, RopgFP). Incubating at room temperature for 15-30 minutes, dropwise adding all the liquid in an EP tube into 10cm dish, uniformly mixing, putting into a 37-DEG carbon dioxide incubator for culturing for 6-8 hours, changing the liquid, and continuously culturing for 36-72 hours;

4. culturing a cell line needing virus infection in a 6-well plate until the density is 30-50%, sucking out all culture media, adding 1ml of fresh culture medium and 1ml of culture medium containing virus, adding polybrene to enable the final concentration to be 10-20 micrograms/ml, uniformly mixing, putting into a 37-DEG carbon dioxide incubator for culturing, changing the culture solution after 12-24 hours, observing fluorescence under a fluorescence microscope for 36-72 hours, and judging the cell infection condition;

Example 10

FIG. 6G/H Using a nude mouse colorectal cancer transplant tumor, wild type duodenal cancer cells (Hutu80), SAGE1 knockout duodenal cancer cells (Hutu80-KO1), and SAGE-mutant reverted to wild type SAGE1 and SAGE-mutant reverted to carry a mutation of an amino acid critical for interaction with INTS3, respectively, were transplanted (the two cells were constructed as described in example 9). Experiments have shown that disruption of the formation of the INTS3-SAGE1 complex significantly inhibits the growth of xenograft tumors. The experiments prove that SAGE1-INTS3, a newly discovered complex, can be used as a target for inhibiting the growth of tumor cells, and the damage of the interaction of the complex can obviously inhibit the growth of the tumor cells in vivo. The specific method comprises the following steps:

hutu80, HUTU80-KO1, HUTU80-KO1-SAGE1 (reverting to express wild-type SAGE1 protein), HUTU80-KO1-SAGE1-c-del (reverting to express SAGE1 truncation 1aa-806aa, the construction method refers to HUTU80-KO1-SAGE1, only the reverted expressed protein fragment is different), HUTU80-KO1-SAGE1mutant (reverting to express SAGE1mutant protein, F838A, F873A, K874A, R A, M36832, Q840A, the construction method refers to HUTU A-KO A-SAGE A, only the reverted expressed protein fragment is different).

Example 11

Collecting a cell line (the construction method is as described above) which is stably interfered and knocked down with INTS3 in HUTU80 and a cell line of a control group thereof, and then sending the collected cell line to Annuuda company for RNAseq sequencing to find out a significant change gene caused by knocking down INTS 3; after collecting a cell line (the construction method is as described above) stably knocking SAGE1 in HUTU80 and a cell line of a control group thereof, sending the cell line to Annuuda for RNAseq sequencing to find out a significantly-changed gene caused by knocking SAGE1 out; the specific process is that for RNA-seq data, the FastQC software is used for carrying out quality control on the RNA-seq data, the Trimmomatic software is used for removing a linker sequence and a low-quality sequence, the Hisat2 software is used for positioning the reserved reads to a human reference genome, the software featureCounts is used for obtaining the original expression quantity of genes according to the gene annotation of an Ensembl website, and finally the R software package DESeq2 is used for finding the differentially expressed genes and the differential multiples thereof. Comparison of differential expression of genes among each other after high expression of SAGE1 or INTS3 is shown by scatter plot (FIG. 6I). As shown in the figure, the reduction of SAGE1 expression level is consistent with the change of the significantly different gene caused by the reduction of INTS3 expression level, namely, the up-regulated gene in the significantly different gene of SAGE1 is also up-regulated in the significantly different gene of INTS3, the down-regulated gene in the significantly different gene of SAGE1 is also down-regulated in the significantly different gene of INTS3, which indicates that SAGE1 changes the expression of the tumor-related gene through the regulation and control of a complex formed by the SAGE1 and the INTS3, and the INTS3 and SAGE1 in the complex are in positive synergy relationship and should act as a whole.

To verify that disruption of the interaction between INTS3-SAGE1 completely abolished the mechanism of the RNAseq-significant change differential gene enrichment of SAGE1 promoting tumor cell growth, we analyzed related signaling pathways of RNAseq-significant change in reversion to wild-type SAGE1 in CaCO2 knocked down SAGE1 in example 9 (figure 6J), and RNAseq-significant change differential gene enrichment of reversion mutant SAGE1 in CaCO2 knocked down SAGE1 (mutated several key amino acids, unable to bind to INTS3) (figure 6K), respectively. The specific operation is as follows: for RNA-seq data, the quality control is carried out by using software FastQC, the adaptor sequence and the low-quality sequence in the RNA-seq data are removed by using software Trimmomatic, the reserved reading segment is positioned to a human reference genome by using software Hisat2, the original expression quantity of the gene is obtained by using software featureCounts according to the gene annotation of an Ensembl website, and finally the differentially expressed gene and the differential multiple thereof are found by using an R software package DESeq 2. The KEGG pathway enriched by the differentially expressed genes was obtained by clusterirprofiler, software package R. According to the results, the over-expression of wild-type SAGE1 can significantly up-regulate many tumor growth-related pathways, such as proteosomes, cell cycles, DNA replication, pathway in cancer, and the like, which are important cancer promotion pathways. Whereas mutant proteins reverting to SAGE1 which were unable to bind INTS3 significantly different gene enrichment pathways were not enriched to these pathways. This difference in signaling pathway changes was consistent with the differences in the cell experiments in example 9, indicating that SAGE1 appears in cells and significantly promotes tumor cell growth only by binding to INTS3 to form the SAGE1-INTS3 complex.

In conclusion, the present invention effectively overcomes various disadvantages of the prior art and has high industrial utilization value.

The foregoing embodiments are merely illustrative of the principles and utilities of the present invention and are not intended to limit the invention. Any person skilled in the art can modify or change the above-mentioned embodiments without departing from the spirit and scope of the present invention. Accordingly, it is intended that all equivalent modifications or changes which can be made by those skilled in the art without departing from the spirit and technical spirit of the present invention be covered by the claims of the present invention.

Sequence listing

<110> Shanghai university of traffic medical college affiliated ninth people hospital

<120> use of substance for modulating SAGE1-INTS3 complex expression and/or function

<160> 26

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gtcccacagg gcttattaa 19

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tggtatttca tgcagaagt 19

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gttccacctg gttgtatta 19

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gctggaattt catccacgat t 21

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ctgctgccta tgtgtttaca a 21

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ccaaggagaa acaaggacat a 21

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gctgcctatg tgtttacaaa t 21

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cccagactga taaggtcata t 21

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cccaaactga taaggtcata t 21

<210> 10

<211> 97

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tgctgttgac agtgagcgcg gtcccacagg gcttattaat tagtgaagcc acagatgtaa 60

ttaataagcc ctgtgggacc atgcctactg cctcgga 97

<210> 11

<211> 97

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tgctgttgac agtgagcgac tggtatttca tgcagaagta tagtgaagcc acagatgtat 60

acttctgcat gaaataccag ctgcctactg cctcgga 97

<210> 12

<211> 97

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tgctgttgac agtgagcgag gttccacctg gttgtattaa tagtgaagcc acagatgtat 60

taatacaacc aggtggaacc gtgcctactg cctcgga 97

<210> 13

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ccgggctgga atttcatcca cgattctcga gaatcgtgga tgaaattcca gctttttg 58

<210> 14

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ccggctgctg cctatgtgtt tacaactcga gttgtaaaca cataggcagc agtttttg 58

<210> 15

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ccggccaagg agaaacaagg acatactcga gtatgtcctt gtttctcctt ggtttttg 58

<210> 16

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ccgggctgcc tatgtgttta caaatctcga gatttgtaaa cacataggca gctttttg 58

<210> 17

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ccggcccaga ctgataaggt catatctcga gatatgacct tatcagtctg ggtttttg 58

<210> 18

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ccggcccaaa ctgataaggt catatctcga gatatgacct tatcagtctg ggtttttg 58

<210> 19

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

accgaaggaa gagtatgtcc tcg 23

<210> 20

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

aaaccgagga catactcttc ctt 23

<210> 21

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

accgaagtaa atctggttgc aac 23

<210> 22

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

aaacgttgca accagattta ctt 23

<210> 23

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

ggaagagtat gtcctcgtgg tt 22

<210> 24

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

gcatcaggcc atggtggag 19

<210> 25

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

atcatccctg cctctactgg 20

<210> 26

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

gtcaggtcca ccactgacac 20

Claims

1. Use of a substance for inhibiting SAGE1-INTS3 complex expression and/or function in the preparation of a medicament or kit for treating a tumor, wherein the tumor is SAGE1 positive.

2. The use according to claim 1, wherein the agent for inhibiting the expression and/or function of SAGE1-INTS3 complex is a single active ingredient.

3. The use according to claim 1, wherein the substance for inhibiting the expression and/or function of SAGE1-INTS3 complex is selected from a nucleic acid molecule, a protein molecule or a compound.

4. The use according to claim 1, wherein the substance for inhibiting the expression and/or function of SAGE1-INTS3 complex is selected from SAGE1 inhibitors.

5. The use of claim 4, wherein said SAGE1 inhibitor is selected from the group consisting of agents used to knock out or knock down SAGE1 expression.

6. The use of claim 4, wherein said SAGE1 inhibitor is selected from the group consisting of interfering RNA for SAGE1, antisense oligonucleotides for SAGE 1.

7. The use of claim 4, wherein the SAGE1 inhibitor is selected from a substance that competes with SAGE1 for binding to INTS 3;

and/or, said SAGE1 inhibitor is selected from INTS6, INTS 6L.

8. The use according to claim 1, wherein the tumour is selected from a solid tumour or a haematological tumour.

9. The use according to claim 8, wherein the tumor is selected from the group consisting of intestinal cancer, lung cancer, liver cancer, breast cancer, esophageal cancer, head and neck cancer, skin cancer, kidney cancer, leukemia.

10. The use of claim 8, wherein the tumor is selected from the group consisting of colon cancer, hepatocellular carcinoma, ovarian serous cystadenocarcinoma, endometrial carcinoma, thyroid carcinoma, cutaneous melanoma, lung adenocarcinoma, head and neck squamous cell carcinoma, glioblastoma multiforme, prostate cancer, thymus carcinoma, brain low-grade glioma, rectal adenocarcinoma, pheochromocytoma and paraganglioma, esophageal carcinoma, renal clear cell carcinoma, cervical squamous carcinoma and adenocarcinoma, urinary bladder urothelial carcinoma, renal papillary cell carcinoma, pancreatic carcinoma, gastric carcinoma, renal chromophobe carcinoma, breast infiltrating carcinoma, lung squamous carcinoma, sarcoma, acute myeloid leukemia.