KR102125005B1 - Novel use of 53bp1 - Google Patents

Abstract

The present invention relates to the anti-cancer use of the 53BP1 gene or protein and the anti-cancer adjuvant use of the 53BP1 point mutant, has an effect of inducing cell death sensitively in p53 mutant cancer cells as well as general solid cancer, and is treated with a conventional anti-cancer agent. In this case, since the anticancer effect can be significantly improved, it can be usefully used in the treatment of cancer.

Description

New use of 53BP1{NOVEL USE OF 53BP1}

The present invention relates to the anti-cancer use of the 53BP1 gene or protein and the use of the 53BP1 point mutant as an anti-cancer adjuvant.

Gene stability is maintained by chromosomal stability by various factors in the cell, which protects the human body from various diseases that can be caused by chromosome destabilization. In particular, abnormalities in the number or structure of centroids are known as one of the factors that induce gene instability, and it is well known that abnormalities in the number and structure of centroids in diseases such as cancer and ciliary diseases (Nigg and Raff, Cell 139 (2009) 663-638 ). The central body is the center that controls the microtubule and is involved in the formation of spindle or ciliary cells during cell division. It is composed of two central bodies, and the central body is also replicated in the DNA replicator, so that the parent and daughter center bodies are paired and divided together with cell division (Nigg, Trends Cell Biol 17 (2007) 215-221 ). In the presence of such processes as oversubstitution of the central body, failure of cell division, and intercellular fusion, an excess of the central body exists in one cell (Ganem et al., Nature 460 (2009) 278-282; Godinho and Pellman, Philos Trans R Soc Lond B Biol Sci 369 (2014) 20130467). The presence of excess centroids or centrisomes causes cell division to be suppressed due to the formation of multiple poles of excess spindles rather than the formation of a bipolar spindle in the cell division, and cell division is suppressed or death through mitotic catastrophe have. However, in the case of cancer cells, the surplus centroid is aggregated as an anode to survive, thereby surviving through the formation of a pseudo double spindle, in which case genetic instability is caused. Therefore, the excessive central body is a phenomenon observed in cancer and ciliary diseases, and acts as a cause of cancer cell development through the induction of genetic instability of cells. Indeed, it is well known that hypercentroids exist in almost all carcinomas such as breast cancer, prostate cancer, colon cancer, lung cancer, and liver cancer (Zyss and Gergely, Trends in Cell Biol 19 (2009) 334-346). Therefore, the development of drug for the treatment of diseases through the removal of excess center-forming cells, which causes genetic instability, has become an important issue in the treatment of next-generation anti-cancer and ciliary diseases. Recently, a compound based on taxol or griseofulvin has been studied as a candidate group for drug development to remove abnormal center-forming cancer cells (Godinho and Pellman, Philos Trans R Soc Lond B Biol Sci 369 (2014) ) 20130467) So far, it has not been able to produce clear results.

p53-binding protein 1 (53BP1) was first discovered as a protein that binds p53 (Iwabuchi et al., Proc Natl Acad Sci USA 91 (1994) 6098-6102). 53BP1 is a protein that has structurally 1972 amino acids and has a BRCT domain, which is a domain in the BRCA gene, and functions as an intermediate mediator that functionally transmits DNA damage repair signals (Wang et al, Science 298 (2002) ) 1435-1438). Recently, it has been revealed that it is a factor determining the pathway of DNA damage repair, and the importance of 53BP1 in repairing cell damage has been highlighted (Panier and Boulton, Nature Rev Mol Cell Biol 15(2014); Kim and Yim, Frontiers in Bioscience, in press; 7 -18). In addition, 53BP1 is a factor that regulates cell division in the cell cycle independently of the mechanism of DNA damage, and a lot of evidence has accumulated. 53BP1 expression is increased during cell division and cell division is delayed in the absence of deficiency, which has been linked to the central control function of 53BP1 (Meitinger et al., J Cell Biol 214(2016) 155-166; Lambrus et al., J Cell Biol 214 (2016) 143-153; Yim et al, Oncogene 36 (2017) 966-978). In the case of cancer cells showing resistance to anticancer drugs, the presence of 53BP1 has been reported to increase the sensitivity of DNA-damaging anticancer drugs in cancer cells (Li et al, Plos One (2013) e74928). However, there is no mention or disclosure as to whether 53BP1 itself has anti-cancer activity.

It is an object of the present invention to provide a new use by regulating the mRNA expression of 53BP1 in the treatment of cancer is directly related to the prevention or treatment of cancer.

In addition, the present invention has an object to provide a new use by revealing that the point mutation of the 53BP1 protein is directly related to the prevention or treatment of cancer.

In addition, the present invention has an object to provide a new use of the anti-cancer adjuvant to improve, enhance or enhance the sensitivity of the 53BP1 protein mutants to anticancer agents.

The present inventors tried to develop an anti-cancer substance capable of promoting cancer cell killing activity in cancer cells and selectively inhibiting proliferation of p53 mutated cancer cells. As a result, a shRNA that suppressed the expression of 53BP1 was prepared and cancer cells using lentivirus As a result of observing the effect on its death, it confirmed the effect as a potent cancer cell death inducer, and in particular, showed a sensitive and selective killing effect against p53 mutant cancer cells, confirming that it is an excellent anti-cancer action and completing the present invention. . In addition, it was confirmed that a 53BP1 protein point mutant was produced to stably maintain protein expression, thereby improving or improving the sensitivity to anticancer agents, and the 53BP1 protein variant can enhance anticancer treatment with DNA-damaging anticancer agents. The present invention was completed by confirming that it can be usefully used in anti-cancer treatment induced drug resistance.

In this aspect, the present invention provides a pharmaceutical composition for preventing or treating cancer comprising at least one selected from the group consisting of a 53BP1 inhibitor and a 53BP1 variant protein comprising the S380 variant in the amino acid sequence of SEQ ID NO: 2.

In another aspect, the present invention provides an oligonucleotide that inhibits mRNA expression of 53BP1 by using 10 to 20 nucleotides consecutive in the nucleotide sequence shown in SEQ ID NO: 1 as a target sequence.

In another aspect, the present invention provides a recombinant vector expressing the oligonucleotide.

In another aspect, the present invention provides a composition for an anticancer adjuvant that includes, as an active ingredient, a 53BP1 mutant protein comprising the S380 mutation in the amino acid sequence of SEQ ID NO: 2 as an active ingredient, and improves, enhances, or enhances the sensitivity of the anticancer agent.

As described above, the 53BP1 expression inhibitor or 53BP1 mutant protein of the present invention can be effectively used for the treatment or prevention of cancer, and when 53BP1 mutant protein is administered together as an adjuvant or combination therapy agent for anticancer drugs, it can be used in various carcinomas. It has the effect of improving, improving or enhancing the sensitivity of the anticancer agent, and thus can be effectively used for cancer treatment.

Figures 1a and 1b is a result of confirming the selective expression according to the cell division of 53BP1 protein according to an embodiment of the present invention, 1a is the result of immunoblot analysis, 1b shows the result of observing the cell cycle through FACS analysis, Plk1 Silver cell division positive control NZ (Nocodazole) refers to a cell division inducing drug.
2A, 2B and 2C show that 53BP1 shRNA according to an embodiment of the present invention inhibits cell division in solid cancer through inhibition of 53BP1 expression, and 2a inhibits 53BP1 protein expression by 3BP1 shRNA; 2b is a positive cell measurement for each antibody detected by the p-H3 antibody and the MPM2 antibody cell division cells increased by 53BP1 shRNA; And 2c shows the results of analyzing the cell division defects increased by 53BP1 shRNA for each type.
Figure 3a, 3b and 3c is that 53BP1 shRNA according to an embodiment of the present invention confirmed the anti-cancer effect by promoting cell death in solid cancer cells by inhibiting 53BP1 expression, 3a is cancer cell selective killing effect by 53BP1 shRNA; 3b shows increased cell division by 53BP1 shRNA and increased apoptotic cells by DNA cleavage; And 3c shows the results confirming the increase in the active caspase 3 positive cells by 53BP1 shRNA.
4A, 4B, and 4C show that when 53BP1 mRNA was removed with gene scissors (CRISPR/Cas9) according to an embodiment of the present invention, cancer cell killing effects through formation of excess centers in various solid cancers were confirmed, and 4a was 53BP1 gene scissors (CRISPR /Cas9) to inhibit 53BP1 expression; 4b shows cancer cell death by DNA cleavage in cervical cancer cell line (HeLa), sarcoma cell line (U2OS), lung cancer cell line (NCI-H460) by expression of 53BP1 gene scissors (CRISPR/Cas9); 4c shows a diagram of observation of cell division disruption due to excessive centrosome formation in the cervical cancer cell line (HeLa), sarcoma cell line (U2OS), and lung cancer cell line (NCI-H460) by expression of 53BP1 gene scissors (CRISPR/Cas9). .
Figures 5a and 5b confirmed the selective and sensitive anti-cancer effect in p53 deficient solid cancer when 53BP1 mRNA was removed with gene scissors (CRISPR/Cas9) according to an embodiment of the present invention, 5a is p53 circular lung cancer cell line NCI-H460 ( the core body is formed by increasing the effect of the excessive lack in 53BP1) ^- H460 ^Ctrl) and in which the p53-deficient lung cancer cell line NCI-H460 (H460 ^p53; And 5b is that the p53-deficient lung cancer cell line NCI-H460 ((H460 ^{p53 -} The results confirmed an increase in apoptotic cells is also caused by deficiency in 53BP1).
Figures 6a, 6b and 6c is confirmed that the effect of stably expressing the 53BP1 protein containing a point mutation according to an embodiment of the present invention, 6a is a stable expression pattern of the aspart (aspart) mutant of HA-53BP1; 6b shows that aspartic mutant expression of HA-53BP1 increases gene stabilization by reducing excess centrosome formation caused by 53BP1 deficiency; And 6c shows the results confirming the pattern of reducing the apoptotic expression of HA-53BP1 aspart mutant, increased by 53BP1 deficiency.
7A, 7B and 7C are the mRNA sequences of 53BP1 of the present invention (Gene accession no. AF078776). The yellow shaded area represents the coding region of the entire mRNA sequence.
8 is the amino acid sequence of the 53BP1 protein of the present invention.
9A, 9B, 9C, and 9D are cDNA sequences used in the preparation of the 53BP1 protein of the present invention. In each sequence, a sequence indicated by a separate yellow or red color represents a target sequence according to an embodiment of the present invention.

Hereinafter, the present invention will be described in detail by examples.

The present invention relates to a pharmaceutical composition for preventing or treating cancer comprising at least one selected from the group consisting of a 53BP1 (p53-binding protein 1) inhibitor and a 53BP1 variant protein comprising the S380 mutation in the amino acid sequence of SEQ ID NO: 2.

In the present invention, "p53-binding protein 1 (p53-binding protein 1; 53BP1, gene access no. AF078776; SEQ ID NO: 1, SEQ ID NO: 3)" was first discovered as a protein that binds p53, and 53BP1 protein is structurally It is a protein that has 1972 amino acids and has a BRCT domain, which is a domain in the BRCA gene, and functions as an intermediate medium that functionally transmits a DNA damage repair signal (Wang et al, Science 298 (2002) 1435-1438 ). Recently, the function of determining the DNA damage repair pathway or the mechanism of cell division in the cell cycle independently of the DNA damage mechanism has been revealed, but it has not been reported whether 53BP1 itself has anti-cancer activity.

In a specific embodiment of the present invention, when the expression of the mRNA is suppressed using shRNA that suppresses the expression of 53BP1 mRNA, it was confirmed that apoptosis is specifically triggered only in cancer cells, and when processing the 53BP1 protein variant, cancer cells By confirming that it exhibits a killing effect, it was confirmed that 53BP1 is suitable as a cancer treatment target.

In the present invention, "53BP1 inhibitor" is used to mean collectively all agents that decrease the expression or activity of 53BP1 mRNA or 53BP1 protein, specifically 53BP1 in a manner that acts directly on 53BP1 or indirectly on its ligand. It may include any agent that reduces the expression or activity of 53BP1 by inhibiting or inhibiting its activity at the transcription level. In the present invention, "53BP1" may be used to refer to both 53BP1 mRNA and protein unless otherwise specified.

The 53BP1 inhibitor is included in the present invention without limitation to its form, such as a compound capable of inhibiting the expression or activity of 53BP1 mRNA or protein, a nucleic acid, a peptide virus, or a vector containing the nucleic acid. The 53BP1 inhibitor is not limited thereto, and specifically, an oligonucleotide that suppresses the expression of 53BP1 mRNA; Or it may be an antibody that inhibits the activity of the 53BP1 protein or an antigen-binding fragment of the antibody.

In this aspect, the present invention may be an oligonucleotide that suppresses mRNA expression of 53BP1 by using 5 to 50 nucleotides or 10 to 30 nucleotides consecutive in the nucleotide sequence represented by SEQ ID NO: 1 as the target sequence, and the target sequence is a sequence. It may be any one of the nucleotide sequence selected from the group consisting of the sequence of 4 to 18.

In another aspect, the present invention may be a recombinant vector expressing an oligonucleotide that inhibits the expression of 53BP1 (p53-binding protein 1) mRNA of SEQ ID NO:1. In this aspect, the pharmaceutical composition of the present invention may include an oligonucleotide that inhibits the expression of 53BP1 mRNA in the form of a recombinant vector expressing the nucleotide, and thus, the present invention provides an oligonucleotide that inhibits the expression of 53BP1 mRNA. It provides a pharmaceutical composition for preventing or treating cancer comprising a recombinant vector expressing the nucleotide.

In the present invention, "vector" means that a target protein or a target RNA can be introduced into a suitable host cell, and includes an expression vector capable of being introduced and expressed, and an essential regulatory element operably linked to express a gene insert. It means a gene construct comprising a. The vector can be, for example, a viral vector. More preferably, Lenti Viral Vector, Adono Viral Vector, or Adeno-associated Viral Vector (AAV) capable of stably expressing genes and efficiently delivering genes to cells Can be Preferably it can be a lentiviral vector or an adeno-associated viral vector. When lentivirus is used as a vector, there is an advantage in that gene transfer efficiency is high and there are few side effects of the immune response. The vector may be used commonly used in the technical field of the present invention. The vector is capable of expressing the oligonucleotide of the present invention, and when administered in an individual, provides an oligonucleotide over a long period of time, thereby having excellent anticancer effects.

The oligonucleotide that suppresses the expression of the 53BP1 mRNA is to suppress the expression or activity of 53BP1 by using 5 to 50 nucleotides or 10 to 30 nucleotides consecutive in the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3 as the target sequence. Can be As a specific example, in the sequence of SEQ ID NO: 3, positions 3785 to 3805 (SEQ ID NO: 4), sequences from positions 2686 to 2706 (SEQ ID NO: 5), sequences from positions 5276 to 5296 (SEQ ID NO: 6), positions 198 to 218 Sequence (SEQ ID NO: 7), sequences from positions 841 to 861 (SEQ ID NO: 8), sequences from positions 3208 to 3228 (SEQ ID NO: 9), sequences from positions 407 to 427 (SEQ ID NO: 10), sequences from positions 1982 to 2002 ( SEQ ID NO: 11), 4726 to 4746 sequence (SEQ ID NO: 12), 4584 to 4604 sequence (SEQ ID NO: 13), 4028 to 4048 sequence (SEQ ID NO: 14), 1992 to 2012 positions (SEQ ID NO: 15), 3978 ~ 3980 position sequence (SEQ ID NO: 16), 1420 ~ 1440 sequence (SEQ ID NO: 17) or 2836 ~ 2856 position sequence (SEQ ID NO: 18) may be a target sequence, but limited to this It does not work. When targeting the sequence, it is possible to more effectively inhibit the expression or activity of 53BP1.

The oligonucleotide that inhibits the expression of 53BP1 mRNA may be selected from the group consisting of antisense oligonucleotides specific for 53BP1 mRNA, aptamer, siRNA, shRNA and miRNA.

In the present invention, "antisense oligonucleotide" is a DNA, RNA, or derivative thereof containing a nucleic acid sequence complementary to the sequence of a characteristic mRNA, and binds to a complementary sequence in mRNA to inhibit the translation of mRNA into a protein. can do. The antisense oligonucleotide sequence is complementary to the 53BP1 sequence of SEQ ID NO: 1 or SEQ ID NO: 3, and refers to a DAN or RNA sequence capable of binding to the sequence. For example, a sequence complementary to any one sequence selected from the group consisting of SEQ ID NOs: 4 to 18 may be included, or may be, but is not limited to. The length of the antisense oligonucleotide may be 5 to 100 bases, or 8 Janie 60 bases, or 10 to 40 bases, or 10 to 30 bases. The antisense oligonucleotide may be synthesized in vitro by a conventional method and administered in vivo, or the antisense oligonucleotide in vivo may be administered in the form of synthesis. Methods for synthesizing antisense oligonucleotides in vitro can be synthesized by bio/chemical methods according to conventional methods in the art. In addition, the form in which antisense oligonucleotides are synthesized in vivo can be realized by using a recombinant vector expressing the antisense oligonucleotides, and such commercial methods can be easily carried out according to conventional methods in the technical field of the present invention. have. Therefore, the design of the antisense oligonucleotide of the present invention can be easily produced according to methods known in the art of the present invention by referring to the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 3. As an example, the antisense oligonucleotide may include a base sequence complementary to a base sequence selected from the group consisting of the sequences of SEQ ID NOs: 4 to 18.

In the present invention, "aptamer" (aptamer) is a single-stranded oligonucleotide, 20 to 60 nucleotides in size, refers to a nucleic acid molecule having a binding activity to a given target. It has a variety of three-dimensional structures depending on the sequence, and can have a high affinity with a specific substance, such as an antigen-antibody reaction. Aptamers can inhibit the activity of a given target by binding to a given target. The aptamer of the present invention may be RNA, DNA, modified nucleic acids or mixtures thereof, and may also be in the form of a straight chain or a ring. Preferably, the aptamer binds to 53BP1 mRNA and may serve to inhibit the expression or activity of 53BP1. Such aptamer can be prepared by a method known to those skilled in the art from the sequence of 53BP1 of SEQ ID NO: 1 or SEQ ID NO: 3.

In the present invention, the terms, "siRNA" and "shRNA" are nucleic acid molecules capable of mediating RNA interference or gene silencing, and are efficient gene knockdown methods or genes because they can suppress the expression of the target gene. Used as a treatment method. shRNA is a hairpin structure formed by binding between complementary sequences in a single-stranded oligonucleotide, and in vivo, the shRNA is cut by a dicer and small fragments of RNA of 21 to 25 nucleotides in size As a double-stranded oligonucleotide siRNA, it can specifically bind to mRNA having a complementary sequence to suppress expression. Therefore, which method to use, shRNA or siRNA, can be determined by the choice of those skilled in the art, and if the target mRNA sequences are the same, similar expression reduction effects can be expected. For the purposes of the present invention, by specifically acting on 53BP1, the 53BP1 mRNA molecule is cut to induce RNA interference (RNAi), thereby inhibiting the 53BP1. siRNA can be synthesized chemically or enzymatically. The method for producing siRNA is not particularly limited, and methods known in the art can be used. For example, a method of directly chemically synthesizing siRNA, a method of synthesizing siRNA using in vitro transcription, a method of cleaving long double-stranded RNA synthesized by in vitro transcription using an enzyme, Expression methods through intracellular delivery of shRNA expression plasmids or viral vectors and expression methods through intracellular delivery of polymerase chain reaction (PCR)-induced siRNA expression cassettes, but are not limited thereto.

In particular, the siRNA for 53BP1 of the present invention may be one of oligonucleotides of any one of SEQ ID NOs: 4 to 18 and oligonucleotides having complementary sequences thereof, but is not limited thereto.

In addition, the shRNA may be a sequence of any one of SEQ ID NO: 4 to SEQ ID NO: 18 as a target sequence. Specifically, it may include a sense nucleotide of any one of SEQ ID NOs: 4 to 18 and an antisense nucleotide of a sequence complementary thereto, and may include a loop sequence between the sense and antisense nucleotides, but is not limited thereto. It does not work. Although not limited thereto, as a more specific example, the shRNA of the present invention may be expressed as a recombinant vector prepared by any one of SEQ ID NOs: 19 to 48. The loop sequence used in the shRNA of the present invention is to clarify its target sequence for the suppression of the expression or activity of 53BP1, the loop sequence can use the sequence commonly used in the technical field of the present invention, the scope of rights is here It is not limited to.

In the present invention, "miRNA (micro RNA)" is a substance that naturally exists in cells, and refers to a substance that induces RNAi phenomenon and is involved in the regulation of a specific gene.

The term "antibody" used in the present invention is a protein molecule containing an immunoglobulin molecule that is immunologically reactive with a specific antigen, and acts as an antigen receptor that specifically recognizes and reacts when a specific antigen invades the body. It refers to a protein molecule. One antibody molecule is composed of two heavy chains and two light chains, each of which has a variable region and a fixed region. The variable region includes three complementarity determining regions (CDRs) and four framework regions (FR), and the complementarity determining regions form a binding site between the antibody and the antigen. The binding specificity of an antibody to an antigen can be generated.

The antibody that can be used in the present invention is not particularly limited as long as it is an antibody that inhibits the activity of the 53BP1 protein, and may include, for example, polyclonal antibodies, monoclonal antibodies, or antibody fragments. In addition, genetically engineered antibodies, such as chimeric antibodies or heterologous antibodies, may also be included.

Prevention or treatment of cancer of the present invention may be achieved by cancer cell specific cell death (apoptosis). The cell death is a form of cell death, which is distinguished from cell necrosis, in which cells are physically destroyed. Also referred to as programmed cell death, it refers to a process in which cells damaged by DNA or unnecessary cells die themselves. .

In a specific embodiment of the present invention, the effect of promoting cancer cell death by 53BP1 shRNA is to inhibit 53BP1 to induce cell death by blocking cell division in the cell cycle, and for normal cells, apoptosis by 53BP1 inhibition does not appear. As confirmed, the inhibition of 53BP1 of the present invention can induce apoptosis of cancer cells specifically and strictly, and thus, when the 53BP1 inhibitor of the present invention is used as an anticancer agent, cancer cell specific cells without side effects affecting normal cells It suggests that death can be induced.

In addition, the present invention relates to a 53BP1 mutant protein.

The 53BP1 variant protein may include the S380 variant in the amino acid sequence of SEQ ID NO: 2. The 53BP1 mutant protein may be S380D 53BP1 mutant protein in which serine at position 380 of SEQ ID NO: 2 is substituted for aspartic acid (D) or S380A 53BP1 mutant protein substituted by alanine (A). . Preferably, it was confirmed in one embodiment that the S380A 53BP1 mutant protein has excellent anticancer activity in the pharmaceutical composition of the present invention. In addition, it was confirmed in an embodiment of the present invention that the S380D 53BP1 mutant protein exhibits stable expression in cancer cells.

In a specific embodiment, S380D and S380A 53BP1 mutation protein confirmed the effect of promoting the killing of cancer cells (FIG. 6c), S380D and S380A 53BP1 mutation protein of the present invention for the treatment or prevention of the cancer pharmaceutical composition of the present invention It can be included as an active ingredient of. In this aspect, the present invention relates to a composition for treating or preventing cancer comprising 53BP1 mutant protein.

Preferably, as an active ingredient of an anticancer composition, the mutant protein may be S380A 53BP1 mutant protein. The S380A mutation causes destabilization of the 53BP1 protein and promotes proteolysis, which may have an excellent effect in promoting the death of cancer cells. Specifically, in the case of S380A 53BP1 mutant protein, it can be seen by referring to FIG. 6c that the effect of promoting the death of cancer cells is superior to that of the control or other mutant protein.

The S380 53BP1 mutant protein of the present invention may be included as an active ingredient of a pharmaceutical composition in the form of a gene encoding it or a recombinant vector in which the gene encoding it is inserted. Therefore, the present invention is a 53BP1 variant comprising the S380 mutation in SEQ ID NO:2. It provides a pharmaceutical composition for the prevention or treatment of cancer comprising a polynucleotide encoding a protein or a recombinant vector containing the polynucleotide. In addition, in this aspect, the present invention provides a recombinant vector expressing an oligonucleotide that inhibits the expression of 53BP1 mRNA; A polynucleotide encoding a 53BP1 variant protein comprising the S380 variant in SEQ ID NO: 2; Or it provides a composition for gene therapy comprising a recombinant vector comprising the polynucleotide.

In the present invention, "cancer" refers to a disease related to cell death regulation, and refers to a disease caused by overproliferation of cells when the normal cell death balance is broken. These abnormal hyperproliferative cells, in some cases, invade surrounding tissues and organs to form masses, destroy or deform normal structures in the body, and this condition is called cancer. Generally, a tumor refers to a mass that is abnormally grown by autonomous overgrowth of body tissue, and can be divided into a benign tumor and a malignant tumor. Malignant tumors have a faster growth rate than benign tumors, and metastasis may occur as they invade surrounding tissues as the cancer progresses. These malignant tumors are commonly referred to as'cancer'.

In the present invention, the cancer is not specifically treated with an anti-cancer agent, or when the anti-cancer drug does not develop resistance (resistance) to the anti-cancer agent or develops a metastatic cancer that metastasizes to another tissue. Cancer. When resistance to an anticancer agent occurs or develops as a metastatic cancer, the characteristics of the primary cancer cells and phenotypes and the characteristics of the cancer cells are different. In the present invention, the suppression of expression of 53BP1 shows excellent apoptosis effect against the primary carcinoma. Since it was confirmed, the pharmaceutical composition comprising the 53BP1 inhibitor or mutant protein of the present invention may be for the prevention or treatment of primary cancer.

In addition, in one embodiment of the present invention, it was observed that the effect of promoting cancer cell death by 53BP1 shRNA inhibits the expression of 53BP1 to induce cell death by blocking cell division in the cell cycle, particularly in lung cancer deficient in p53. It was confirmed that the effect of inhibiting division and promoting apoptosis has a stronger anti-cancer effect in p53 circular lung cancer. In the present invention, it may be p53 deficiency or mutant solid cancer, which specifically indicates the lack or inhibition of p53. In addition, in this aspect, the pharmaceutical composition of the present invention may be for the prevention or treatment of p53 deficient or mutant solid cancer, or for the prevention or treatment of p53 deficient or mutant solid cancer patients.

The cancer may be solid cancer, and specific types of cancer include brain tumor, head and neck cancer, lung cancer, breast cancer, thymoma, mesothelioma, esophageal cancer, cancer, colorectal cancer, liver cancer, stomach cancer, pancreatic cancer, biliary cancer, kidney cancer, bladder cancer, and prostate cancer. Cancer, testicular cancer, germ cell tumor, ovarian cancer, cervical cancer, endometrial cancer, colorectal cancer, lymphoma, multiple myeloma, sarcoma, malignant melanoma and skin cancer, but the types of cancer of the present invention are limited by the above examples no.

In the present invention, "individual" refers to all animals, including humans, who have or develop a cancer disease, and can administer or relieve cancer, including liver cancer, by administering to the subject the pharmaceutical composition or composition for anticancer adjuvants of the present invention. have. The relief refers to all actions that improve or benefit cancer diseases by administration of the composition according to the present invention.

Specifically, the individual may be an individual who has p53 deficiency or mutant cancer disease. In addition, the individual may be an individual who has not undergone chemotherapy in the past or has primary cancer that does not show resistance (resistance) even after chemotherapy.

The term "treatment" in the present invention refers to clinically intervening to alter the natural course of the individual or cell to be treated, which can be performed during or to prevent a clinical pathological condition. The desired therapeutic effects include preventing the occurrence or recurrence of the disease, alleviating symptoms, lowering all direct or indirect pathological consequences of the disease, preventing metastasis, reducing the rate of disease progression, and reducing disease status. Or temporary relief, remission or improved prognosis. Preferably, the present invention includes all actions to improve the course of cancer by administration of a substance that inhibits 53BP1 or a composition comprising 53BP1 mutant protein.

In addition, "prevention" refers to all actions to suppress or delay the onset of the cancer by administration of a composition comprising a 53BP1 inhibitory substance or 53BP1 mutant protein according to the present invention.

The effective amount of the active ingredient of the pharmaceutical composition of the present invention means an amount required to achieve treatment of a disease. Therefore, the type of disease, the severity of the disease, the type and content of active and other ingredients contained in the composition, the type of formulation and the patient's age, weight, general health status, sex and diet, time of administration, route of administration and composition It can be adjusted according to various factors including secretion rate, duration of treatment, and drugs used simultaneously.

In addition, the dosage is preferably selected according to the absorption of the active ingredient in the body, the rate of inactivation and excretion rate, the patient's age, sex and condition, and the severity of the disease to be treated, and anti-cancer showing the effect of promoting cancer cell death of the present invention The composition may be administered by dividing it once or several times daily into a dosage amount of 1 to 100 mg, preferably 1 to 10 mg per 1 kg of body weight of an adult.

In addition, the anticancer agent for promoting cancer cell death of the present invention may be administered parenterally, and when administered parenterally, it is preferable to administer by intravenous injection, intramuscular injection or intrathoracic injection. To formulate for parenteral administration, the apoptosis-promoting anticancer agent may be prepared as a solution or suspension by mixing it with water with a stabilizer or a buffer, and it may be formulated as a unit dosage form of an ampoule or vial.

The pharmaceutical composition of the present invention may further include a suitable carrier, excipient or diluent commonly used in the manufacture of pharmaceutical compositions. As used herein,'pharmaceutically acceptable carrier' means a known pharmaceutical excipient that is useful when formulating a pharmaceutically active compound for administration and is substantially non-toxic and non-sensitive under the conditions of use. The exact ratio of these excipients is determined by the solubility and chemical properties of the active ingredient, the route of administration chosen, as well as standard pharmaceutical practices.

The composition comprising a pharmaceutically acceptable carrier may be various oral or parenteral formulations. In the case of formulation, it may be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc., which are usually used. Solid preparations for oral administration may include tablets, powders, granules, capsules, etc. These solid preparations include at least one excipient in one or more compounds, such as starch, calcium carbonate, sucrose or lactose. It can be prepared by mixing (lactose), gelatin, etc. In addition, lubricants such as magnesium stearate, talc, etc. may be used in addition to simple excipients. Liquid preparations for oral administration include suspensions, intravenous solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used as diluents, various excipients, such as wetting agents, sweeteners, sweeteners, fragrances, and preservatives, can be included. have. Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. As the non-aqueous solvent and suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable estero such as ethyl oleate may be used. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin butter, and glycerogelatin may be used.

In addition, the composition of the present invention is not limited to the pharmaceutical composition of the present invention, tablets, pills, powders, granules, capsules, suspensions, intravenous solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions , Freeze-dried formulations and suppositories may have any one formulation selected from the group consisting of. In addition, it can be preferably formulated according to each disease or ingredient by using an appropriate method in the art or a method published in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA.

According to another aspect of the present invention, the present invention relates to a composition for an anticancer adjuvant that includes, as an active ingredient, a 53BP1 mutant protein comprising the S380 mutation in the amino acid sequence of SEQ ID NO: 2, and improves or enhances the sensitivity of the anticancer agent.

The above can be applied to the 53BP1 mutant protein.

In the present invention, "an anti-cancer adjuvant" can be improved, improved or augmented with the anti-cancer activity of the anti-cancer agent by being administered to the individual before/after/or together with the anti-cancer agent, and may be an adjuvant or combination therapy for the anti-cancer agent. Specifically, the mutant protein of the present invention means that the anti-cancer activity of the anti-cancer agent can be improved, improved, or increased by increasing the sensitivity (sensitivity) of the cancer cell or an individual with cancer to the anti-cancer agent.

The anti-cancer agent may preferably be a DNA-carcinogenic anticancer agent. DNA damaging anti-cancer agents are all known in the art or commercially available.

In a specific embodiment of the present invention, in the case of the 53BP1 mutant protein including a point mutation in the serine (S) of position 380 of SEQ ID NO: 2, it was confirmed that the 53BP1 protein is stably expressed in cancer cells. In particular, in the case of S380 53BP1 mutant protein of the present invention, it was confirmed that 53BP1 is more stably expressed in cancer cells. This is a variant of the present invention as an anticancer adjuvant that improves, enhances or enhances the sensitivity of an anticancer agent when treating an anticancer agent, in relation to the properties of the 53BP protein, which is related to the sensitivity (sensitivity) of DNA damaging anticancer agents in cancer cells. It means there is.

In the composition for anticancer adjuvants of the present invention, the mutant protein may be preferably S380D 53BP1 mutant protein. In the case of S380D 53BP1 mutant protein, it was confirmed that gene stabilization was increased by reducing the formation of excess centrosomes caused by 53BP1 deficiency in cancer cells, and thus it was more stably expressed in cancer cells, thereby increasing susceptibility to anticancer agents.

Therefore, the 53BP1 mutant protein of the present invention can be stably expressed in cancer cells, and thus, when administered together with a DNA-acidic anti-cancer agent, it is possible to improve the sensitivity of cancer cells by the anti-cancer agent by the combination/sequential administration method. Anticancer effect can also be expected, so it can be usefully used as an anticancer adjuvant.

However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

< Example 1> 53BP1 For reviewing the selective expression of protein cell division Immunoblotting Analysis and Flow cytometry

In order to study the function of 53BP1 protein, it was confirmed that the protein is expressed during the cell cycle.

In order to collect the cells in the same cycle, a human uterine cancer cell line (HeLa; ATCC, USA) was dispensed with a number of cells of 1x10 ⁶ in a 10 mm plate, and then cultured for 24 hours at 37°C and 5% carbon dioxide, followed by thymidine ( thymidine; Sigma-Aldrich, USA) was treated with the cells for 16 hours, then exchanged with fresh medium for culturing 8 hours, and then thymidine was treated for 16 hours to synchronize in the same cell cycle. Induced. After 9 hours of exchange with fresh medium, cells in the cell divider were collected, placed on a plate again, and the cells were collected at intervals of 2 hours from 12 hours. 100 μl grinding solution (0.5% Triton X-100, 20 mM Tris, pH 7.5, 2 mM MgCl ₂ , 1 mM DTT, 1 mM EGTA, 50 mM beta-glycerophosphoate, 25 mM NaF, 1 mM Na in the received cells) Protein was quantified after treatment with ₃ VO ₄ , 2 μg/ml leupeptin, 2 μg/ml pepstatin A, 100 μg/ml PMSF, 1 μg/ml antipain).

After electrophoresis of the specifically quantified protein through SDS-PAGE, an increase in expression of 53BP1 was observed by performing immunoblot using 53BP1 antibody, Plk1 antibody, and Erk2 antibody (FIG. 1A). Nocodazole (NZ; Sigma-Aldrich, USA) is a drug that collects cells in the cell division, and Plk1 is a protein that increases expression in the cell division and was used as a positive control.

In addition, it was examined by flow cytometry (FACS) which stage of the cell cycle is the time when the expression of 53BP1 increased. Specifically, after dividing the human uterine cancer cell line (HeLa) with a cell number of 1x10 ⁶ on a 10 mm plate, incubating for 24 hours at 37°C and 5% carbon dioxide, and then at intervals of 16 hours-8 hours-16 hours. Cells were collected at the beginning of DNA synthesis in the manner of thymidine treatment-new medium exchange-thymidine treatment, and then replaced with fresh medium. After replacing with a new medium and removing the cells after 9 hours, the cells were dispensed into 1×10 ⁶ cells in a 10 mm plate, incubated at 37° C. under 5% carbon dioxide for 12 hours, and then the cells were collected at 2 hour intervals. At this time, the cells were treated with 1x trypsin, and each cell was detached. After fixing them in 70% ethanol, the DNA content was analyzed using propidium iodide (Sigma-Aldrich, USA) staining solution. Staining was performed for flow cytometry (FACS) (FIG. 1B).

As shown in FIG. 1, it can be confirmed that the amount of PLK1 protein whose expression is increased in the cell division increases (FIG. 1A ), and the number of cells with a DNA amount of 2 fold (2N) increases most at 18 hours ( 1b), compared to the positive control group NZ treatment group, the expression of 53BP1 showed the most expression in the 18-hour period, and it can be seen that 53BP1 increased its expression in the cell division.

< Example 2> 53BP1 mRNA shRNA And Lentivirus making

In order to confirm the effect of 53BP1 by suppressing mRNA expression, a shRNA and a lentivirus containing the same were produced.

Specific target sequences for the production of shRNA are shown in Table 1 below.

Sequence number Location (based on SEQ ID NO: 3) order 4 3785~3805 GAACAGAAGTAGAAAGAAAAG 5 2686~2706 TGTGAAAGTTCTAGTGAAACC 6 5276-5296 GTGAAGAAGAGGAGGAATTTT 7 198-218 ACAAACAGCTGGAGAAGAACG 8 841-861 GCACAAGAACTTATGGAAAGT 9 3208-3228 GGAGAAGAGGAGAAAGAAAAA 10 407-427 GAGAAGAGTTGGAACAGAAGG 11 1982-2002 GGTCTGAGGTGGAAGAAATCC 12 4726-4746 GGCCAAAGAAAGTGGTATAAG 13 4584-4604 GGGCAAAGACATTCTGTTATG 14 4028-4048 GGACAGAACCCGCAGATTTTG 15 1992-2012 GGAAGAAATCCCTGAGACACC 16 3978-3998 CAGTGGAAGCTCAGGGAAAGG 17 1420-1440 GGGAAGAAAGATGGAGATATG 18 2836-2856 CCAGAAAGCACCATAGCAACC

Specific primer sequences that can be used to prepare the shRNA of the present invention are shown in Table 2 below.

Sequence number Explanation order 19/20 shRNA production primer-target sequence position: 3785~3805 FW: 5'-CCGGGAACAGAAGTAGAAAGAAAAGCTCGAGCTTTTCTTTCTACTTCTGTTC TTTTTG-3'
RV: 5'- AATTCAAAAAGAACAGAAGTAGAAAGAAAAGCTCGAGCTTTTCTTTCTACTTCTGTTC 3' 21/22 shRNA production primer-target sequence position: 2686~2706 FW: 5'- CCGGTGTGAAAGTTCTAGTGAAACCCTCGAGGGTTTCACTAGAACTTTCACA TTTTTG-3'
RV: 5'- AATTCAAAAATGTGAAAGTTCTAGTGAAACCCTCGAGGGTTTCACTAGAACTTTCACA-3' 23/24 shRNA production primer-target sequence positions:
5276~5296 FW: 5'- CCGGGTGAAGAAGAGGAGGAATTTTCTCGAGAAAATTCCTCCTCTTCTTCACTTTTTG-3'
RV: 5'- AATTCAAAAAGTGAAGAAGAGGAGGAATTTTCTCGAGAAAATTCCTCCTCTTCTTCAC-3' 25/26 shRNA production primer-target sequence positions:
198~218 FW: 5'- CCGGACAAACAGCTGGAGAAGAACGCTCGAGCGTTCTTCTCCAGCTGTTTGTTTTTTG-3'
RV: 5'- AATTCAAAAAACAAACAGCTGGAGAAGAACGCTCGAGCGTTCTTCTCCAGCTGTTTGT-3' 27/28 shRNA production primer-target sequence positions:
841~861 FW: 5'- CCGGGCACAAGAACTTATGGAAAGTCTCGAGACTTTCCATAAGTTCTTGTGCTTTTTG-3'
RV: 5'- AATTCAAAAAGCACAAGAACTTATGGAAAGTCTCGAGACTTTCCATAAGTTCTTGTGC-3' 29/30 shRNA production primer-target sequence positions:
3208~3228 FW: 5'- CCGGGGAGAAGAGGAGAAAGAAAAACTCGAGTTTTTCTTTCTCCTCTTCTCCTTTTTG-3'
RV: 5'- AATTCAAAAAGGAGAAGAGGAGAAAGAAAAACTCGAGTTTTTCTTTCTCCTCTTCTCC-3' 31/32 shRNA production primer-target sequence positions:
407-427 FW: 5'- CCGGGAGAAGAGTTGGAACAGAAGGCTCGAGCCTTCTGTTCCAACTCTTCTCTTTTTG-3'
RV: 5'- AATTCAAAAAGAGAAGAGTTGGAACAGAAGGCTCGAGCCTTCTGTTCCAACTCTTCTC-3' 33/34 shRNA production primer-target sequence positions:
1982~2002 FW: 5'- CCGGGGTCTGAGGTGGAAGAAATCCCTCGAGGGATTTCTTCCACCTCAGACCTTTTTG-3'
RV: 5'- AATTCAAAAAGGTCTGAGGTGGAAGAAATCCCTCGAGGGATTTCTTCCACCTCAGACC-3' 35/36 shRNA production primer-target sequence positions:
4726~4746 FW: 5'- CCGGGGCCAAAGAAAGTGGTATAAGCTCGAGCTTATACCACTTTCTTTGGCCTTTTTG-3'
RV: 5'- AATTCAAAAAGGCCAAAGAAAGTGGTATAAGCTCGAGCTTATACCACTTTCTTTGGCC-3' 37/38 shRNA production primer-target sequence positions:
4584~4604 FW: 5'- CCGGGGGCAAAGACATTCTGTTATGCTCGAGCATAACAGAATGTCTTTGCCCTTTTTG-3'
RV: 5'- AATTCAAAAAGGGCAAAGACATTCTGTTATGCTCGAGCATAACAGAATGTCTTTGCCC-3' 39/40 shRNA production primer-target sequence positions:
4028~4048 FW: 5'- CCGGGGACAGAACCCGCAGATTTTGCTCGAGCAAAATCTGCGGGTTCTGTCCTTTTTG-3'
RV: 5'- AATTCAAAAAGGACAGAACCCGCAGATTTTGCTCGAGCAAAATCTGCGGGTTCTGTCC-3' 41/42 shRNA production primer-target sequence positions:
1992~2012 FW: 5'- CCGGGGAAGAAATCCCTGAGACACCCTCGAGGGTGTCTCAGGGATTTCTTCCTTTTTG-3'
RV: 5'- AATTCAAAAAGGAAGAAATCCCTGAGACACCCTCGAGGGTGTCTCAGGGATTTCTTCC-3' 43/44 shRNA production primer-target sequence positions:
3978~3998 FW: 5'- CCGGCAGTGGAAGCTCAGGGAAAGGCTCGAGCCTTTCCCTGAGCTTCCACTGTTTTTG-3'
RV: 5'- AATTCAAAAACAGTGGAAGCTCAGGGAAAGGCTCGAGCCTTTCCCTGAGCTTCCACTG-3' 45/46 shRNA production primer-target sequence positions:
1420~1440 FW: 5'- CCGGGGGAAGAAAGATGGAGATATGCTCGAGCATATCTCCATCTTTCTTCCCTTTTTG-3'
RV: 5'- AATTCAAAAAGGGAAGAAAGATGGAGATATGCTCGAGCATATCTCCATCTTTCTTCCC-3' 47/48 shRNA production primer-target sequence positions:
2836~2856 FW: 5'- CCGGCCAGAAAGCACCATAGCAACCCTCGAGGGTTGCTATGGTGCTTTCTGGTTTTTG-3'
RV: 5'- AATTCAAAAACCAGAAAGCACCATAGCAACCCTCGAGGGTTGCTATGGTGCTTTCTGG-3'

First, to make a shRNA targeting the nucleotide at position 3785 to 3805 of SEQ ID NO: 3 of human 53BP1 (SEQ ID NO: 4), 5'-GAACAGAAGTAGAAAGAAAAG-3' as a sense oligonucleotide; As the antisense oligonucleotide, 5'-CTTTTCTTTCTACTTCTGTTC-3' was used. The loop sequence used for shRNA preparation was 5'-CTCGAG-3' (SEQ ID NO: 49), which was prepared in the form included in the primer.

5'-CCGGGAACAGAA GTAGAAAGAAAAGCTCGAGCTTTTCTTTCTACTTCTGTTCTTTTTG-3' was used as a forward primer to perform subcloning to the pLKO-puro.1 vector and 5'-AATTCAAAAAGAACAGAAGTAGAAAGAAAAGCTCGAGCTTTTCTTTC TACTTCTTC-3TC. After dissolving the oligomer in distilled water at 1 µg/µl, add 5 µl of forward primer and reverse primer, 5 µl of 10x NEB buffer2, 35 µl of distilled water, and heat at 95°C for 10 minutes, then 80 The reaction was carried out at 10 DEG C for 10 minutes and left at room temperature overnight. The pLKO-puro 1 vector was digested with EcoRI and AgeI enzymes at 37° C. for 90 minutes, respectively. After the pLKO-puro1 vector and the oligonucleotide were reacted with T4 ligase at 17°C overnight, a pLKO-puro.1-53BP1 plasmid was prepared. The prepared pLKO-puro.1-53BP1 plasmid was used to insert it into the virus through a conventional lentivirus production method. Specifically, 2 μg pHR'-CMV-VSV-G, 4 μg pHR'-CMV-△R8.2VPR using a transfection reagent (Polyplus, invitrogen) in HEK293T cells, which are human embryonic kidney cells, for virus expression , 4 μg pLKO-puro.1 (control) or pLKO-puro.1-53BP1 (53BP1 shRNA experimental group) was added and cultured in a 37° C. CO₂ incubator for 16 hours. Thereafter, the medium was harvested for 5 times at 12-hour intervals, and the collected medium was centrifuged at 4°C and 17000 rpm for 2 hours to remove the supernatant, and the TNE buffer solution (50 mM Tris, pH 7.5, 130 mM NaCl, 1 mM EDTA). The virus in the buffer solution was used after stabilization at 4°C for 16 hours.

< Example 3> 53BP1 shRNA Inhibition of cell division in solid cancer

Using the 53BP1 shRNA prepared in Example 2, it was intended to observe the effect on cell division in cancer cells through expression inhibition of 53BP1 mRNA.

After dividing the human uterine cancer cell line (HeLa; ATCC, USA) with a cell number of 5x10 ⁵ on a 10 mm plate, incubate for 24 hours at 37°C and 5% carbon dioxide, and then from the pLKO-puro.1 vector. The obtained control virus and lentivirus expressing 53BP1 shRNA were each treated for 24 hours, and then treated with 1 μg/ml puromycin for 2 days to select cells infected with the virus, and then the cells were harvested. Receiving cells are 100 μl of grinding solution (0.5% Triton X-100, 20 mM Tris, pH 7.5, 2 mM MgCl ₂ , 1 mM TT, 1 mM EGTA, 50 mM beta-glycerophosphoate, 25 mM NaF, 1 mM Na Protein was quantified after treatment with ₃ VO ₄ , 2 μg/ml leupeptin, 2 μg/ml pepstatin A, 100 μg/ml PMSF, 1 μg/ml antipain). Specifically, the quantitatively quantified protein was subjected to electrophoresis through SDS-PAGE, and then 53BP1 antibody and Actin antibody were used to perform immunoblot to observe the inhibition of 53BP1 expression (FIG. 2A).

In addition, the effect of 53BP1 shRNA on cell division in cancer cells was observed. Specifically, after placing a sterilized coverglass on a 12-well plate, the human uterine cancer cell line (HeLa; ATCC, USA) was dispensed with a cell number of 5x10 ⁴ and cultured for 24 hours at 37°C and 5% carbon dioxide. Then, the control virus and 53BP1 shRNA lentivirus were treated with the cells for 24 hours. Thereafter, the cells infected with the virus were selected by treatment with puromycin for 2 days, and then the cells were exchanged in a new medium. This was fixed with 4% paraformaldehyde and then reacted with 4% bovine serum albumin solution. Antigen-antibody reaction at 4° C. overnight using antibodies of the cell division markers p-Histone H3 (p-H3) and phospho-MPM2 (MPM2) (see FIG. 2B) or antibodies of Plk1 and 53BP1 (see FIG. 2C). After washing, the PBS solution containing 0.05% Tween20 (8 g NaCl, 0.2 g KCl, 2.68 g Na₂HPO₄-7H₂O, 0.24 g KH₂PO₄, 1L DW) was washed at room temperature three times for 7 minutes to remove the antibody. Here, the secondary antibodies, anti-FITC and anti-Cy3, were diluted 1:200 in 4% bovine serum albumin (BSA), respectively, and then dropped into coverglass to react with the antibody for 4 hours at room temperature. Did. Then, the secondary antibody was washed three times for 7 minutes at room temperature with PBS solution containing 0.05% Tween20. DAPI (4',6-diamidino-2-phenylindole) staining solution was used for staining the nucleus, and 50 µl of 100% glycerol was dropped onto a slide for microscopic observation, and the antibody-bound cells were covered thereon. The glass was turned upside down to remove air bubbles in the glass, and a fluorescence micrograph was taken.

As shown in Figures 2a, 2b and 2c, when processing the shRNA of the present invention it was found that the expression of 53BP1 is suppressed (Fig. 2a). As observed in FIG. 2B, it was observed that the number of cells positive for the cell division marker p-Histone H3 (p-H3) and the cells positive for phopspho-MPM2 (MPM2) increased in the cells lacking 53BP1 (53BP1 shRNA) compared to the control group. It could and was plotted as a percentage. In addition, in the case of cells lacking 53BP1 in FIG. 2C, it was observed that the formation of the spindle of the cell division was incomplete and that the spindle was disturbed, and it was also observed that the separation of the chromosomes into the anode was disturbed. Notation and schematization. Through this, it was confirmed that 53BP1 protein is a necessary factor for normal cell division.

< Example 4> 53BP1 shRNA Cancer cell selective killing promoting effect and Anticancer effect

53BP1 shRNA is a marker of flow cytometry and apoptosis to observe whether cell disruption in solid cancer affects apoptosis or whether cell death by 53BP1 shRNA is a cancer cell selective effect without affecting normal cells. Immunofluorescence staining experiments using active caspase 3 were performed, and the results are shown in FIGS. 3A to 3C.

First, in order to observe the selective killing effect of cancer cells, normal cells (MRC5; ATCC, USA) and non-small cell lung cancer (A549, NCI-H460; ATCC, USA) control virus (vector of pLKO-puro.1 of Example 2) and 53BP1 shRNA lentivirus was treated for 24 hours, and then puromycin was treated at a concentration of 1 μg/ml for 2 days to select cells infected with the virus. Selected cells are collected and 100 μl of grinding solution (0.5% Triton X-100, 20 mM Tris, pH 7.5, 2 mM MgCl ₂ , 1 mM DTT, 1 mM EGTA, 50 mM beta-glycerophosphoate, 25 mM NaF, 1 Proteins were quantified after treatment with mM Na ₃ VO ₄ , 2 μg/ml leupeptin, 2 μg/ml pepstatin A, 100 μg/ml PMSF, 1 μg/ml antipain). The activity of caspase-3 increased in cells where apoptosis occurs using a specifically quantified protein was measured using an Ac-DEVD-AMC (BD Biosciences, USA) fluorescence substrate and is shown in FIG. 3A.

As shown in FIG. 3A, caspase activity measured in dying cells in MRC5 cells, which are normal cells, was almost similar in the control group and the experimental group treated with 53BP1 shRNA, but its activity was 53BP1 in cancer cells A549 and NCI-H460 cells. It was observed that by treatment with shRNA, caspase-3 activity was increased by about 5 to 12 times compared to the control group. Therefore, it was found that 53BP1 expression inhibition by 53BP1 shRNA treatment induced cancer cell selective death without affecting normal cell death.

In addition, the control virus and 53BP1 shRNA lentivirus were treated in the uterine cancer cell line (HeLa) for 24 hours, and then puromycin was treated at a concentration of 1 µg/ml for 2 days to select cells infected with the virus. After the medium exchange, the selected cells were cultured in a 37°C, 5% carbon dioxide incubator for 24 hours. After 24 hours, 1x trypsin was treated to remove cells from the plate. The cells were collected in a 15 ml tube and centrifuged at 1000 xg for 5 minutes to separate the cells and the supernatant. After removing the supernatant, the cells were transferred to a 1.5 ml tube with 1XPBS solution and centrifuged again for 1000 xg, 5 minutes to supernatant. Was removed. The remaining cells were fixed with 1 ml of 70% ethanol, and stored at 4° C. for 16 hours or more, followed by staining the nuclei with 30 μg/ml propidium iodide for 30 minutes at room temperature. The DNA content was measured using a flow cytometer from Millipore Company, and it was divided into cell cycle SubG1, G1, S, and G2/M stages and schematized (see FIG. 3B).

As shown in Fig. 3b, in the case of 53BP1 deficient cells, there are about 40% of the cells on the cell division G2, and the cell death occurs and the DNA cleavage (the cells present in subG1) reaches about 13%. It was observed.

Next, phospho-MPM2, a mitotic marker, and a truncated activated caspase-3 antibody, an apoptotic marker, were used to conduct an immunostaining experiment to observe whether apoptosis blocking cells apoptosis occurs. Specifically, in order to proceed with the immunostaining experiment, after sterilized cover glass was placed on a 24 well plate, the human uterine cancer cell line (HeLa) was dispensed with a cell number of 5x10 ⁴ and cultured for 24 hours at 37°C and 5% carbon dioxide. . The next day, the cells were treated with a control virus and 53BP1 shRNA lentivirus for 24 hours, and then treated with furomycin at a concentration of 1 µg/ml for 2 days to select cells infected with the virus. After the medium exchange, the selected cells were cultured in an incubator with 37°C and 5% carbon dioxide for 24 hours. After 24 hours, fixation with 4% paraformaldehyde increased the permeability of the antibody solution to cells with 100% methanol. The 4% bovine serum albumin (BSA) solution was reacted at 4° C. for 1 hour, followed by an antigen-antibody reaction for 16 hours with phospho-MPM2 and active caspase 3 antibody. The first wash was performed three times for 7 minutes at room temperature with 50 μl PBS-0.05% Tween20 solution (0.05% Tween 20, 8 g NaCl, 0.2 g KCl, 2.68 g Na₂HPO₄-7H₂O, 0.24 g KH₂PO₄, 1L DW) for each experiment group at room temperature. The antibody was removed, and the secondary antibodies, anti-FITC and anti-Cy3 antibodies, were diluted in 4% BSA at a ratio of 1:200 each, and then added to a cover glass to react with the antibody for 1 hour at room temperature. The DAPI (4',6-diamidino-2-phenylindole) staining solution was added thereto to stain the nucleus. After the reaction, the antibody was removed by washing three times with PBS-0.05% Tween20 solution three times for 7 minutes, and then 50 μl of 100% glycerol was dropped onto the slide, and the cover glass was turned over to remove air bubbles in the glass and a fluorescence micrograph was taken ( 3c).

As shown in Fig. 3c, in the case of cells lacking 53BP1, the fact that apoptosis occurs while the cell division step is suppressed, caspase, which is an apoptosis marker, in cells phospho-MPM2 stained or cells having a nuclear fission shape of a cell divider This could be demonstrated by observing that -3 is activated.

< Example 5> 53BP1 Genetic scissors( CRISPR / Cas9 ) Through the formation of excess centers in various solid cancers Anticancer effect

The present inventors tried to observe the effect of blocking the expression of 53BP1 and apoptosis by using the gene scissor (CRISPR/Cas9) system as a method for further proving this in addition to the lentiviral system causing 53BP1 deficiency.

Specifically, 53BP1 CRISPR/Cas9 is expressed to construct a cell line in which 53BP1 is not expressed (knock out), human uterine cancer cells (HeLa), human osteosarcoma cells (U2OS), and human non-small cell lung cancer cells (NCI-H460) The cells were treated with 5 μg 53BP1 CRISPR/Cas9 plasmid and 5 μg 53BP1 HDR plasmid using the transfection reagent, and cultured in a 5% cell incubator at 37° C. for 24 hours. After 24 hours, 1 μg/ml puromycin was treated for 2 days to selectively select cells expressing the control and 53BP1 CRISPR/Cas9 genes. Immunoblot was performed to confirm that 53BP1 expression suppression of 53BP1 by CRISPR/Cas9 works well in cells. 100 μl grinding solution (0.5% Triton X-100, 20 mM Tris, pH 7.5, 2 mM MgCl ₂ , 1 mM DTT, 1 mM EGTA, 50 mM beta-glycerophosphoate, 25 mM NaF, 1 mM Na in the received cells) ₃ VO ₄ , 2 µg/ml leupeptin, 2 µg/ml pepstatin A, 100 µg/ml PMSF, 1 µg/ml antipain), then quantify the protein and electrophores it through SDS-PAGE, followed by 53BP1 antibody, actin Immunoblot was performed using (actin) antibody.

As a result, as shown in Figure 4a, 53BP1 CRISPR/Cas9 gene was observed that the expression of 53BP1 is well suppressed in the case of cells (53 BP1 KO).

When the expression of 53BP1 was suppressed using gene scissors (CRISPR/Cas9), as in the case where the expression was suppressed by 53BP1 shRNA treatment, immunofluorescence staining was performed to observe the phenomenon of suppressing cell division and promoting apoptosis of cancer cells.

First, attach the sterilized cover glass to a plate of 24 well, and then count 53BP1 CRISPR/Cas9 expressing uterine cancer cells (HeLa), sarcoma cells (U2OS), and lung cancer cells (H460) with a cell number of 5x10 ⁴ cells/ml 37 ℃, carbon dioxide was cultured in a 5% cell incubator. After 24 hours, the medium was removed, and 500 μl 1XPBS solution was dispensed to remove the remaining medium. The cells were fixed with cold 4% paraformaldehyde for 10 minutes and 100% methanol was left for 2 minutes to improve permeability. After treating the cells with 4% BSA solution, an antigen-antibody reaction was performed overnight at 4°C using a pericentrin antibody, followed by PBST solution (0.05% Tween 20, 8 g NaCl, 0.2 g KCl, 2.68) g Na₂HPO₄-7H₂O, 0.24 g KH₂PO₄, 1L DW) was washed three times for 7 minutes to remove the primary antibody. The anti-Cy3 antibody was diluted 1:200 in 4% BSA, and then dropped on a cover glass to react with the antibody for 4 hours at room temperature. Then, the antibody was removed at room temperature three times for 7 minutes with PBS-0.05% Tween20 solution. Also, for nuclear staining, DAPI (4',6-diamidino-2-phenylindole) dye was used. To make a microscope sample, 50 µl of 100% glycerol was added dropwise to the slide to attach a cover glass and air bubbles were removed. The CRISPR/Cas9 plasmid is labeled with a green fluorescent protein (GFP), and when fluorescence microscopy, the selected 53BP1 expression-inhibiting uterine cancer cells displayed green fluorescence.

As shown in Figures 4b and 4c, in cells expressing 53BP1 CRISPR/Cas9 through DAPI nuclear staining (53BP1 KO), it was found that apoptosis of the nuclei occurred compared to the control group, and apoptosis was increased by about 15% (Fig. 4b). As a result of studying the cause of this apoptosis increase, the presence of a large amount of pericentrin present in the center in cells expressing 53BP1 CRISPR/Cas9 was proved through immunostaining experiments. Therefore, it was found that the deficiency of 53BP1 blocks cell division by abnormally forming excess centroids, which induces the death of cancer cells (FIG. 4C ).

< Example 6> p53 deficiency In solid rock 53BP1 Effect of increasing apoptosis by suppressing expression

The present inventors made p53-deficient lung cancer cells to observe the effect on cancer cell death when the 53BP1 was suppressed using gene scissors in solid tumors lacking the tumor suppressor p53 protein (H460 ^{p53 -} experimental group), and p53 was normal. Lung cancer cells (H460 ^ctrl control) and their effects were compared and analyzed.

Specifically, a lentiviral system was constructed as in <Example 2> using pLKO-puro.1-p53 plasmid capable of expressing p53 shRNA in order to make a cell line that does not express p53 protein. Human non-small cell lung cancer cells (NCI-H460) are cells in which p53 is present in a circle, and after infection with a virus expressing p53 shRNA, 1 μg/ml puromycin was selectively selected for 48 hours. Next, 5 μg CRISPR/Cas9 knockout (KO) plasmid and 5 μg 53BP1 HDR plasmid were injected into the selected puro H460 ^ctrl and H460 ^{p53 -} cells using a transduction reagent, and 37° C. and 5% carbon dioxide were added for 24 hours. Cultured in cell culture. To proceed with immunofluorescence staining using pericentrin antibody, attach sterilized cover glass to a plate of 24 wells, and incubate 5x10 ⁴ cells/ml of cells in a cell incubator at 37°C and 5% carbon dioxide. Did. After 24 hours, the medium was removed cleanly, and 500 μl 1XPBS solution was dispensed to remove the remaining medium, followed by an immunofluorescence staining experiment as in <Example 5>.

5a and b, the expression of 53BP1 is suppressed, and the expression of 53BP1 and p53 is simultaneously suppressed compared to H460 ^ctrl (H460 ^ctrl /53BP1 KO), where p53 expression is not inhibited H460 ^p53- (H460 ^p53 /53BP1 KO) ) It was observed that the number of centroids stained with pericentrin in the cells increased (FIG. 5A). DAPI (4 ', 6-diamidino -2-phenylindole) observation of a fragment of the nuclear through dyeing, 53BP1 and expressing the H460 ^p53 suppressed at the same time in the p53 ^- p53 in (H460 ^p53 / 53BP1 KO) cell is circular while 53BP1 It was observed that apoptosis increased by more than 2 times compared to the expression of H460 ^ctrl (H460 ^ctrl /53BP1 KO) suppressed (FIG. 5B). Therefore, when 53BP1 is deficient in solid cancer that lacks or does not function as a tumor suppressor gene p53, it was confirmed that the apoptosis effect of cancer cells is further increased, and the present invention proved that the anticancer effect of the active ingredient can be increased.

< Example 7> containing point mutations 53BP1 Stable expression effect of protein

By producing the S380D mutant, which is a phosphorylation analogue of 53BP1, the serine residue at position 380 is replaced with an aspartic residue and expressed, thereby producing a 53BP1 protein having a structure similar to the phosphorylation form. By expressing this, it was intended to observe whether it was stable over time. Specifically, after inserting the plasmid using a transfection sample of 53BP1 mutants in uterine cancer cells (HeLa), treatment with thymidine at an interval of 16 hours-8 hours-16 hours-exchange of new medium-thymidine ( Cells were collected at the beginning of DNA synthesis in the manner of thymidine) treatment, and then replaced with fresh media. Cells were harvested 8 and 12 hours after switching to fresh medium. Receiving cells are 100 μl of grinding solution (0.5% Triton X-100, 20 mM Tris, pH 7.5, 2 mM MgCl ₂ , 1 mM TT, 1 mM EGTA, 50 mM beta-glycerophosphoate, 25 mM NaF, 1 mM Na ₃ VO ₄ , 2 µg/ml leupeptin, 2 µg/ml pepstatin A, 100 µg/ml PMSF, 1 µg/ml antipain) was processed, and protein was quantified. After electrophoresis through SDS-PAGE, 53BP1 antibody, Plk1 The expression of 53BP1 was observed using the antibody, GFP antibody and Actin antibody. GFP was inserted together during transduction as a control to confirm whether transfection was introduced.

As shown in FIG. 6A, the phosphorylated mimetic aspartate point mutant at position S380 was stably expressed, but the dephosphorylated mimetic alanine point mutant of S380 was not stable (FIG. 6A).

In addition, when 53BP1-S380D protein was stably expressed after the removal of 53BP1, an immunofluorescence staining experiment was performed to observe whether cell death caused by 53BP1 expression inhibition could be overcome. After infecting the human uterine cancer cells (HeLa) with 53BP1 shRNA expressing lentivirus, the infected cells are screened with puromycin, and then the point mutants of HA-53BP1, S380D, and S380A are transfected into the cells for 24 hours. After expression, immunofluorescence staining was performed in the same manner as in <Example 5> using pericentrin and HA antibody.

As shown in Figures 6b and 6c, the analysis was performed using HA-labeled cells, and in the case of HA as a control among uterine cancer cells (HeLa) in which 53BP1 expression was suppressed, the number of centroids increased, leading to cancer cell death, and about 18 % Of cancer cells were killed. When the S380A point mutation was expressed after suppression of 53BP1 expression (SA), it was observed that the number of centroids was higher than when the circular (WT) or S380D was expressed (SD). In addition, as a result of observing these cells also through nuclear fragmentation, it was observed that the death of cancer cells was increased (FIGS. 6B and 6C ). However, when the S380D point mutant was expressed after the suppression of 53BP1 expression, it was observed that the formation of excess centrosomes caused by 53BP1 deficiency was blocked, and genetic stabilization occurred, resulting in a significant decrease in the number of cells dying from apoptosis.

SEQUENCE LISTING <110> Industry-University Cooperation Foundation Hanyang University ERICA Campus <120> NOVEL USE OF 53BP1 <130> P20170696OP <160> 48 <170> PatentIn version 3.2 <210> 1 <211> 6266 <212> DNA <213> Human <400> 1 cgttgtttgg cgtgtttttt tttttgtttt ttgtcactgc ctgcctgggt cctgcccgag 60 gtctccatcc tcggtttccc tgtccttgcc ccgggccctg ggagtgctct ggaaggctgc 120 gcagtattgg aggggacaga atgaccttcc ggccttgagt ccctggggag cagatggacc 180 ctactggaag tcagttggat tcagatttct ctcagcaaga tactccttgc ctgataattg 240 aagattctca gcctgaaagc caggttctag aggatgattc tggttctcac ttcagtatgc 300 tatctcgaca ccttcctaat ctccagacgc acaaagaaaa tcctgtgttg gatgttgtgt 360 ccaatcctga acaaacagct ggagaagaac gaggagacgg taatagtggg ttcaatgaac 420 atttgaaaga aaacaaggtt gcagaccctg tggattcttc taacttggac acatgtggtt 480 ccatcagtca ggtcattgag cagttacctc agccaaacag gacaagcagt gttctgggaa 540 tgtcagtgga atctgctcct gctgtggagg aagagaaggg agaagagttg gaacagaagg 600 agaaagagaa ggaagaagat acttcaggca atactacaca ttcccttggt gctgaagata 660 ctgcctcatc acagttgggt tttggggttc tggaactctc ccagagccag gatgttgagg 720 aaaatactgt gccatatgaa gtggacaaag agcagctaca atcagtaacc accaactctg 780 gttataccag gctgtctgat gtggatgcta atactgcaat taagcatgaa gaacagtcca 840 acgaagatat ccccatagca gaacagtcca gcaaggacat ccctgtgaca gcacagccca 900 gtaaggatgt acatgttgta aaagagcaaa atccaccacc tgcaaggtca gaggacatgc 960 cttttagccc caaagcatct gttgctgcta tggaagcaaa agaacagttg tctgcacaag 1020 aacttatgga aagtggactg cagattcaga agtcaccaga gcctgaggtt ttgtcaactc 1080 aggaagactt gtttgaccag agcaataaaa cagtatcttc tgatggttgc tctactcctt 1140 caagggagga aggtgggtgt tctttggctt ccactcctgc caccactctg catctcctgc 1200 agctctctgg tcagaggtcc cttgttcagg acagtctttc cacgaattct tcagatcttg 1260 ttgctccttc tcctgatgct ttccgatcta ctccttttat cgttcctagc agtcccacag 1320 agcaagaagg gagacaagat aagccaatgg acacgtcagt gttatctgaa gaaggaggag 1380 agccttttca gaagaaactt caaagtggtg aaccagtgga gttagaaaac ccccctctcc 1440 tgcctgagtc cactgtatca ccacaagcct caacaccaat atctcagagc acaccagtct 1500 tccctcctgg gtcacttcct atcccatccc agcctcagtt ttctcatgac atttttattc 1560 cttccccaag tctggaagaa caatcaaatg atgggaagaa agatggagat atgcatagtt 1620 catctttgac agttgagtgt tctaaaactt cagagattga accaaagaat tcccctgagg 1680 atcttgggct atctttgaca ggggattctt gcaagttgat gctttctaca agtgaatata 1740 gtcagtcccc aaagatggag agcttgagtt ctcacagaat tgatgaagat ggagaaaaca 1800 cacagattga ggatacggaa cccatgtctc cagttctcaa ttctaaattt gttcctgctg 1860 aaaatgatag tatcctgatg aatccagcac aggatggtga agtacaactg agtcagaatg 1920 atgacaaaac aaagggagat gatacagaca ccagggatga cattagtatt ttagccactg 1980 gttgcaaggg cagagaagaa acggtagcag aagatgtttg tattgatctc acttgtgatt 2040 cggggagtca ggcagttccg tcaccagcta ctcgatctga ggcactttct agtgtgttag 2100 atcaggagga agctatggaa attaaagaac accatccaga ggaggggtct tcagggtctg 2160 aggtggaaga aatccctgag acaccttgtg aaagtcaagg agaggaactc aaagaagaaa 2220 atatggagag tgttccgttg cacctttctc tgactgaaac tcagtcccaa gggttgtgtc 2280 ttcaaaagga aatgccaaaa aaagaatgct cagaagctat ggaagttgaa accagtgtga 2340 ttagtattga ttcccctcaa aagttggcaa tacttgacca agaattggaa cataaggaac 2400 aggaagcttg ggaagaagct acttcagagg actccagtgt tgtcattgta gatgtgaaag 2460 agccatctcc cagagttgat gtttcttgtg aacctttgga gggagtggag aagtgctcag 2520 attcccagtc atgggaggat attgctccag aaatagaacc atgtgctgag aatagattag 2580 acaccaagga agaaaagagt gtagaatatg aaggagatct gaaatcaggg actgcagaaa 2640 cagaacctgt agagcaagat tcttcacagc cttccttacc tttagtgaga gcagatgatc 2700 ctttaagact tgaccaggag ttgcagcagc cccaaactca ggagaaaaca agtaattcat 2760 taacagaaga ctcaaaaatg gctaatgcaa agcagctaag ctcagatgca gaggcccaga 2820 agctggggaa gccctctgcc catgcctcac aaagcttctg tgaaagttct agtgaaaccc 2880 catttcattt cactttgcct aaagaaggtg atatcatccc accattgact ggtgcaaccc 2940 cacctcttat tgggcaccta aaattggagc ccaagagaca cagtactcct attggtatta 3000 gcaactatcc agaaagcacc atagcaacca gtgatgtcat gtctgaaagc atggtggaga 3060 cccatgatcc catacttggg agtggaaaag gggattctgg ggctgcccca gacgtggatg 3120 ataaattatg tctaagaatg aaactggtta gtcctgagac tgaggcgagt gaagagtctt 3180 tgcagttcaa cctggaaaag cctgcaactg gtgaaagaaa aaatggatct actgctgttg 3240 ctgagtctgt tgccagtccc cagaagacca tgtctgtgtt gagctgtatc tgtgaagcca 3300 ggcaagagaa tgaggctcga agtgaggatc cccccaccac acccatcagg gggaacttgc 3360 tccactttcc aagttctcaa ggagaagagg agaaagaaaa attggagggt gaccatacaa 3420 tcaggcagag tcaacagcct atgaagccca ttagtcctgt caaggaccct gtttctcctg 3480 cttcccagaa gatggtcata caagggccat ccagtcctca aggagaggca atggtgacag 3540 atgtgctaga agaccagaaa gaaggacgga gtactaataa ggaaaatcct agtaaggcct 3600 tgattgaaag gcccagccaa aataacatag gaatccaaac catggagtgt tccttgaggg 3660 tcccagaaac tgtttcagca gcaacccaga ctataaagaa tgtgtgtgag caggggacca 3720 gtacagtgga ccagaacttt ggaaagcaag atgccacagt tcagactgag agggggagtg 3780 gtgagaaacc agtcagtgct cctggggatg atacagagtc gctccatagc cagggagaag 3840 aagagtttga tatgcctcag cctccacatg gccatgtctt acatcgtcac atgagaacaa 3900 tccgggaagt acgcacactt gtcactcgtg tcattacaga tgtgtattat gtggatggaa 3960 cagaagtaga aagaaaagta actgaggaga ctgaagagcc aattgtagag tgtcaggagt 4020 gtgaaactga agtttcccct tcacagactg ggggctcctc aggtgacctg ggggatatca 4080 gctccttctc ctccaaggca tccagcttac accgcacatc aagtgggaca agtctctcag 4140 ctatgcacag cagtggaagc tcagggaaag gagccggacc actcagaggg aaaaccagcg 4200 ggacagaacc cgcagatttt gccttaccca gctcccgagg aggcccagga aaactgagtc 4260 ctagaaaagg ggtcagtcag acagggacgc cagtgtgtga ggaggatggt gatgcaggcc 4320 ttggcatcag acagggaggg aaggctccag tcacgcctcg tgggcgtggg cgaaggggcc 4380 gcccaccttc tcggaccact ggaaccagag aaacagctgt gcctggcccc ttgggcatag 4440 aggacatttc acctaacttg tcaccagatg ataaatcctt cagccgtgtc gtgccccgag 4500 tgccagactc caccagacga acagatgtgg gtgctggtgc tttgcgtcgt agtgactctc 4560 cagaaattcc tttccaggct gctgctggcc cttctgatgg cttagatgcc tcctctccag 4620 gaaatagctt tgtagggctc cgtgttgtag ccaagtggtc atccaatggc tacttttact 4680 ctgggaaaat cacacgagat gtcggagctg ggaagtataa attgctcttt gatgatgggt 4740 acgaatgtga tgtgttgggc aaagacattc tgttatgtga ccccatcccg ctggacactg 4800 aagtgacggc cctctcggag gatgagtatt tcagtgcagg agtggtgaaa ggacatagga 4860 aggagtctgg ggaactgtac tacagcattg aaaaagaagg ccaaagaaag tggtataagc 4920 gaatggctgt catcctgtcc ttggagcaag gaaacagact gagagagcag tatgggcttg 4980 gcccctatga agcagtaaca cctcttacaa aggcagcaga tatcagctta gacaatttgg 5040 tggaagggaa gcggaaacgg cgcagtaacg tcagctcccc agccacccct actgcctcca 5100 gtagcagcag cacaacccct acccgaaaga tcacagaaag tcctcgtgcc tccatgggag 5160 ttctctcagg caaaagaaaa cttatcactt ctgaagagga acggtcccct gccaagcgag 5220 gtcgcaagtc tgccacagta aaacctggtg cagtaggggc aggagagttt gtgagcccct 5280 gtgagagtgg agacaacacc ggtgaaccct ctgccctgga agagcagaga gggcctttgc 5340 ctctcaacaa gaccttgttt ctgggctacg catttctcct taccatggcc acaaccagtg 5400 acaagttggc cagccgctcc aaactgccag atggtcctac aggaagcagt gaagaagagg 5460 aggaattttt ggaaattcct cctttcaaca agcagtatac agaatcccag cttcgagcag 5520 gagctggcta tatccttgaa gatttcaatg aagcccagtg taacacagct taccagtgtc 5580 ttctaattgc ggatcagcat tgtcgaaccc ggaagtactt cctgtgcctt gccagtggga 5640 ttccttgtgt gtctcatgtc tgggtccatg atagttgcca tgccaaccag ctccagaact 5700 accgtaatta tctgttgcca gctgggtaca gccttgagga gcaaagaatt ctggactggc 5760 aaccccgtga aaatcctttc cagaatctga aggtactctt ggtatcagac caacagcaga 5820 acttcctgga gctctggtct gagatcctca tgactggtgg tgcagcctct gtgaagcagc 5880 accattcaag tgcccataac aaagatattg ctttaggggt atttgatgtg gtggtgacgg 5940 acccctcatg cccagcctcg gtgctgaagt gtgctgaagc attgcagctg cctgtggtgt 6000 cacaagagtg ggtgatccag tgcctcattg ttggggagag aattggattc aagcagcatc 6060 caaaatataa acacgattat gtttctcact aaagatactt ggtcttactg gttttattcc 6120 ctgctatcgt ggagattgtg ttttaaccag gttttaaatg tgtcttgtgt gtaactggat 6180 tccttgcatg gatcttgtat atagttttat ttgctgaact tttatgataa aataaatgtt 6240 gaatctcttt ggttgtagta actggg 6266 <210> 2 <211> 1972 <212> PRT <213> Human <400> 2 Met Asp Pro Thr Gly Ser Gln Leu Asp Ser Asp Phe Ser Gln Gln Asp 1 5 10 15 Thr Pro Cys Leu Ile Ile Glu Asp Ser Gln Pro Glu Ser Gln Val Leu 20 25 30 Glu Asp Asp Ser Gly Ser His Phe Ser Met Leu Ser Arg His Leu Pro 35 40 45 Asn Leu Gln Thr His Lys Glu Asn Pro Val Leu Asp Val Val Ser Asn 50 55 60 Pro Glu Gln Thr Ala Gly Glu Glu Arg Gly Asp Gly Asn Ser Gly Phe 65 70 75 80 Asn Glu His Leu Lys Glu Asn Lys Val Ala Asp Pro Val Asp Ser Ser 85 90 95 Asn Leu Asp Thr Cys Gly Ser Ile Ser Gln Val Ile Glu Gln Leu Pro 100 105 110 Gln Pro Asn Arg Thr Ser Ser Val Leu Gly Met Ser Val Glu Ser Ala 115 120 125 Pro Ala Val Glu Glu Glu Lys Gly Glu Glu Leu Glu Gln Lys Glu Lys 130 135 140 Glu Lys Glu Glu Asp Thr Ser Gly Asn Thr Thr His Ser Leu Gly Ala 145 150 155 160 Glu Asp Thr Ala Ser Ser Gln Leu Gly Phe Gly Val Leu Glu Leu Ser 165 170 175 Gln Ser Gln Asp Val Glu Glu Asn Thr Val Pro Tyr Glu Val Asp Lys 180 185 190 Glu Gln Leu Gln Ser Val Thr Thr Asn Ser Gly Tyr Thr Arg Leu Ser 195 200 205 Asp Val Asp Ala Asn Thr Ala Ile Lys His Glu Glu Gln Ser Asn Glu 210 215 220 Asp Ile Pro Ile Ala Glu Gln Ser Ser Lys Asp Ile Pro Val Thr Ala 225 230 235 240 Gln Pro Ser Lys Asp Val His Val Val Lys Glu Gln Asn Pro Pro 245 250 255 Ala Arg Ser Glu Asp Met Pro Phe Ser Pro Lys Ala Ser Val Ala Ala 260 265 270 Met Glu Ala Lys Glu Gln Leu Ser Ala Gln Glu Leu Met Glu Ser Gly 275 280 285 Leu Gln Ile Gln Lys Ser Pro Glu Pro Glu Val Leu Ser Thr Gln Glu 290 295 300 Asp Leu Phe Asp Gln Ser Asn Lys Thr Val Ser Ser Asp Gly Cys Ser 305 310 315 320 Thr Pro Ser Arg Glu Glu Gly Gly Cys Ser Leu Ala Ser Thr Pro Ala 325 330 335 Thr Thr Leu His Leu Leu Gln Leu Ser Gly Gln Arg Ser Leu Val Gln 340 345 350 Asp Ser Leu Ser Thr Asn Ser Ser Asp Leu Val Ala Pro Ser Pro Asp 355 360 365 Ala Phe Arg Ser Thr Pro Phe Ile Val Pro Ser Ser Pro Thr Glu Gln 370 375 380 Glu Gly Arg Gln Asp Lys Pro Met Asp Thr Ser Val Leu Ser Glu Glu 385 390 395 400 Gly Gly Glu Pro Phe Gln Lys Lys Leu Gln Ser Gly Glu Pro Val Glu 405 410 415 Leu Glu Asn Pro Pro Leu Leu Pro Glu Ser Thr Val Ser Pro Gln Ala 420 425 430 Ser Thr Pro Ile Ser Gln Ser Thr Pro Val Phe Pro Pro Gly Ser Leu 435 440 445 Pro Ile Pro Ser Gln Pro Gln Phe Ser His Asp Ile Phe Ile Pro Ser 450 455 460 Pro Ser Leu Glu Glu Gln Ser Asn Asp Gly Lys Lys Asp Gly Asp Met 465 470 475 480 His Ser Ser Ser Leu Thr Val Glu Cys Ser Lys Thr Ser Glu Ile Glu 485 490 495 Pro Lys Asn Ser Pro Glu Asp Leu Gly Leu Ser Leu Thr Gly Asp Ser 500 505 510 Cys Lys Leu Met Leu Ser Thr Ser Glu Tyr Ser Gln Ser Pro Lys Met 515 520 525 Glu Ser Leu Ser Ser His Arg Ile Asp Glu Asp Gly Glu Asn Thr Gln 530 535 540 Ile Glu Asp Thr Glu Pro Met Ser Pro Val Leu Asn Ser Lys Phe Val 545 550 555 560 Pro Ala Glu Asn Asp Ser Ile Leu Met Asn Pro Ala Gln Asp Gly Glu 565 570 575 Val Gln Leu Ser Gln Asn Asp Asp Lys Thr Lys Gly Asp Asp Thr Asp 580 585 590 Thr Arg Asp Asp Ile Ser Ile Leu Ala Thr Gly Cys Lys Gly Arg Glu 595 600 605 Glu Thr Val Ala Glu Asp Val Cys Ile Asp Leu Thr Cys Asp Ser Gly 610 615 620 Ser Gln Ala Val Pro Ser Pro Ala Thr Arg Ser Glu Ala Leu Ser Ser 625 630 635 640 Val Leu Asp Gln Glu Glu Ala Met Glu Ile Lys Glu His His Pro Glu 645 650 655 Glu Gly Ser Ser Gly Ser Glu Val Glu Glu Ile Pro Glu Thr Pro Cys 660 665 670 Glu Ser Gln Gly Glu Glu Leu Lys Glu Glu Asn Met Glu Ser Val Pro 675 680 685 Leu His Leu Ser Leu Thr Glu Thr Gln Ser Gln Gly Leu Cys Leu Gln 690 695 700 Lys Glu Met Pro Lys Lys Glu Cys Ser Glu Ala Met Glu Val Glu Thr 705 710 715 720 Ser Val Ile Ser Ile Asp Ser Pro Gln Lys Leu Ala Ile Leu Asp Gln 725 730 735 Glu Leu Glu His Lys Glu Gln Glu Ala Trp Glu Glu Ala Thr Ser Glu 740 745 750 Asp Ser Ser Val Val Ile Val Asp Val Lys Glu Pro Ser Pro Arg Val 755 760 765 Asp Val Ser Cys Glu Pro Leu Glu Gly Val Glu Lys Cys Ser Asp Ser 770 775 780 Gln Ser Trp Glu Asp Ile Ala Pro Glu Ile Glu Pro Cys Ala Glu Asn 785 790 795 800 Arg Leu Asp Thr Lys Glu Glu Lys Ser Val Glu Tyr Glu Gly Asp Leu 805 810 815 Lys Ser Gly Thr Ala Glu Thr Glu Pro Val Glu Gln Asp Ser Ser Gln 820 825 830 Pro Ser Leu Pro Leu Val Arg Ala Asp Asp Pro Leu Arg Leu Asp Gln 835 840 845 Glu Leu Gln Gln Pro Gln Thr Gln Glu Lys Thr Ser Asn Ser Leu Thr 850 855 860 Glu Asp Ser Lys Met Ala Asn Ala Lys Gln Leu Ser Ser Asp Ala Glu 865 870 875 880 Ala Gln Lys Leu Gly Lys Pro Ser Ala His Ala Ser Gln Ser Phe Cys 885 890 895 Glu Ser Ser Ser Glu Thr Pro Phe His Phe Thr Leu Pro Lys Glu Gly 900 905 910 Asp Ile Ile Pro Pro Leu Thr Gly Ala Thr Pro Pro Leu Ile Gly His 915 920 925 Leu Lys Leu Glu Pro Lys Arg His Ser Thr Pro Ile Gly Ile Ser Asn 930 935 940 Tyr Pro Glu Ser Thr Ile Ala Thr Ser Asp Val Met Ser Glu Ser Met 945 950 955 960 Val Glu Thr His Asp Pro Ile Leu Gly Ser Gly Lys Gly Asp Ser Gly 965 970 975 Ala Ala Pro Asp Val Asp Asp Lys Leu Cys Leu Arg Met Lys Leu Val 980 985 990 Ser Pro Glu Thr Glu Ala Ser Glu Glu Ser Leu Gln Phe Asn Leu Glu 995 1000 1005 Lys Pro Ala Thr Gly Glu Arg Lys Asn Gly Ser Thr Ala Val Ala 1010 1015 1020 Glu Ser Val Ala Ser Pro Gln Lys Thr Met Ser Val Leu Ser Cys 1025 1030 1035 Ile Cys Glu Ala Arg Gln Glu Asn Glu Ala Arg Ser Glu Asp Pro 1040 1045 1050 Pro Thr Thr Pro Ile Arg Gly Asn Leu Leu His Phe Pro Ser Ser 1055 1060 1065 Gln Gly Glu Glu Glu Lys Glu Lys Leu Glu Gly Asp His Thr Ile 1070 1075 1080 Arg Gln Ser Gln Gln Pro Met Lys Pro Ile Ser Pro Val Lys Asp 1085 1090 1095 Pro Val Ser Pro Ala Ser Gln Lys Met Val Ile Gln Gly Pro Ser 1100 1105 1110 Ser Pro Gln Gly Glu Ala Met Val Thr Asp Val Leu Glu Asp Gln 1115 1120 1125 Lys Glu Gly Arg Ser Thr Asn Lys Glu Asn Pro Ser Lys Ala Leu 1130 1135 1140 Ile Glu Arg Pro Ser Gln Asn Asn Ile Gly Ile Gln Thr Met Glu 1145 1150 1155 Cys Ser Leu Arg Val Pro Glu Thr Val Ser Ala Ala Thr Gln Thr 1160 1165 1170 Ile Lys Asn Val Cys Glu Gln Gly Thr Ser Thr Val Asp Gln Asn 1175 1180 1185 Phe Gly Lys Gln Asp Ala Thr Val Gln Thr Glu Arg Gly Ser Gly 1190 1195 1200 Glu Lys Pro Val Ser Ala Pro Gly Asp Asp Thr Glu Ser Leu His 1205 1210 1215 Ser Gln Gly Glu Glu Glu Phe Asp Met Pro Gln Pro Pro His Gly 1220 1225 1230 His Val Leu His Arg His Met Arg Thr Ile Arg Glu Val Arg Thr 1235 1240 1245 Leu Val Thr Arg Val Ile Thr Asp Val Tyr Tyr Val Asp Gly Thr 1250 1255 1260 Glu Val Glu Arg Lys Val Thr Glu Glu Thr Glu Glu Pro Ile Val 1265 1270 1275 Glu Cys Gln Glu Cys Glu Thr Glu Val Ser Pro Ser Gln Thr Gly 1280 1285 1290 Gly Ser Ser Gly Asp Leu Gly Asp Ile Ser Ser Phe Ser Ser Lys 1295 1300 1305 Ala Ser Ser Leu His Arg Thr Ser Ser Gly Thr Ser Leu Ser Ala 1310 1315 1320 Met His Ser Ser Gly Ser Ser Gly Lys Gly Ala Gly Pro Leu Arg 1325 1330 1335 Gly Lys Thr Ser Gly Thr Glu Pro Ala Asp Phe Ala Leu Pro Ser 1340 1345 1350 Ser Arg Gly Gly Pro Gly Lys Leu Ser Pro Arg Lys Gly Val Ser 1355 1360 1365 Gln Thr Gly Thr Pro Val Cys Glu Glu Asp Gly Asp Ala Gly Leu 1370 1375 1380 Gly Ile Arg Gln Gly Gly Lys Ala Pro Val Thr Pro Arg Gly Arg 1385 1390 1395 Gly Arg Arg Gly Arg Pro Pro Ser Arg Thr Thr Gly Thr Arg Glu 1400 1405 1410 Thr Ala Val Pro Gly Pro Leu Gly Ile Glu Asp Ile Ser Pro Asn 1415 1420 1425 Leu Ser Pro Asp Asp Lys Ser Phe Ser Arg Val Val Pro Arg Val 1430 1435 1440 Pro Asp Ser Thr Arg Arg Thr Asp Val Gly Ala Gly Ala Leu Arg 1445 1450 1455 Arg Ser Asp Ser Pro Glu Ile Pro Phe Gln Ala Ala Ala Gly Pro 1460 1465 1470 Ser Asp Gly Leu Asp Ala Ser Ser Pro Gly Asn Ser Phe Val Gly 1475 1480 1485 Leu Arg Val Val Ala Lys Trp Ser Ser Asn Gly Tyr Phe Tyr Ser 1490 1495 1500 Gly Lys Ile Thr Arg Asp Val Gly Ala Gly Lys Tyr Lys Leu Leu 1505 1510 1515 Phe Asp Asp Gly Tyr Glu Cys Asp Val Leu Gly Lys Asp Ile Leu 1520 1525 1530 Leu Cys Asp Pro Ile Pro Leu Asp Thr Glu Val Thr Ala Leu Ser 1535 1540 1545 Glu Asp Glu Tyr Phe Ser Ala Gly Val Val Lys Gly His Arg Lys 1550 1555 1560 Glu Ser Gly Glu Leu Tyr Tyr Ser Ile Glu Lys Glu Gly Gln Arg 1565 1570 1575 Lys Trp Tyr Lys Arg Met Ala Val Ile Leu Ser Leu Glu Gln Gly 1580 1585 1590 Asn Arg Leu Arg Glu Gln Tyr Gly Leu Gly Pro Tyr Glu Ala Val 1595 1600 1605 Thr Pro Leu Thr Lys Ala Ala Asp Ile Ser Leu Asp Asn Leu Val 1610 1615 1620 Glu Gly Lys Arg Lys Arg Arg Ser Asn Val Ser Ser Pro Ala Thr 1625 1630 1635 Pro Thr Ala Ser Ser Ser Ser Ser Thr Thr Pro Thr Arg Lys Ile 1640 1645 1650 Thr Glu Ser Pro Arg Ala Ser Met Gly Val Leu Ser Gly Lys Arg 1655 1660 1665 Lys Leu Ile Thr Ser Glu Glu Glu Arg Ser Pro Ala Lys Arg Gly 1670 1675 1680 Arg Lys Ser Ala Thr Val Lys Pro Gly Ala Val Gly Ala Gly Glu 1685 1690 1695 Phe Val Ser Pro Cys Glu Ser Gly Asp Asn Thr Gly Glu Pro Ser 1700 1705 1710 Ala Leu Glu Glu Gln Arg Gly Pro Leu Pro Leu Asn Lys Thr Leu 1715 1720 1725 Phe Leu Gly Tyr Ala Phe Leu Leu Thr Met Ala Thr Thr Ser Asp 1730 1735 1740 Lys Leu Ala Ser Arg Ser Lys Leu Pro Asp Gly Pro Thr Gly Ser 1745 1750 1755 Ser Glu Glu Glu Glu Glu Phe Leu Glu Ile Pro Pro Phe Asn Lys 1760 1765 1770 Gln Tyr Thr Glu Ser Gln Leu Arg Ala Gly Ala Gly Tyr Ile Leu 1775 1780 1785 Glu Asp Phe Asn Glu Ala Gln Cys Asn Thr Ala Tyr Gln Cys Leu 1790 1795 1800 Leu Ile Ala Asp Gln His Cys Arg Thr Arg Lys Tyr Phe Leu Cys 1805 1810 1815 Leu Ala Ser Gly Ile Pro Cys Val Ser His Val Trp Val His Asp 1820 1825 1830 Ser Cys His Ala Asn Gln Leu Gln Asn Tyr Arg Asn Tyr Leu Leu 1835 1840 1845 Pro Ala Gly Tyr Ser Leu Glu Glu Gln Arg Ile Leu Asp Trp Gln 1850 1855 1860 Pro Arg Glu Asn Pro Phe Gln Asn Leu Lys Val Leu Leu Val Ser 1865 1870 1875 Asp Gln Gln Gln Asn Phe Leu Glu Leu Trp Ser Glu Ile Leu Met 1880 1885 1890 Thr Gly Gly Ala Ala Ser Val Lys Gln His His Ser Ser Ala His 1895 1900 1905 Asn Lys Asp Ile Ala Leu Gly Val Phe Asp Val Val Val Thr Asp 1910 1915 1920 Pro Ser Cys Pro Ala Ser Val Leu Lys Cys Ala Glu Ala Leu Gln 1925 1930 1935 Leu Pro Val Val Ser Gln Glu Trp Val Ile Gln Cys Leu Ile Val 1940 1945 1950 Gly Glu Arg Ile Gly Phe Lys Gln His Pro Lys Tyr Lys His Asp 1955 1960 1965 Tyr Val Ser His 1970 <210> 3 <211> 5919 <212> DNA <213> Artificial <220> <223> cDNA of 53BP1 protien <400> 3 atggacccta ctggaagtca gttggattca gatttctctc agcaagatac tccttgcctg 60 ataattgaag attctcagcc tgaaagccag gttctagagg atgattctgg ttctcacttc 120 agtatgctat ctcgacacct tcctaatctc cagacgcaca aagaaaatcc tgtgttggat 180 gttgtgtcca atcctgaaca aacagctgga gaagaacgag gagacggtaa tagtgggttc 240 aatgaacatt tgaaagaaaa caaggttgca gaccctgtgg attcttctaa cttggacaca 300 tgtggttcca tcagtcaggt cattgagcag ttacctcagc caaacaggac aagcagtgtt 360 ctgggaatgt cagtggaatc tgctcctgct gtggaggaag agaagggaga agagttggaa 420 cagaaggaga aagagaagga agaagatact tcaggcaata ctacacattc ccttggtgct 480 gaagatactg cctcatcaca gttgggtttt ggggttctgg aactctccca gagccaggat 540 gttgaggaaa atactgtgcc atatgaagtg gacaaagagc agctacaatc agtaaccacc 600 aactctggtt ataccaggct gtctgatgtg gatgctaata ctgcaattaa gcatgaagaa 660 cagtccaacg aagatatccc catagcagaa cagtccagca aggacatccc tgtgacagca 720 cagcccagta aggatgtaca tgttgtaaaa gagcaaaatc caccacctgc aaggtcagag 780 gacatgcctt ttagccccaa agcatctgtt gctgctatgg aagcaaaaga acagttgtct 840 gcacaagaac ttatggaaag tggactgcag attcagaagt caccagagcc tgaggttttg 900 tcaactcagg aagacttgtt tgaccagagc aataaaacag tatcttctga tggttgctct 960 actccttcaa gggaggaagg tgggtgttct ttggcttcca ctcctgccac cactctgcat 1020 ctcctgcagc tctctggtca gaggtccctt gttcaggaca gtctttccac gaattcttca 1080 gatcttgttg ctccttctcc tgatgctttc cgatctactc cttttatcgt tcctagcagt 1140 cccacagagc aagaagggag acaagataag ccaatggaca cgtcagtgtt atctgaagaa 1200 ggaggagagc cttttcagaa gaaacttcaa agtggtgaac cagtggagtt agaaaacccc 1260 cctctcctgc ctgagtccac tgtatcacca caagcctcaa caccaatatc tcagagcaca 1320 ccagtcttcc ctcctgggtc acttcctatc ccatcccagc ctcagttttc tcatgacatt 1380 tttattcctt ccccaagtct ggaagaacaa tcaaatgatg ggaagaaaga tggagatatg 1440 catagttcat ctttgacagt tgagtgttct aaaacttcag agattgaacc aaagaattcc 1500 cctgaggatc ttgggctatc tttgacaggg gattcttgca agttgatgct ttctacaagt 1560 gaatatagtc agtccccaaa gatggagagc ttgagttctc acagaattga tgaagatgga 1620 gaaaacacac agattgagga tacggaaccc atgtctccag ttctcaattc taaatttgtt 1680 cctgctgaaa atgatagtat cctgatgaat ccagcacagg atggtgaagt acaactgagt 1740 cagaatgatg acaaaacaaa gggagatgat acagacacca gggatgacat tagtatttta 1800 gccactggtt gcaagggcag agaagaaacg gtagcagaag atgtttgtat tgatctcact 1860 tgtgattcgg ggagtcaggc agttccgtca ccagctactc gatctgaggc actttctagt 1920 gtgttagatc aggaggaagc tatggaaatt aaagaacacc atccagagga ggggtcttca 1980 gggtctgagg tggaagaaat ccctgagaca ccttgtgaaa gtcaaggaga ggaactcaaa 2040 gaagaaaata tggagagtgt tccgttgcac ctttctctga ctgaaactca gtcccaaggg 2100 ttgtgtcttc aaaaggaaat gccaaaaaaa gaatgctcag aagctatgga agttgaaacc 2160 agtgtgatta gtattgattc ccctcaaaag ttggcaatac ttgaccaaga attggaacat 2220 aaggaacagg aagcttggga agaagctact tcagaggact ccagtgttgt cattgtagat 2280 gtgaaagagc catctcccag agttgatgtt tcttgtgaac ctttggaggg agtggagaag 2340 tgctcagatt cccagtcatg ggaggatatt gctccagaaa tagaaccatg tgctgagaat 2400 agattagaca ccaaggaaga aaagagtgta gaatatgaag gagatctgaa atcagggact 2460 gcagaaacag aacctgtaga gcaagattct tcacagcctt ccttaccttt agtgagagca 2520 gatgatcctt taagacttga ccaggagttg cagcagcccc aaactcagga gaaaacaagt 2580 aattcattaa cagaagactc aaaaatggct aatgcaaagc agctaagctc agatgcagag 2640 gcccagaagc tggggaagcc ctctgcccat gcctcacaaa gcttctgtga aagttctagt 2700 gaaaccccat ttcatttcac tttgcctaaa gaaggtgata tcatcccacc attgactggt 2760 gcaaccccac ctcttattgg gcacctaaaa ttggagccca agagacacag tactcctatt 2820 ggtattagca actatccaga aagcaccata gcaaccagtg atgtcatgtc tgaaagcatg 2880 gtggagaccc atgatcccat acttgggagt ggaaaagggg attctggggc tgccccagac 2940 gtggatgata aattatgtct aagaatgaaa ctggttagtc ctgagactga ggcgagtgaa 3000 gagtctttgc agttcaacct ggaaaagcct gcaactggtg aaagaaaaaa tggatctact 3060 gctgttgctg agtctgttgc cagtccccag aagaccatgt ctgtgttgag ctgtatctgt 3120 gaagccaggc aagagaatga ggctcgaagt gaggatcccc ccaccacacc catcaggggg 3180 aacttgctcc actttccaag ttctcaagga gaagaggaga aagaaaaatt ggagggtgac 3240 catacaatca ggcagagtca acagcctatg aagcccatta gtcctgtcaa ggaccctgtt 3300 tctcctgctt cccagaagat ggtcatacaa gggccatcca gtcctcaagg agaggcaatg 3360 gtgacagatg tgctagaaga ccagaaagaa ggacggagta ctaataagga aaatcctagt 3420 aaggccttga ttgaaaggcc cagccaaaat aacataggaa tccaaaccat ggagtgttcc 3480 ttgagggtcc cagaaactgt ttcagcagca acccagacta taaagaatgt gtgtgagcag 3540 gggaccagta cagtggacca gaactttgga aagcaagatg ccacagttca gactgagagg 3600 gggagtggtg agaaaccagt cagtgctcct ggggatgata cagagtcgct ccatagccag 3660 ggagaagaag agtttgatat gcctcagcct ccacatggcc atgtcttaca tcgtcacatg 3720 agaacaatcc gggaagtacg cacacttgtc actcgtgtca ttacagatgt gtattatgtg 3780 gatggaacag aagtagaaag aaaagtaact gaggagactg aagagccaat tgtagagtgt 3840 caggagtgtg aaactgaagt ttccccttca cagactgggg gctcctcagg tgacctgggg 3900 gatatcagct ccttctcctc caaggcatcc agcttacacc gcacatcaag tgggacaagt 3960 ctctcagcta tgcacagcag tggaagctca gggaaaggag ccggaccact cagagggaaa 4020 accagcggga cagaacccgc agattttgcc ttacccagct cccgaggagg cccaggaaaa 4080 ctgagtccta gaaaaggggt cagtcagaca gggacgccag tgtgtgagga ggatggtgat 4140 gcaggccttg gcatcagaca gggagggaag gctccagtca cgcctcgtgg gcgtgggcga 4200 aggggccgcc caccttctcg gaccactgga accagagaaa cagctgtgcc tggccccttg 4260 ggcatagagg acatttcacc taacttgtca ccagatgata aatccttcag ccgtgtcgtg 4320 ccccgagtgc cagactccac cagacgaaca gatgtgggtg ctggtgcttt gcgtcgtagt 4380 gactctccag aaattccttt ccaggctgct gctggccctt ctgatggctt agatgcctcc 4440 tctccaggaa atagctttgt agggctccgt gttgtagcca agtggtcatc caatggctac 4500 ttttactctg ggaaaatcac acgagatgtc ggagctggga agtataaatt gctctttgat 4560 gatgggtacg aatgtgatgt gttgggcaaa gacattctgt tatgtgaccc catcccgctg 4620 gacactgaag tgacggccct ctcggaggat gagtatttca gtgcaggagt ggtgaaagga 4680 cataggaagg agtctgggga actgtactac agcattgaaa aagaaggcca aagaaagtgg 4740 tataagcgaa tggctgtcat cctgtccttg gagcaaggaa acagactgag agagcagtat 4800 gggcttggcc cctatgaagc agtaacacct cttacaaagg cagcagatat cagcttagac 4860 aatttggtgg aagggaagcg gaaacggcgc agtaacgtca gctccccagc cacccctact 4920 gcctccagta gcagcagcac aacccctacc cgaaagatca cagaaagtcc tcgtgcctcc 4980 atgggagttc tctcaggcaa aagaaaactt atcacttctg aagaggaacg gtcccctgcc 5040 aagcgaggtc gcaagtctgc cacagtaaaa cctggtgcag taggggcagg agagtttgtg 5100 agcccctgtg agagtggaga caacaccggt gaaccctctg ccctggaaga gcagagaggg 5160 cctttgcctc tcaacaagac cttgtttctg ggctacgcat ttctccttac catggccaca 5220 accagtgaca agttggccag ccgctccaaa ctgccagatg gtcctacagg aagcagtgaa 5280 gaagaggagg aatttttgga aattcctcct ttcaacaagc agtatacaga atcccagctt 5340 cgagcaggag ctggctatat ccttgaagat ttcaatgaag cccagtgtaa cacagcttac 5400 cagtgtcttc taattgcgga tcagcattgt cgaacccgga agtacttcct gtgccttgcc 5460 agtgggattc cttgtgtgtc tcatgtctgg gtccatgata gttgccatgc caaccagctc 5520 cagaactacc gtaattatct gttgccagct gggtacagcc ttgaggagca aagaattctg 5580 gactggcaac cccgtgaaaa tcctttccag aatctgaagg tactcttggt atcagaccaa 5640 cagcagaact tcctggagct ctggtctgag atcctcatga ctggtggtgc agcctctgtg 5700 aagcagcacc attcaagtgc ccataacaaa gatattgctt taggggtatt tgatgtggtg 5760 gtgacggacc cctcatgccc agcctcggtg ctgaagtgtg ctgaagcatt gcagctgcct 5820 gtggtgtcac aagagtgggt gatccagtgc ctcattgttg gggagagaat tggattcaag 5880 cagcatccaa aatataaaca cgattatgtt tctcactaa 5919 <210> 4 <211> 21 <212> DNA <213> Artificial <220> <223> 3785-3805 region of 53BP1 mRNA <400> 4 gaacagaagt agaaagaaaa g 21 <210> 5 <211> 21 <212> DNA <213> Artificial <220> <223> 2686-2706 region of 53BP1 mRNA <400> 5 tgtgaaagtt ctagtgaaac c 21 <210> 6 <211> 21 <212> DNA <213> Artificial <220> <223> 5276-5296 region of 53BP1 mRNA <400> 6 gtgaagaaga ggaggaattt t 21 <210> 7 <211> 21 <212> DNA <213> Artificial <220> <223> 198-218 region of 53BP1 mRNA <400> 7 acaaacagct ggagaagaac g 21 <210> 8 <211> 21 <212> DNA <213> Artificial <220> <223> 841-861 region of 53BP1 mRNA <400> 8 gcacaagaac ttatggaaag t 21 <210> 9 <211> 21 <212> DNA <213> Artificial <220> <223> 3208-3228 region of 53BP1 mRNA <400> 9 ggagaagagg agaaagaaaa a 21 <210> 10 <211> 21 <212> DNA <213> Artificial <220> <223> 407-427 region of 53BP1 mRNA <400> 10 gagaagagtt ggaacagaag g 21 <210> 11 <211> 21 <212> DNA <213> Artificial <220> <223> 1982-2002 region of 53BP1 mRNA <400> 11 ggtctgaggt ggaagaaatc c 21 <210> 12 <211> 21 <212> DNA <213> Artificial <220> <223> 4726-4746 region of 53BP1 mRNA <400> 12 ggccaaagaa agtggtataa g 21 <210> 13 <211> 21 <212> DNA <213> Artificial <220> <223> 4584-4604 region of 53BP1 mRNA <400> 13 gggcaaagac attctgttat g 21 <210> 14 <211> 21 <212> DNA <213> Artificial <220> <223> 4028-4048 region of 53BP1 mRNA <400> 14 ggacagaacc cgcagatttt g 21 <210> 15 <211> 21 <212> DNA <213> Artificial <220> <223> 1992-2012 region of 53BP1 mRNA <400> 15 ggaagaaatc cctgagacac c 21 <210> 16 <211> 21 <212> DNA <213> Artificial <220> <223> 3978-3998 region of 53BP1 mRNA <400> 16 cagtggaagc tcagggaaag g 21 <210> 17 <211> 21 <212> DNA <213> Artificial <220> <223> 1420-1440 region of 53BP1 mRNA <400> 17 gggaagaaag atggagatat g 21 <210> 18 <211> 21 <212> DNA <213> Artificial <220> <223> 2836-2856 region of 53BP1 mRNA <400> 18 ccagaaagca ccatagcaac c 21 <210> 19 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 19 ccgggaacag aagtagaaag aaaagctcga gcttttcttt ctacttctgt tctttttg 58 <210> 20 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 20 aattcaaaaa gaacagaagt agaaagaaaa gctcgagctt ttctttctac ttctgttc 58 <210> 21 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 21 ccggtgtgaa agttctagtg aaaccctcga gggtttcact agaactttca catttttg 58 <210> 22 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 22 aattcaaaaa tgtgaaagtt ctagtgaaac cctcgagggt ttcactagaa ctttcaca 58 <210> 23 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 23 ccgggtgaag aagaggagga attttctcga gaaaattcct cctcttcttc actttttg 58 <210> 24 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 24 aattcaaaaa gtgaagaaga ggaggaattt tctcgagaaa attcctcctc ttcttcac 58 <210> 25 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 25 ccggacaaac agctggagaa gaacgctcga gcgttcttct ccagctgttt gttttttg 58 <210> 26 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 26 aattcaaaaa acaaacagct ggagaagaac gctcgagcgt tcttctccag ctgtttgt 58 <210> 27 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 27 ccgggcacaa gaacttatgg aaagtctcga gactttccat aagttcttgt gctttttg 58 <210> 28 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 28 aattcaaaaa gcacaagaac ttatggaaag tctcgagact ttccataagt tcttgtgc 58 <210> 29 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 29 ccggggagaa gaggagaaag aaaaactcga gtttttcttt ctcctcttct cctttttg 58 <210> 30 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 30 aattcaaaaa ggagaagagg agaaagaaaa actcgagttt ttctttctcc tcttctcc 58 <210> 31 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 31 ccgggagaag agttggaaca gaaggctcga gccttctgtt ccaactcttc tctttttg 58 <210> 32 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 32 aattcaaaaa gagaagagtt ggaacagaag gctcgagcct tctgttccaa ctcttctc 58 <210> 33 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 33 ccggggtctg aggtggaaga aatccctcga gggatttctt ccacctcaga cctttttg 58 <210> 34 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 34 aattcaaaaa ggtctgaggt ggaagaaatc cctcgaggga tttcttccac ctcagacc 58 <210> 35 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 35 ccggggccaa agaaagtggt ataagctcga gcttatacca ctttctttgg cctttttg 58 <210> 36 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 36 aattcaaaaa ggccaaagaa agtggtataa gctcgagctt ataccacttt ctttggcc 58 <210> 37 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 37 ccgggggcaa agacattctg ttatgctcga gcataacaga atgtctttgc cctttttg 58 <210> 38 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 38 aattcaaaaa gggcaaagac attctgttat gctcgagcat aacagaatgt ctttgccc 58 <210> 39 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 39 ccggggacag aacccgcaga ttttgctcga gcaaaatctg cgggttctgt cctttttg 58 <210> 40 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 40 aattcaaaaa ggacagaacc cgcagatttt gctcgagcaa aatctgcggg ttctgtcc 58 <210> 41 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 41 ccggggaaga aatccctgag acaccctcga gggtgtctca gggatttctt cctttttg 58 <210> 42 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 42 aattcaaaaa ggaagaaatc cctgagacac cctcgagggt gtctcaggga tttcttcc 58 <210> 43 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 43 ccggcagtgg aagctcaggg aaaggctcga gcctttccct gagcttccac tgtttttg 58 <210> 44 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 44 aattcaaaaa cagtggaagc tcagggaaag gctcgagcct ttccctgagc ttccactg 58 <210> 45 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 45 ccgggggaag aaagatggag atatgctcga gcatatctcc atctttcttc cctttttg 58 <210> 46 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 46 aattcaaaaa gggaagaaag atggagatat gctcgagcat atctccatct ttcttccc 58 <210> 47 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 47 ccggccagaa agcaccatag caaccctcga gggttgctat ggtgctttct ggtttttg 58 <210> 48 <211> 58 <212> DNA <213> Artificial <220> <223> Primer for shRNA targeting 53BP1 <400> 48 aattcaaaaa ccagaaagca ccatagcaac cctcgagggt tgctatggtg ctttctgg 58

Claims (15)

A 53BP1 mutant protein in which the serine at position 380 in the amino acid sequence of SEQ ID NO: 2 is substituted with alanine (A); A polynucleotide encoding a 53BP1 variant protein in which the serine at position 380 in the amino acid sequence of SEQ ID NO: 2 is substituted with alanine (A); And The pharmaceutical composition for preventing or treating cancer comprising at least one selected from the group consisting of a recombinant vector containing the polynucleotide. According to claim 1,
The composition is a pharmaceutical composition for the prevention or treatment of primary cancer. According to claim 1,
The composition is a pharmaceutical composition for the treatment of p53 deficiency or mutant solid cancer. A 53BP1 mutant protein in which the serine at position 380 in the amino acid sequence of SEQ ID NO: 2 is substituted with alanine (A); A polynucleotide encoding a 53BP1 variant protein in which the serine at position 380 in the amino acid sequence of SEQ ID NO: 2 is substituted with alanine (A); And anti-cancer adjuvant composition for improving, improving or enhancing the sensitivity of the anti-cancer agent comprising at least one selected from the group consisting of a recombinant vector containing the polynucleotide. A polynucleotide encoding a 53BP1 variant protein in which the serine at position 380 in the amino acid sequence of SEQ ID NO: 2 is substituted with alanine (A); And Gene therapy composition comprising at least one selected from the group consisting of a recombinant vector containing the polynucleotide.
delete delete delete delete delete delete delete delete delete delete

Images