CN109097405A - A kind of bulbus fritillariae cirrhosae endogenetic fungus mediates biological synthesis method and the application of nano silver - Google Patents

A kind of bulbus fritillariae cirrhosae endogenetic fungus mediates biological synthesis method and the application of nano silver Download PDF

Info

Publication number
CN109097405A
CN109097405A CN201811027521.0A CN201811027521A CN109097405A CN 109097405 A CN109097405 A CN 109097405A CN 201811027521 A CN201811027521 A CN 201811027521A CN 109097405 A CN109097405 A CN 109097405A
Authority
CN
China
Prior art keywords
nano silver
endogenetic fungus
silver
bulbus fritillariae
fritillariae cirrhosae
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201811027521.0A
Other languages
Chinese (zh)
Inventor
吴卫
邓克莉
苏天骄
陈银银
侯凯
张慧慧
石宪
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sichuan Agricultural University
Original Assignee
Sichuan Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sichuan Agricultural University filed Critical Sichuan Agricultural University
Priority to CN201811027521.0A priority Critical patent/CN109097405A/en
Publication of CN109097405A publication Critical patent/CN109097405A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P3/00—Preparation of elements or inorganic compounds except carbon dioxide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae

Abstract

The invention belongs to biosynthesis technology fields, disclose biological synthesis method and application that a kind of bulbus fritillariae cirrhosae endogenetic fungus mediates nano silver, it is reacted using bulbus fritillariae cirrhosae endogenetic fungus soak with silver nitrate solution, after carrying out primary dcreening operation to 15 plants of isolated bulbus fritillariae cirrhosae endogenetic fungus, nano silver 4-AgNPs and 13-AgNPs are prepared by biological synthesis process using bulbus fritillariae cirrhosae endogenetic fungus CBY4 and CBY13；In biosynthetic process, synthesis condition are as follows: pH3-11, silver nitrate solution concentration are 2mmol/L, and 2000Lux illumination is strong, 50 DEG C.Present invention firstly discovers that the endogenetic fungus CBY4 and CBY13 that separate in bulbus fritillariae cirrhosae have the ability of synthesizing nano-silver, optimization has obtained the reaction condition that a comparison is suitble to its nano silver to synthesize, while finding that the nano silver of synthesis has certain antibacterial and anti-tumor activity.

Description

A kind of bulbus fritillariae cirrhosae endogenetic fungus mediates biological synthesis method and the application of nano silver
Technical field
The invention belongs to the biologies that biosynthesis technology field more particularly to a kind of bulbus fritillariae cirrhosae endogenetic fungus mediate nano silver Synthetic method and application.
Background technique
Currently, the prior art commonly used in the trade is such that
1, the analysis status of endogenetic fungus
Endogenetic fungus is between a kind of histocyte for moving in health plant or intracellular, and not will cause obvious disease disease The fungi of shape.Successfully isolate first plant of endogenetic fungus from the seed of rye grass from scientists such as vogl in 1898,120 Nian Lai, the analysis about endogenetic fungus were never interrupted, and the analysis of endogenetic fungus has covered entire plant kingdom at present, no Pipe is common rudimentary plant such as moss, lichens etc. or the high higher plant such as ginseng, dendrobium candidum etc. of economic value.Especially It is in 1993, and Montana, United States stand university doctor Strobel etc. and separate from the bast of yewtree for the first time Endogenetic fungus to 1 plant of energy synthesizing new cancer-resisting substance taxol pacifies the mould Taxomyces andreanae of De Shi Japanese yew, this point Analysis result is direct and convincingly demonstrating plant endogenesis epiphyte can synthesize and the same or similar active constituent of host plant.Hereafter The the isolating and purifying of plant endogenesis epiphyte, strain idenfication, Activity determination are increasingly becoming analysis hot spot.
The diversity of 1.1 endogenetic fungus
Endogenetic fungus is widely present in entire plant kingdom, is a huge and special fungi monoid, compared to other Fungi monoid, still in its infancy, educational circles also knows little about it to the type and quantity of endogenetic fungus for the analysis of endogenetic fungus. For initial Hawksworth in estimating nature when quantity existing for fungi, there is no count endogenetic fungus.
Scholar can be separated to endogenetic fungus in varying numbers out of plant that analyzed, show that endogenetic fungus is It is intracorporal to be prevalent in plant, quantity is several to nearly hundred kinds from ten, also never occurs without isolated endogenetic fungus Phenomenon.Tian little Man etc. has successfully been isolated out 12 plants of Nei Shengzhen from three root of compositae plant sweet wormwood, stem, leaf different parts Bacterium.5 etc. are successfully separated to obtain 58 plants of endogenetic fungus from the radix scrophulariae in two producing regions.Qin Sheng etc. is with a kind of chichipe The fleshy stem of Opuntiamicrodasys (Lehm.) Pfeiff is material, and therefrom separation obtains 31 plants of endogenetic fungus.Li Zhiying Deng with the lateral root of the medicinal plant rhizome of Chinese monkshood, stem, leaf, flower for material, from this four different parts separation obtain 164 plants of Nei Shengzhen Bacterium[8].Average every kind of host at least obligate Nei Shengzhen of 4-5 kind is found when carrying out specific assays to endogenetic fungus and host Bacterium, if by the earth at present oneself verify existing 250,000 kinds of plants and calculate, then the sum of entire plant kingdom's endogenetic fungus can surpass Cross 1,000,000 kinds.
The effect of 1.2 endogenetic fungus
Endogenetic fungus as one kind lives in the intracorporal fungi monoid of host plant for a long time, with the long-term coevolution of host During form special mutualistic symbiosis relationship.One side host plant can be provided for endogenetic fungus needed for growth Nutriment and habitat, another aspect endogenetic fungus can also synthesize some pairs of advantageous active constituents of host plant.Cause This endogenetic fungus plays an important role to the growth and development of host plant and differentiation of evolving.
1.2.1 promote the growth of host plant
Endogenetic fungus has the function of that plant growth, the discovery such as Behie green muscardine fungus Metarhizium can be enhanced Robertsii provides a kind of effective nitrogen route of metastasis by the effect of mycelia for plant host.Under the action of green muscardine fungus, 15 labeled nitrogen in insect bodies, finally appeared in the form of two kinds of amino acid Kidney bean Phaseolus vulgaris and In two kinds of plants of switchgrass Panicum virgatum, it was demonstrated that green muscardine fungus can promote plant that nitrogen is absorbed and utilized.It is bright Do the good endogenetic fungus D16 for being experimentally confirmed the important Salvia miltiorrhiza Bge Salvia miltiorrhiza Bge. in China and generating There is apparent facilitation to the growth of Hairy Root Cultures of Salvia miltiorrhiza.Lee can strong analysis find English ryegrass generate Nei Shengzhen Bacterium can promote host plant to grow under greenhouse pot culture and field condition.Tiller number, height growth with endogenetic fungus population Rate, tiller growth rate, leaf width, overground part tissue water content are all remarkably higher than without endogenetic fungus population and control population (P < 0.05), this absolutely proves that endogenetic fungus has apparent facilitation, endogenetic fungus bacterial bearing rate to English ryegrass growth Higher, this facilitation is more obvious.
Endogenetic fungus has the function of that the substance for promoting plant growth and development, such as auxin, gibberellin can be synthesized.? Collect intelligent equal selection 5 kinds of endogenetic fungus isolated from orchidaceae medicinal plant to ferment, from fungal fermented filtrate and mycelium Middle to extract plant hormone respectively, being analyzed and identified wherein includes gibberellin (GA3), heteroauxin (IAA), abscisic acid (ABA), zeatin (Z), 5 Plant Hormone of ribosylzeatin (ZR), and these hormones have the growth of orchidaceae medicinal plant Good facilitation.
1.2.2 enhance the degeneration-resistant border of host plant and the ability of pest and disease damage
Waqas etc. has found that the plant hormone that paecilomycerol P.formosus LWL1 is generated and organic acid have and alleviates japonica rice Effect in terms of heat stress can significantly improve plant growth situation, including plant height, fresh weight, dry weight and chlorophyll content, and have There is the total protein concentration of lower endogenous stress signal chemical levels and promotion, is conducive to crop and grows under high temperature environment Tolerance.Song Meiling is experimentally confirmed the halophytes wild barley Hordeum with endogenetic fungus population The brevisubulatum germination percentage of seed, germination index and offspring length, relative water content and leaf under condition of salt stress is green Content (P < 0.05), SOD, POD and CAT enzymatic activity, Nutrient Absorption and the transport of element, carotenoid and Proline Ability is all remarkably higher than control group.Yao etc. is analysis shows from isolated 655 plants of subprostrate sophora Sophora tonkinensis There are 6 plants of bacterium to have significant inhibitory activity to three kinds of disease fungus of Radix Notoginseng Panax notoginseng in endogenetic fungus.
1.2.3 synthesizing metabolite abundant
Ludwig-M ü ller points out that the partial or complete biosynthesis pathway of Secondary metabolites may be with plant Intracorporal endophyte is related, and endophyte can also synthesize same or similar active material.Strobel analysis is found from interior May separate out 51% biologically active novel substance in raw fungi, and from edaphon be only capable of isolating 38% it is new Substance.A large amount of bioactive substances are separated to from endogenetic fungus at present, mainly there is flavones, alkaloid, quinones, cyclic peptide, rouge The compounds such as fat acid, and find that its chemical component has desinsection, hypoglycemic, antibacterial, antiviral and antitumor isoreactivity[21].Simultaneously Because endogenetic fungus have be detached from its host plant can independent growths ability, can successfully cultivate in laboratory conditions Survival.Therefore compared to host plant, endogenetic fungus has individual small, easy culture preservation, and fermentation period is short, free from environmental pollution Deng many-sided advantage, and a large amount of purpose products can be obtained by fermentation endogenetic fungus.These advantages make endogenetic fungus As a kind of important natural drug new sources, also avoids plant resources by exhaustive exploitation, played for protection endangered plants resource Important function.
Liu et al. is isolated in 48 plants from the root of camplotheca acuminata Camptotheca acuminata Decne., branch, leaf and fruit Raw fungi, the method combined using HPLC method with ultraviolet scanning spectrum have obtained the ultraviolet spectra similar to camptothecine and 10 Strain can generate the bacterial strain of camptothecine.And further its anti-tumor activity is screened, as a result, it has been found that 7 plants of bacterial strains obviously press down The growth in vitro of HL-60 cell processed.Liu Yun etc. uses tissue isolation, by separating, purifying Chinese podophyllum root plant root, stem position Endogenetic fungus, one plant of endogenetic fungus Cephalosporium sp. that can produce podophyllotoxin is obtained, using tumor suppression in animal body The fermentation liquid of this plant of endogenetic fungus of experimental analysis has inhibiting effect to mouse S 180 sarcoma, and leucocyte and lymph can be promoted thin The proliferation of born of the same parents.Analytical proof separates Zhang Lingqi etc. from the bast of catharanthus roseus Catharanthus roseus (L.) stem for the first time Fusarium oxysporum Fusariumoxysporum out can generate anticarcinogen vincristine ingredient.
The analysis status of 1.3 bulbus fritillariae cirrhosae endogenetic fungus
Bulbus fritillariae cirrhosae is liliaceous plant bulbus fritillariae cirrhosae Fritillaria cirrhosa D.Don, Fritillaria unibracteata Fritillaria unibracteata Hsiao et K.C.Hsia, Gansu fritillaria Fritillaria przewalskii Maxim., taipei fritillary bulb Fritillaria taipaiensis P.Y.Li or watt cloth fritillaria Fritillaria unibracteata Hsiao et K.C.Hsia var.wabuensis(S.Y.Tang et S.C.Yue)Z.D. Liu, The dry bulb of S.Wang et S.C.chen.Have a clearing heat and moistening lung, preventing phlegm from forming and stopping coughing, dissipating bind disappears the effect of carbuncle.Bulbus fritillariae cirrhosae is as one The rare Chinese herbal medicines of kind have obtained analysis exploitation energetically in recent years.Since endogenetic fungus is a kind of long-term life In the intracorporal fungi monoid of plant, the change that any variation of group can all cause phytobiocoenose to form, and then directly affect Existence, competition and the quality of plant, it is therefore necessary to which bulbus fritillariae cirrhosae endogenetic fungus is further analyzed.
Show that bulbus fritillariae cirrhosae endogenetic fungus is all extremely abundant on value volume and range of product by analysis, tight cloud etc. of casting is from 5 differences In the dry bulb of the bulbus fritillariae cirrhosae of growth period, separation, which obtains, belongs to 90 plants of endogenetic fungus that 1 guiding principle, 6 mesh 30 belongs to.Old magpie etc. from Fritillaria unibracteata, Gansu fritillaria, bulbus fritillariae cirrhosae, Bulbus Fritillariae cirrhosae healthy bulb in be successively separated to 15,13,6,4 kind of endogenetic fungus, Wherein 9 plants of endogenetic fungus energy metabolisms generate alkaloid.
Simultaneously analysis shows isolated bulbus fritillariae cirrhosae endogenetic fungus also has very strong activity.Pan Feng etc. is from bulbus fritillariae cirrhosae Isolated one plant of endogenetic fungus Fusarium tricinctum CBY11, using the measurement of DPPH free radical scavenging activity, always Antioxidative Activity Determination (ABTS method) and total reducing power measurement (FRAP method) three kinds of methods measure its antioxidant activity, as a result Prove that this plant of bacterial strain has very strong antioxidant activity.The discovery such as old magpie is out of in Fritillaria unibracteata, Gansu fritillaria isolated All there is raw fungi tender wait of very strong bacteriostatic activity Su Tian to carry out tyrosinase using 15 plants of endogenetic fungus for being isolated from bulbus fritillariae cirrhosae Activity suppression experiment, the results showed that the fermentation liquid for being isolated from 3 plants of endogenetic fungus of watt cloth fritillaria has higher inhibition tyrosine Enzymatic activity, and certain stability can be kept under high-temperature process.
The analysis of 2 nano silvers synthesis
Nano silver (Silver Nanoparticles) refers to the metallic silver simple substance that partial size is prepared into 1-100nm, as A kind of special silver material, nano silver have physics, the chemistry and biology for being different from common metal silver bullion body and silver ion Property.And as a kind of nano material, nano silver has skin effect, small-size effect, quantum size effect and maroscopic quantity again Sub- tunnel-effect, therefore it can show the peculiar properties such as the heat different from conventional material, light, electricity, magnetic, catalysis and sensitivity.Nanometer Silver has been widely used in catalyst material, antistatic material, low temperature superconducting material, biosensor material and biomedicine Etc., thus nano silver synthesis be prepared into the hot spot analyzed recently.The synthetic method of nano silver is varied, main There are physical method, chemical method and bioanalysis three categories.
2.1 Traditional Method synthesizing nano-silvers
Currently, the synthesis of nano silver is mainly using conventional method, including physical method and chemical method[35].Physics before Method and chemical method are because have many advantages, such as that experiment condition is simple, at low cost, energy saving and is widely applied, in actual production Also both methods is mostly used to carry out scale of mass production greatly.But it is directed to the unstability and toxicity examination of synthesizing nano-silver The problems such as agent, people are larger to this dispute[36]。
2.1.1 physical method
The silver-colored simple substance of bulk is mainly directly become nanoscale with various dispersion technologies by physical method synthesizing nano-silver Silver particles, common method have physical crushing method, vaporization condensation process, sputtering method, atomization and mechanical attrition method etc..Although object The nano silver of logos preparation has the advantages that impurity is few, with high purity, but since this method is very high to appointed condition requirement, and Nano silver partial size usually obtained is larger and is unevenly distributed.Therefore high production cost, condition are not easy to control and energy consumption height becomes The important obstruction that physical method is promoted.
2.1.2 chemical method
Chemical method synthesizing nano-silver is mainly to use the principle of electronation, the use of reducing agent by silver ion reduction is nanometer Argent grain.Mainly there are solution phase chemical reduction, photochemical reduction, electrochemical reducing, micro emulsion method, microwave assisting method etc..Change Learn synthetic method because its condition is simple, at low cost, yield is big, made from nano silver size tunable, it is easy to operate the advantages that, in reality It is widely applied in the production of border.Dong Chunfa uses liquid phase reduction, be reducing agent using lauric acid as dressing agent, hydrazine hydrate, Silver ammino solution is presoma, by regulating and controlling reaction condition, the mass ratio of lauric acid and silver nitrate is adjusted to 1.2:1, in room temperature Under the conditions of can synthesize obtain average grain diameter be 8nm, be evenly distributed, mono-dispersed nano Argent grain.Yan Wenjin is using PEG as mould Plate and reducing agent need to only be passed through H2, the nano silver that partial size is less than 10nm just can be synthesized by this method[46].Fu Ranyan uses liquid phase Chemical reduction method, by N, N-dimethylformamide (DMF) is used as solvent and reducing agent, using polyvinylpyrrolidone (PVP) as table Face activating agent, by controlling changing related experiment condition, the controllable preparation nano silver of different-shape structure.
But chemical method synthesizing nano-silver is needed in the synthesis process using to solvent, reducing agent, stabilizer and protective agent Deng inevitably there are following problems: (1) solvent, stabilizer and protective agent etc. have toxicity more, easily cause environmental pollution；(2) golden It is smaller to belong to presoma solubility, it is easily excessive；(3) chemical reagent is expensive.These factors strongly limit the popularization of chemical method Using.
2.2 bioanalysis synthesizing nano-silvers
As the application of nano silver is promoted deeply by continuous, how low energy efficiently, green synthesizing nano-silver and throws with open arms Enter the hot spot that mass production in industry is increasingly becoming this year to analyze.The nano silver of bioanalysis synthesis is generally obtained than physical method Nano silver partial size it is smaller, be more evenly distributed；The nano silver obtained than chemical method has more biological safety.Bioanalysis is main Using biomaterial and microorganism system come natural synthesizing nano-particle, high temperature and pressure, high energy consumption are not needed, is not needed big yet Amount uses toxic chemical.And bioanalysis is easy to operate, synthesis condition is easy to control, at low cost, free from environmental pollution.
2.2.1 biomaterial synthesizing nano-silver
Bioanalysis is as a kind of method for preparing nanoparticle emerging in recent years, increasingly by everybody concern.From Floristics in right boundary is various, substantial amounts, is the biomaterial of ideal synthesizing nano-particle.Plant itself It is synthesizing nano-particle in the cell, but due to there is inherently concurrent disease etc. into the cell, leads to nanoparticle obtained Separation become highly difficult, it is then now most that nanoparticle is all prepared using plant leaching liquor immersion.In plant leaching liquor immersion Contain various plants metabolite, such as terpene, flavonoids, Polyphenols, biological enzyme compound and its derivative, plant leaching Extract both can be used as reducing agent for Ag+Reduction obtains nano silver particles, while can be used as a kind of coverture again, improves and closes At the stability of obtained nano silver particles, and will not be to environmental concerns.Have now been found that tens kinds of plants can be used In synthesizing nano-silver, such as catharanthus roseus Catharanthus roseus[52], cassia bark Cassia fistula (Linn.), kind litchi Branch Annona squamosa, spinach Spinacia oleracea, aloe Aloe vera[56], wild tea tree Camellia The leaching liquor of the plants such as sinensis, Morinda officinalis Morinda tinctoria, Desert Rose Adenium obesum has all divided Analysis confirms can be with synthesizing nano-silver particle.
2.2.2 microorganism system synthesizing nano-silver
So far, have analysis shows the multiple-microorganism in nature including prokaryotes and eucaryote all Can synthesizing nano-silver, such as bacterium, yeast and fungi, they all have the in the cell or extracellularly energy of synthesizing nano-silver Power.
2.2.2.1 the type of Microbe synthesis nano silver
2.2.2.1.1 bacterium
Bacterium synthesizing nano-silver is reported earliest appears in 1999, isolated one plant of Si Shi vacation from silver ore such as Klaus Monad P.stutzeri AG259, by the bacterium, the culture in the silver salt (50mM AgNO3) of high concentration, is detected by TEM Know, which can largely accumulate silver particles.Xiong Wen isolated one plant of Xie Dian from Northeast Forestry University's forest farm soil Powder enzyme bacillus amyloliquefaciens, synthesized using the inoculum with silver nitrate it is spherical and Subsphaeroidal average grain diameter is the nano-Ag particles of 15nm, and nano silver good dispersion, crystallinity is good, belongs to face-centred cubic structure. Fu Mouxing etc. has found that the dry cell of Aeromonas Aeromonas sp.SH10 can be rapidly by [Ag (NH3) 2]+It is reduced into Ag0 is detected using ultraviolet-visible spectrum, occurs wave crest at 425nm, is had 5 characteristic diffraction peaks in XRD spectrum, is shown Stable Nano silver grain is formd during this biological reducing.Show that silver nano-grain size is equal by TEM and SEM observation It is even, it is dispersed in cell and solution.Sunrise etc. is opened using the cell-free filtrate of Paenibacillus polymyxa Jaas cd in extracellular success Synthesizing nano-silver particle, the nano silver particles partial size of detection discovery synthesis is in 20-50nm, and form is uniform, dispersibility compared with It is good.
2.2.2.1.2 yeast
Analysis in recent years about yeast synthesizing nano-silver is more and more, and Dan analytical proof is made using Pichia yeast powder , as pH≤4, there is no nano silver generation in solution when silver nitrate is precursor for reducing agent；As pH > 4, with pH value Increase, the partial size of nano particle obtained is gradually reduced.And with the raising of the increase of mixing speed and temperature, nanometer The intensity at the UV-Visible absorption peak of silver is gradually increased, but the position at peak illustrates mixing speed and temperature there is no variation The influence spent to nano silver partial size is little.Isolated one plant of extremophile saccharomycete bacterium from the drainage of Portugal's Acid mine such as Ana Strain has obtained the AgNPs that partial size is less than 20nm using the solution reaction of yeast strain and silver ion after cleaning.Apte It has synthesized partial size Deng being reacted with silver nitrate solution using Yarrowia lipolytica Yarrowia lipolytica (NCYC 789) and is The nano-Ag particles of 15nm.
2.2.2.1.3 fungi
The analysis of fungi synthesizing nano-silver achieved huge progress in recent years, as a kind of effective and rapid ground synthesizing nano-silver Method receive more and more attention.For fungi compared with bacterium and yeast, a large amount of enzyme can be secreted by having, separation process letter Single advantage.There are many fungal species to confirm the synthesizing nano-silver particle that can succeed at present.
Li Guangquan utilizes Aspergillus terreus Aspergillus terreus success synthesizing nano-silver for the first time, reacts at 20-37 DEG C It can occur under room temperature, generate spherical or subsphaeroidal nano-Ag particles, particle size has typical case in 1-20nm Center of area hexahedron structure.Outstanding person etc. is opened by the AgNO of hook-shaped trichoderma Trichoderma hamatum, NYZJ03 and 2mmol/L3 Solution, which is blended under dark condition, to react, and culture solution color becomes bronzing, and UV-vis map occurs significantly at 420nm Absorption peak shows there is nano-Ag particles generation, and it is spherical shape that TEM, which detects nano silver particles majority, has monodispersity, partial size point Cloth is between 1-13nm, average grain diameter 6.69nm.Li G etc. utilizes the supernatant of Aspergillus Aspergillus terreus Under normal temperature conditions quickly by Ag+It is reduced into AgNPs, by AgNPs Morphological Characterization, it is found that the AgNPs of synthesis is that one kind is more The spheric granules of dispersion, particle size have good stability between 1-20nm[69].Vala etc. is utilized from India west The silver nitrate of marine fungi aspergillus niger Aspergillus niger and various concentration that the Cambay gulf bank of seashore is separated Solution reaction (0.25-1-mM) is all synthesizing nano silver particles for 24 hours, and the magnitude range of particle is 5-26-nm.Honary etc. Isolated one plant of penicillium citrinum Penicillium citrinum from soil, with silver nitrate solution under 28 DEG C of dark conditions Reaction for 24 hours, can obtain it is uniform in size, average diameter be 109nm ball shaped nano Argent grain.The analytical proofs such as Rodrigues Tabin aspergillus Aspergillus tubingensis and the raw red shell bacterium Bionectria ochroleuca of light color have synthesis The ability of nano silver, the AgNPs of synthesis are spherical shape, and particle size is 35 ± 10nm, and has very strong fungal resistance.
2.2.2.2 the method for Microbe synthesis nano silver
There are mainly two types of the methods of Microbe synthesis nano silver: intracellular synthesis and extracellular synthesis.Intracellular synthesis is received Rice silver mainly using some biological enzyme into the cell as reducing agent by silver ion reduction at nano silver particles, but current machine It makes not yet clear.And it obtains the nano silver synthesized into the cell and needs first to break cell with ultrasonic wave or cell lytic agent Broken, this increases difficulty to the nano silver recovery purifying in downstream.
Extracellular synthesizing nano-silver mainly has 3 kinds of modes: (1) using microbial cells, by cultured microculture Liquid centrifugation or filtering, discard supernatant, collect thallus, thallus removal surface disturbance substance are cleaned repeatedly with distilled water, with nitric acid Silver-colored solution reaction, silver ion can induce thallus to generate the active material that can restore silver ion, but this synthesis process speed is slower. (2) microbial culture supernatant is used, cultured microbial culture medium is centrifuged, supernatant is taken to react with silver nitrate solution, The active material contained in supernatant can be by silver ion reduction at nano silver particles, but ingredient is complicated in supernatant, receives Isolating and purifying for meter Yin is at high cost.(3) cultured microbial culture medium is centrifuged or is filtered by microbial cells soak, is abandoned Fall supernatant, collect thallus, cleans thallus removal surface disturbance substance repeatedly with distilled water, then thallus is resuspended in distilled water For 24 hours, filtering or centrifugation obtain soak and react synthesizing nano-silver with silver nitrate solution again for culture.Active material passes through free diffusing Effect moves in soak, and the interfering substance contained is few, convenient for the separating-purifying of nano silver.
The analysis of 3 nano silver antibacterials
Early in period in 16th century, the mankind just recognize that silver and its compound have extremely strong bacteriostasis, can effectively press down Bacterium, fungi and virus processed.And compared with other materials, silver and its compound are right only to microorganism toxicity with higher The toxicity of mammalian cell performance is then lower and slightly complication.Silverware just is widely used in pressing down by the mankind from that time Bacterium sterilization aspect, such as whether toxic through common acupuncture needle test food in Chinese ancients, high official and noble lord then be used directly silver-colored bowl silver Chopsticks have the function that disinfection and sterilization；In west, Greeks just use silverware potable water storage before The Nativity Story, prevent thin Bacterium breeds.Later people covered wound prevention with silver strip again and festered, and when baby due, which drips upper silver nitrate solution, can prevent mucous membrane Infection.
In the 1930s, people were once ignoring the antibacterial ability of silverware with the discovery of antibiotic and universal, until The appearance of " superbacteria ".Due to the abuse of antibiotic, chromosome mutation of more and more microorganisms by itself, life The modes such as change mechanism, enzyme-deactivating produce drug resistance to antibiotic on the market, and bacterium infection becomes urgent problem to be solved. Sight is focused on antibacterial broad spectrum activity again, is not likely to produce on the silver system anti-biotic material of drug resistance by people.Due to nanometer Silver has small etc. the special nature of nano material monodispersity, partial size, makes it have significant quantum size effect, surface effect Should and quantum tunneling effect, thus make nano silver it is with super strength activity and permeability, antibacterial or bactericidal effect will be than tradition Silver ion it is more preferable.Nano silver not only has the validity period of antibacterial broad spectrum activity, Continuous sterilization long, but also has no drug resistance, safety It is high.Ease etc. is opened by sterility test, systemic acute toxi-city test and SD rat to absorption, metabolic condition silver-colored in the material etc. Test, it was demonstrated that Radix Salviae Miltiorrhizae nano silver composite material is sterile, and apyrogeneity is non-stimulated, and without obvious acute toxicity, and body is to nano silver Absorptance it is few to classical surface of a wound anti-infectious agent flamazine, have good biological safety.She Wen Jun etc. uses MTT Method detects l cell L-929 of the artificial tooth base resin to secondary culture for being added to types of nano-silver base inorganic antibacterial agents Cytotoxicity, the results showed that be added to the denture base resin of low concentration types of nano-silver base inorganic antibacterial agents, without obvious cytotoxicity, With preferable biological safety.Therefore the anti-microbial property of nano silver is by wide popularization and application.It has already appeared on the market at present It is large quantities of that nano silver is penetrated into manufactured antibacterial fabric in fabric, for example antibacterial gauze can be used for treating burn, scald, It can effectively prevent by burning, scalding caused bacterium infection, effect is more preferable than the flamazine of clinical use.It will also receive Rice ag material combines to form a kind of new domestic ceramics with ceramic material --- and nano-antibacterial (sterilization) ceramics are keeping making pottery Ceramic products it is original using function and decorative effect while, increase the function of its disinfection, sterilization and chemical degradation.Ling etc. is adopted Use carboxymethyl chitosan quaternary ammonium salt (QCMC) and organo montmorillonite (OMMT) as reducing agent and stabilizer, synthesis obtains nanometer Silver.Anti-bacteria paper is prepared by way of surface covering and internal addition using the AgNPs of acquisition as antibiotic paint.
3.1 nano silver antibacterial mechanism
Nano silver has efficient sterilizing and antibacterial broad spectrum activity, and antibacterial mechanisms are the emphasis of numerous experts and scholars' analyses, To provide theoretical foundation for single-minded from now on, high-efficiency antimicrobial, however the antibacterial mechanisms of nano silver are not also very clear at present. Analysis shows, the antibacterial mechanisms of relatively approval mainly have at present: (1) AgNPs is constantly sustained Ag by a large amount of+, keep long-acting anti- Bacterium ability.The analyses such as Lu find the AgNPs release Ag of different-shape+Quantity and speed it is different, Ag+Burst size is more, antibacterial energy Power is stronger.(2) mycoderm is destroyed, changes the form and structure of somatic cells, reaches antibacterial purpose.Liu et al. is found through experiments that AgNPs can react with the compound for being attached to the sulfur-bearing of bacterial cell film surface, phosphorus, destroy the integrality of film.(3) With the interaction of sulfydryl, bacterium key enzyme is caused to inactivate.The AgNPs such as Sotiriou can be with the ammonia on bacterium functional protein Base acid residue --- sulfydryl interaction changes the structure of enzyme, eventually leads to key enzyme inactivation.(4) inhibit bacterium DNA replication, Reduce cell splitting rate.There is document report to say that AgNPs is likely to result in the condensation of DNA, thus cause DNA replication dna reduce and Degradation has the function that inhibit bacterial growth.(5) it penetrates mycoderm and enters cell, block respiratory chain.5 μ g/ml of Li et al. AgNPs handles Escherichia coli (E.coli) after ten minutes, and the activity of respiratory chain dehydrogenase is preferably minimized, and AgNPs concentration is got over Height, enzymatic activity are lower.
3.2 nano silvers inhibit biomembrane
Biomembrane (Biofilm, BF) be bacterium during the growth process, for adapt to living environment variation and be adsorbed in inertia Or corresponding with planktonic cells (Planktoniccell) growth pattern of one kind that surface of active material is formed, by bacterium with Extracellular matrix (extracellular polymeric substances, the EPS) composition of itself secretion.Such bacterium is biological In film is tightly wrapped in, there is significant difference on morphosis and biochemical characteristic with common planktonic cells, it is clear to immunity of organism Except the bactericidal effect resistance of effect and antibiotic substantially enhances.Bacterium can also easily cause infection from BF to external diffusion, and Infection site is difficult to thoroughly remove, and recurrent exerbation is difficult to control.
Prevention inhibits biomembrane mainly to take following methods: (1) Mechanical Method (sound splits, vortex and ultrasonic wave)；(2) raw Change method (enzymatic treatment)；(3) electro photoluminescence.But these processing methods all produce little effect, and there is no discovery simple and effective both at home and abroad at present Measure.There is document report to claim, nano silver particles suffer from powerful killing effect to flcating germ and its BF formed.Radzig Equal discoveries are by caseinhydrolysate peptide, the partial size biology of Escherichia coli AB1157 that has been the AgNPs strong inhibition of 8.3nm The formation of film.Park etc. by the glass sheet grow two days pseudomonas aeruginosa P. aeruginosa PA01 biomembrane with AgNPs reaction, biofilm cells just inactivate quickly.
The antitumor analysis of 4 nano silvers
Malignant tumour has very high pathogenicity rate and lethality, seriously threatens the health of the mankind.According to world health group Statistics is knitted, only the whole world in 2012 just reaches 8,200,000 people because of the number of mortality of malignant tumors, accounts for the 13% of all death tolls, dislikes Property tumour has become " the first killer " of human health.Traditional tumor therapeuticing method has: operation excision, chemotherapy and radiation Deng although there is certain curative effect, with limitation and side effect.It is larger that operation excision is only applicable to volume, easy to operate to cut The tumour removed；The targeting of chemotherapy is poor, with very strong cytotoxicity and drug resistance；Radiotherapy uses radiation exposure, to normal thin Born of the same parents have an impact.Urgently novel technology and drug is used for the diagnosing and treating of malignant tumour now.
As experts and scholars explore the continuous excavation of nano silver, nano silver not only has Efficient antibacterial, thin to tumour The diagnosing and treating of born of the same parents also functions to increasingly important role.Since nano silver has localized surface plasmons resonance effect (localized surface plasmon resonance, LSPR), i.e. incident photon can be sent out with nanometer silver surface free electron Raw resonant reaction.Nano silver can be used as the contrast agent of x-ray imaging, detect the intracorporal tumour cell of mouse.The exploitation such as Zhao A kind of novel reusable nano silver LSPR biosensor detects squamous cell carcinoma in cervical cancer patient serum Antigen (SCCa), the optimum range of linear quantitative detection are 0.1-1000pM.Guo etc. reports polyvinylpyrrolidone (PVP) The AgNPs of cladding can cause active oxygen (ROS) in acute myeloid leukemia (AML) cell to generate, mitochondrial membrane potential (MMP) it loses, DNA damage, so as to cause AML Apoptosis.The analysis such as FaedmalekiIt was found that AgNPs is to tumour cell The inhibiting effect of (HepG2 cell) compares normal cell (primary liver cell of mouse) and enhances 44 times, it was demonstrated that AgNPs is A kind of cytotoxic drug and potential anticancer drug candidate.The analytical proofs such as Nazir AgNPs is to human skin maligna Plain tumor HT144 and prognosis of squamous cell lung cancer H157 has very strong inhibiting effect, the growth inhibition dosage of tumour cell 50% (ID50) it is 3.6 μM of ol.
In conclusion problem of the existing technology is:
There are mainly two types of the methods of Microbe synthesis nano silver: intracellular synthesis and extracellular synthesis.Intracellular synthesis is received Rice silver mainly using some biological enzyme into the cell as reducing agent by silver ion reduction at nano silver particles, but current machine It makes not yet clear.
And obtain the nano silver that synthesizes into the cell and need first with ultrasonic wave or cell lytic agent by clasmatosis, this Difficulty is increased to the nano silver recovery purifying in downstream.Not can determine that on earth is which kind of biological enzyme is specifically working, or more Kind Bio-enzyme Combined Pre-treatment acts on synthesizing nano-silver.
Existing synthesis needs expensive equipment and instrument, and synthesis cost is high, and the nano silver partial size synthesized is very big, point Cloth is uneven, and the waste liquid generated in synthesis process will cause pollution to environment.
Solve the difficulty and meaning of above-mentioned technical problem:
The purifies and separates of monomer are difficult, and are difficult for cell metabolite and nano silver to be kept completely separate.
Present invention demonstrates that this endogenetic fungus of bulbus fritillariae cirrhosae can generate nano silver with nitric acid silver reaction, there is synthesis nanometer The bioactivity of silver (existing research proves that the endogenetic fungus of other plant has the activity).And the nano silver generated has Certain antibacterial and anti-tumor activity
The present invention does not need expensive equipment and instrument, can mediate biosynthesis nanometer using bulbus fritillariae cirrhosae endogenetic fungus Silver, synthesis cost is lower, and the nano silver partial size synthesized is smaller, is more evenly distributed, without using poisonous and hazardous in synthesis process Chemicals, the waste liquid generated after synthesis do not pollute the environment.
Summary of the invention
In view of the problems of the existing technology, the present invention provides the biologies that a kind of bulbus fritillariae cirrhosae endogenetic fungus mediates nano silver Synthetic method and application.
The invention is realized in this way a kind of bulbus fritillariae cirrhosae endogenetic fungus mediates the biological synthesis method of nano silver, comprising:
It is reacted using bulbus fritillariae cirrhosae endogenetic fungus soak with silver nitrate solution, to 15 plants of isolated bulbus fritillariae cirrhosae Nei Shengzhen Bacterium carry out primary dcreening operation after, using bulbus fritillariae cirrhosae endogenetic fungus CBY4 and CBY13 by biological synthesis process prepare nano silver 4-AgNPs with 13-AgNPs；
In biosynthetic process, synthesis condition are as follows: pH3-11, silver nitrate solution concentration are 2mmol/L, 2000Lux illumination By force, 50 DEG C.
Two kinds of strains of CBY4 and CBY13 are that separation early period of the invention has obtained, and gene order is submitted to NCBI GenBank；Log in network address are as follows:https://www.ncbi.nlm.nih.gov。
Obtain sequence number CBY4: and CBY13:MH059783；
Confirm that CBY4 and CBY13 is fusarium tricinctum by phylogenetic tree construction.
CBY4 is stored in China Committee for Culture Collection of Microorganisms's common micro-organisms center, number of registering on the books are as follows: CGMCC NO.9719.
October 11 2014 preservation time.
Further, the synthetic method of the bulbus fritillariae cirrhosae endogenetic fungus biosynthesis nano silver further comprises:
(1) fermentation of endogenetic fungus
Bacterial strain activation: accessing in the PDA plate culture medium of Fresh from picking mycelia in the inclined-plane PDA for saving strain, It is placed in 28 DEG C of culture 3-5d activation in biochemical cultivation case；
Fermentation liquid preparation: it is beatened to take bacteria cake at activated bacterial strain flat board edge with 5mm punch, bacteria cake according to one bottle one The mode of bacteria cake is inoculated into the triangular flask equipped with PDB；28 DEG C, 120r/min are placed in constant-temperature shaking incubator, shaken cultivation 7d；
(2) microorganism collection and secondary fermentation of endogenetic fungus
Endogenetic fungus fermentation liquid is filtered, thallus is collected, is washed repeatedly with deionized water 3-4 times until filtered solution is in colourless； It takes a certain amount of thallus to be immersed in and carries out secondary fermentation in the deionized water of former fermentation system same volume, 28 DEG C, 120r/ Min, shaken cultivation is for 24 hours.Thallus soak is filtered, filtrate is collected；
(3) primary dcreening operation of biosynthesis nano silver
Fresh concentration is the silver nitrate solution of 1mmol/L, by thallus soak and AgNO3Solution according to 9:1 ratio Example is mixed, and reaction is stood under normal temperature and pressure conditions, will be not added with AgNO3Isometric soak of solution is set as blank pair According to；After reacting a period of time, nano silver characteristic absorption peak is detected in conjunction with UV-2600 ultraviolet-uisible spectrophotometer, is judged whether There is the index that nano silver is synthetically produced；
(4) identification of endogenetic fungus.
Further, the identification of endogenetic fungus includes:
A) Morphological Identification:
Micro-morphology analysis is carried out to the bacterial strain CBY4 and CBY13 of screening；
B) molecular biology identification:
The genomic DNA of bulbus fritillariae cirrhosae endogenetic fungus CBY13 is extracted using classical CTAB method:
It is put into mortar with the wet thallus of aseptic inoculation needle picking about 5g or so, liquid nitrogen grinding is added, it will be ground thin Powder is transferred in the sterile centrifugation tube of 50mL, is stored in -20 DEG C of refrigerator overnights.
It takes out sample and 15mL buffer is added into sterile centrifugation tube, the NaCl and 2mLCTAB for adding 3mL 5mol are split Solve liquid, 65 DEG C of incubation 45min (, then 37 DEG C of incubation 15min.
20mLde chloroform: isoamyl alcohol=24:1 mixed liquor is added；It is uniformly mixed, after being placed at room temperature for 10min, 12000r/min It is centrifuged 20min, discards supernatant the slow mixing of isopropanol of addition 11mL after liquid；
With centrifugal process 8000r/min centrifugation 10min collect nucleic acid particle, by the nucleic acid particle to precipitate with 70% second Alcohol is cleaned, natural air drying 10min；
Obtained nucleic acid particle is suspended in 5mL sterile water；0.5mg DNase-free RNase, 37 DEG C of incubations are added 30min；
5mLde chloroform: isoamyl alcohol=24:1 mixed liquor, then plus 5mL phenol extraction DNA is added；
4mL isoamyl alcohol is added and precipitates DNA, then 8000r/min is centrifuged 10min.
Liquid is discarded supernatant, the DNA particle to precipitate is cleaned with 70% ethyl alcohol, and natural air drying is then dissolved in 0.5mL TE buffer in (10 mM Tris-HCl and 0.1mmol EDTA, pH 7.5)；
The region target ITS1-5.8S rDNA-ITS2 is expanded with universal primer ITS1 and ITS4:
PCR primer: 5 '-TCCGTAGGTGAACCTGCGG-3 ' of upstream primer ITS1 and downstream primer ITS4 5 '- TCCTCCGCTTATTGATATGC-3′；
PCR system: 15 μ L of each 0.75 μ L of upstream and downstream primer, 2.0 μ L, 2 × Taq PCR Master Mix of DNA solution, water 11.5 μ L, whole system totally 30 μ L；
PCR reaction condition: 95 DEG C of initial denaturation 5min；94 DEG C of denaturation 45S, 52 DEG C of annealing 30S, 72 DEG C of extension 3min, 40 It recycles, then 72 DEG C of extension 15min；
Be sequenced after cutting glue purification to the PCR product come is amplified, column will be sequenced and be submitted to NCBI BLAST comparison is carried out on GenBank database, and the maximum and representative strain benefit of similarity is chosen according to comparison result Clustering is carried out using neighbor- joining (NJ) method with MEGA5.10 software
Further, the synthetic method of the bulbus fritillariae cirrhosae endogenetic fungus biosynthesis nano silver further comprises:
The monitoring of nano silver synthesis process:
By the AgNO of soak and 1mmol/L3After solution is according to the ratio hybrid reaction of 9:1, in different times point 0h, 1h, 2h, 4h, 8h, 12h, for 24 hours, 48h and 72h take a certain amount of sample, using UV-2600 ultraviolet-uisible spectrophotometer to sample Full wavelength scanner is carried out, the variation of nano silver synthesis process is detected；
The optimization of nano silver synthesis condition:
Analyze different illumination intensity, pH, AgNO3Influence of the concentration and temperature of solution to nano silver synthesis rate, to this 4 A factor optimizes；Different pH is 3.0,4.0,5.0,6.0,7.0,8.0,9.0,10.0 and 11.0；Different AgNO3 The concentration of solution is 0.5,1,1.5,2,2.5,3,3.5mmol/L；Different intensities of illumination be 0,1000Lux, 1500Lux, 2000Lux and different temperature are 4 DEG C, 25 DEG C and 50 DEG C.After reacting 48h at different conditions respectively, a small amount of sample is taken, benefit Full wavelength scanner is carried out to sample with ultraviolet-uisible spectrophotometer；
The characterization of optimum synthesis nano silver:
Utilize the micromorphology of transmission electron microscope analysis nano silver:
It supports film copper mesh to place 3-5min in carbon sample drop, then sucks surplus liquid with filter paper；
It supports film copper mesh to place 2-3min in carbon 2% phosphotungstic acid drop, sucks surplus liquid, drying at room temperature with filter paper；
It is observed under transmission electron microscope, acquires image analysis.
Another object of the present invention is to provide a kind of biosynthesis for mediating nano silver using the bulbus fritillariae cirrhosae endogenetic fungus The bulbus fritillariae cirrhosae endogenetic fungus of method synthesis mediates nano silver, the bulbus fritillariae cirrhosae endogenetic fungus mediate nano silver be 4-AgNPs and 13-AgNPs。
Another object of the present invention be to provide it is a kind of using the bulbus fritillariae cirrhosae endogenetic fungus mediate nano silver preparation to gold The antibacterial drug of staphylococcus aureus.
Another object of the present invention be to provide it is a kind of using the bulbus fritillariae cirrhosae endogenetic fungus mediate nano silver preparation to big The antibacterial drug of enterobacteria.
Another object of the present invention is to provide a kind of anti-swelling for utilizing bulbus fritillariae cirrhosae endogenetic fungus mediation nano silver preparation Tumor preparation.
Advantages of the present invention and good effect are as follows:
Present invention firstly discovers that the endogenetic fungus CBY4 and CBY13 that separate in bulbus fritillariae cirrhosae have the ability of synthesizing nano-silver, Optimization has obtained the reaction condition that a comparison is suitble to its nano silver to synthesize, while finding that the nano silver of synthesis has centainly Antibacterial and anti-tumor activity.Present invention finds the new biological function of bulbus fritillariae cirrhosae endogenetic fungus and effects, also receive for biosynthesis The analysis of meter Yin has accumulated more data.
The present invention uses biological synthesis process, is reacted using bulbus fritillariae cirrhosae endogenetic fungus soak with silver nitrate solution, to project Group early period, isolated 15 plants of bulbus fritillariae cirrhosae endogenetic fungus carried out primary dcreening operation, as a result, it has been found that bulbus fritillariae cirrhosae endogenetic fungus CBY4 and CBY13 It can be transferred through biological synthesis process and prepare nano silver, be fusarium tricinctum by two plants of bacterium of identification, the nano silver that they are synthesized 4-AgNPs and 13-AgNPs is named respectively.
Soak pH, silver nitrate solution concentration, intensity of illumination and temperature is inquired into respectively to receive CBY4 and CBY13 biosynthesis The influence of meter Yin.As a result, it has been found that the synthetic quantity of nano silver has significant difference under reaction different condition.In the range of pH3-11 Interior, the synthetic quantity of 4-AgNPs and 13-AgNPs reach maximum when pH is 6；When silver nitrate solution concentration is 2mmol/L, The equal synthetic quantity of 4-AgNPs and 13-AgNPs obtained is larger, partial size is minimum；Within the scope of 2000Lux intensity of illumination, with light According to enhanced strength, the synthetic quantity of 4-AgNPs and 13-AgNPs are continuously increased；In 50 DEG C of temperature ranges, as temperature increases Add, the synthetic quantity of 4-AgNPs and 13-AgNPs also increase.It is final determine pH be 6, silver nitrate concentration 2mmol/L, light intensity For the synthesis for being more suitable for 4-AgNPs and 13-AgNPs opposite under the conditions of 2000Lux and 50 DEG C of temperature.
4-AgNPs and 13-AgNPs has good fungistatic effect to staphylococcus aureus and Escherichia coli.Using flat The antibacterial circle diameter of plate hole trap diffusion method is respectively 19.33mm and 19.97mm and 19.72mm and 19.38mm.4-AgNPs suppression The minimum inhibitory concentration (MIC) that staphylococcus aureus processed and Escherichia coli biofilm are formed is respectively 76 μ g/mL and 38 μ g/ mL；The minimum inhibitory concentration (MIC) that 13-AgNPs inhibits staphylococcus aureus and Escherichia coli biofilm to be formed is respectively 60 μ g/mL and 30 μ g/mL.
Nano silver 4-AgNPs and 13-AgNPs there is apparent inhibition to make the proliferation growth of human cervical carcinoma Hela cell With, can successfully induce the apoptosis of cancer cell, have good anti-tumor activity.
To sum up, present invention firstly discovers that the endogenetic fungus CBY4 and CBY13 that separate in bulbus fritillariae cirrhosae have synthesizing nano-silver Ability, optimization have obtained the reaction condition that a comparison is suitble to its nano silver to synthesize, while finding that the nano silver of synthesis has one Fixed antibacterial and anti-tumor activity.Present invention finds the new biological function of bulbus fritillariae cirrhosae endogenetic fungus and effects, also close for biology More data are had accumulated at the analysis of nano silver.
Detailed description of the invention
Fig. 1 is the biological synthesis method flow chart that the present invention implements that the bulbus fritillariae cirrhosae endogenetic fungus provided mediates nano silver.
Fig. 2 is that the present invention implements the soak (blue line) of the bacterial strain CBY4 provided and its nano silver (red line) of preparation UV-Vis abosrption spectrogram.
Fig. 3 is that the present invention implements the soak (blue line) of the bacterial strain CBY13 provided and its nano silver (red line) of preparation UV-Vis abosrption spectrogram.
Fig. 4 is that the present invention implements bacterial strain CBY13 morphological observation (a, b: colonial morphology for providing；C, d: shape under microscope State) figure.
Fig. 5 is the bulbus fritillariae cirrhosae endogenetic fungus CBY13 systematic growth tree graph that the present invention implements the adjacent method provided building.
Fig. 6 is the UV-Vis abosrption spectrogram that the present invention implements the CBY4 different time points synthesizing nano-silver provided.
Fig. 7 is the UV-Vis abosrption spectrogram that the present invention implements the CBY13 different time points synthesizing nano-silver provided.
Fig. 8 is the influence diagram that the pH that the present invention implements to provide synthesizes 4-AgNPs.
Fig. 9 is that the present invention implements the AgNO provided3The influence diagram that the concentration of solution synthesizes 4-AgNPs.
Figure 10 is the influence diagram that the intensity of illumination that the present invention implements to provide synthesizes 4-AgNPs.
Figure 11 is the influence diagram that the temperature that the present invention implements to provide synthesizes 4-AgNPs.
Figure 12 is the influence diagram that the pH that the present invention implements to provide synthesizes 13-AgNPs.
Figure 13 is the influence diagram that the present invention implements that the concentration of the AgNO3 solution provided synthesizes 13-AgNPs.
Figure 14 is the influence diagram that the intensity of illumination that the present invention implements to provide synthesizes 13-AgNPs.
Figure 15 is the influence diagram that the temperature that the present invention implements to provide synthesizes 13-AgNPs.
Figure 16 is the transmission electron microscope picture that the present invention implements the nano silver 4-AgNPs provided.
Figure 17 is the transmission electron microscope picture figure that the present invention implements the nano silver 13-AgNPs provided.
Figure 18 is that the present invention implements the 4-AgNPs of offer to drug-resistant S. aureus (left side) and Escherichia coli The fungistatic effect figure on (the right).
Figure 19 is that the present invention implements the 13-AgNPs of offer to staphylococcus aureus (left side) and Escherichia coli (the right) Fungistatic effect figure.
Figure 20 is the suppression that the present invention implements that the 4-AgNPs provided forms staphylococcus aureus and Escherichia coli biofilm Effect processed and MIC figure.
Figure 21 is that the 13-AgNPs that the present invention implements to provide forms staphylococcus aureus and Escherichia coli biofilm Inhibitory effect and MIC figure.
Figure 22 is that the present invention implements the 13-AgNPs provided and 4-AgNPs to the influence diagram of Hela cell Proliferation.
Figure 23 is the aspect graph that the present invention implements that the various concentration 4-AgNPs provided acts on lower Hela cell.
Figure 24 is the aspect graph that the present invention implements that the various concentration 13-AgNPs provided acts on lower Hela cell.
Figure 25 is that the present invention implements the CCK8 provided detection 13-AgNPs and 4-AgNPs anti-tumor activity figure.
Specific embodiment
In order to make the objectives, technical solutions, and advantages of the present invention clearer, with reference to embodiments, to the present invention It is further elaborated.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, and do not have to It is of the invention in limiting.
Application principle of the invention is further described with reference to the accompanying drawing.
As shown in Figure 1, the biosynthesis that the present invention provides a kind of bulbus fritillariae cirrhosae endogenetic fungus mediation nano silver includes following step It is rapid:
S101 reacts successfully synthesis with silver nitrate solution using biological synthesis process and receives using bulbus fritillariae cirrhosae endogenetic fungus as raw material Meter Yin；
S102 optimizes synthesis process by changing reaction condition；
S103 carries out the analysis of bacteriostatic activity and anti-tumor activity to it using nano silver as object.
The synthetic method of bulbus fritillariae cirrhosae endogenetic fungus biosynthesis nano silver provided by the invention is specific as follows:
(1) fermentation of endogenetic fungus
Bacterial strain activation: the PDA plate training of a certain amount of mycelia access Fresh of picking from the inclined-plane PDA for saving strain It supports and is placed in 28 DEG C of culture 3-5d activation (growth feelings of specific activation time view bacterial strain in biochemical cultivation case in base (diameter 90mm) Depending on condition).
Fermentation liquid preparation: it is beatened to take bacteria cake at activated bacterial strain flat board edge with 5mm punch, bacteria cake according to one bottle one The mode of bacteria cake is inoculated into the triangular flask equipped with PDB (100mL/250mL).28 DEG C are placed in constant-temperature shaking incubator, 120r/min, shaken cultivation 7d.
(2) microorganism collection and secondary fermentation of endogenetic fungus
Endogenetic fungus fermentation liquid is filtered, thallus is collected, is washed repeatedly with deionized water 3-4 times until filtered solution is in colourless (washing times are depending on the circumstances).A certain amount of thallus is taken to be immersed in the deionized water with former fermentation system same volume Middle carry out secondary fermentation, 28 DEG C, 120r/min, shaken cultivation is for 24 hours.Thallus soak is filtered, filtrate is collected, is used for nano silver Compound experiment.
(3) primary dcreening operation of biosynthesis nano silver
Fresh concentration is the silver nitrate (AgNO of 1mmol/L3) solution, by thallus soak and AgNO3Solution is according to 9: 1 ratio is mixed, and reaction is stood under normal temperature and pressure conditions, will be not added with AgNO3Isometric soak of solution is set as empty White control.After reacting a period of time, by the variation of reaction solution color in observation test tube, it is divided in conjunction with UV-2600 UV, visible light Photometer detects nano silver characteristic absorption peak (detection range 300-600nm, sweep spacing 2nm), as judging whether there is nanometer The index that silver is synthetically produced.Uv-visible absorption spectra is a kind of important means for detecting nano silver particles, there is document report It points out, typical nano silver particles have characteristic absorption peak within the scope of 400-500nm.
(4) identification of endogenetic fungus
A Morphological Identification:
Find that bacterial strain CBY4 and CBY13 can biosynthesis nano silvers by preliminary screening.With PDA culture medium culture CBY13 bacterial strain carries out giant colony observation.Reference literature carries out micro-morphology sight to bacterial strain using inserted sheet cultivation It examines.
B molecular biology identification:
The genomic DNA of bulbus fritillariae cirrhosae endogenetic fungus CBY13 is extracted using classical CTAB method:
It is put into mortar with the wet thallus of aseptic inoculation needle picking about 5g or so, liquid nitrogen grinding is added, it will be ground thin Powder is transferred in the sterile centrifugation tube of 50mL, is stored in -20 DEG C of refrigerator overnights.
It takes out sample and 15mL buffer is added into sterile centrifugation tube (comprising 100mM Tris-HCl pH 7.5,50mmol EDTA, 2%SDS, and 1%2-mercaptoethanol), add NaCl the and 2mLCTAB lysate (packet of 3mL 5mol Containing 10%CTAB and 0.7M NaCl), 65 DEG C of incubation 45min (are inverted) frequently, then 37 DEG C of incubation 15min.
It is added 20mL mixed liquor (chloroform: isoamyl alcohol=24:1)；It is uniformly mixed, after being placed at room temperature for 10min, 12000r/min It is centrifuged 20min, discards supernatant the slow mixing of isopropanol of addition 11mL (0.55vol) after liquid.
With centrifugal process 8000r/min centrifugation 10min collect nucleic acid particle, by the nucleic acid particle to precipitate with 70% second Alcohol is cleaned, natural air drying 10min.
Obtained nucleic acid particle is suspended in 5mL sterile water；0.5mg DNase-free RNase, 37 DEG C of incubations are added 30min。
It is added 5mL mixed liquor (chloroform: isoamyl alcohol=24:1), then plus 5mL phenol extraction DNA.
4mL isoamyl alcohol is added and precipitates DNA, then 8000r/min is centrifuged 10min.
Liquid is discarded supernatant, the DNA particle to precipitate is cleaned with 70% ethyl alcohol, and natural air drying is then dissolved in 0.5mL TE buffer in (10 mM Tris-HCl and 0.1mmol EDTA, pH 7.5).
The region target ITS1-5.8S rDNA-ITS2 is expanded with universal primer ITS1 and ITS4:
PCR primer: upstream primer ITS1SEQ ID NO:15 '-TCCGTAGGTGAACCTGCGG-3 ') and downstream primer 5 '-TCCTCCGCTTATTGATATGC-3 ' of ITS4 SEQ ID NO:2.
PCR system: each 0.75 μ L of upstream and downstream primer, 2.0 μ L, 2 × Taq PCR Master Mix (Pu Luomai of DNA solution Lattice (Beijing) Bioisystech Co., Ltd) 15 μ L, 11.5 μ L of water, whole system totally 30 μ L.
PCR reaction condition: 95 DEG C of initial denaturation 5min；94 DEG C of denaturation 45S, 52 DEG C of annealing 30S, 72 DEG C of extension 3min, 40 It recycles, then 72 DEG C of extension 15min.
It carries out delivering Chengdu Qing Ke Zi Xi Bioisystech Co., Ltd (north after cutting glue purification to the PCR product come is amplified Capital, China) it is sequenced, column will be sequenced and be submitted to progress BLAST comparison on NCBI GenBank database, according to comparison As a result it chooses the maximum and representative strain of similarity and uses neighbor-joining (NJ) using MEGA5.10 software Method carries out clustering.
(5) nano silver synthesis process monitors
By the AgNO of soak and 1mmol/L3After solution is according to the ratio hybrid reaction of 9:1, point in different times (0h, 1h, 2h, 4h, 8h, 12h, for 24 hours, 48h and 72h) take a certain amount of sample, utilize UV-2600 ultraviolet-uisible spectrophotometer Full wavelength scanner (detection range 300-600nm, sweep spacing 2nm) is carried out to sample, detects the change of nano silver synthesis process Change.
(6) optimization of nano silver synthesis condition
Investigate different illumination intensity, pH, AgNO3Influence of the concentration and temperature of solution to nano silver synthesis rate, to this 4 A factor optimizes.Different pH (being adjusted using NaOH and glacial acetic acid) is 3.0,4.0,5.0,6.0,7.0,8.0,9.0, 10.0 with 11.0；Different AgNO3The concentration of solution is 0.5,1,1.5,2,2.5,3,3.5mmol/L；Different intensities of illumination It is 4 DEG C, 25 DEG C and 50 DEG C for 0,1000Lux, 1500Lux, 2000Lux and different temperature.It reacts at different conditions respectively After 48h, a small amount of sample is taken, full wavelength scanner is carried out to sample using ultraviolet-uisible spectrophotometer.
(7) characterization of optimum synthesis nano silver
Utilize the micromorphology of transmission electron microscope analysis nano silver:
A, it supports film copper mesh to place 3-5min in carbon sample drop, then sucks surplus liquid with filter paper；
B, drip 2% phosphotungstic acid supports film copper mesh to place 2-3min in carbon, sucks surplus liquid, drying at room temperature with filter paper；
C, it is observed under transmission electron microscope, acquires image analysis.
Below with reference to nano silver antibacterial activity analysis, the invention will be further described.
1, nano silver antibacterial activity analysis
1.1 nano silvers inhibit bacterium
Inhibit the activity of bacterium using plate well trap diffusion method analysis nano silver.The activated experiment indicator bacteria of picking is golden yellow Color staphylococcus (Gram-positive) and Escherichia coli (Gram-negative) are into beef extract-peptone fluid nutrient medium, and 37 DEG C, 120r/min shaken cultivation is to OD600Value is 0.1, takes 30 μ L staphylococcus aureus bacterium solutions and Escherichia coli bacteria liquid respectively, is used Spreading rod is uniformly coated on beef extract-peptone solid medium, and the punch for being 5mm with diameter is beaten in plate center and takes one A hole is drawn in 4-AgNPs or 80 μ L injection hole of 13-AgNPs, is tested in triplicate, to inject CBY4 soak or CBY13 Soak is negative control, with Ag containing equivalent+Silver nitrate solution be positive control.After 37 DEG C of cultures for 24 hours, right-angled intersection is used Method measures inhibition zone size, calculates average value, and experiment is set to be repeated three times.
The inhibiting effect that 1.2 nano silvers form staphylococcus aureus and Escherichia coli biofilm
Influence and MIC using TTC method measurement nano silver to staphylococcus aureus and Escherichia coli biofilm formation. By the bacteria suspension culture of staphylococcus aureus and Escherichia coli to OD600=0.1, respectively take 100 μ L to be inoculated in 96 orifice plates, point The nano silver 4-AgNPs and 13-AgNPs of 100 μ L various concentrations are not added, making its final concentration is respectively 1 μ g/mL, 1.9 μ g/ ML, 3.8 μ g/mL, 7.5 μ g/mL, 15 μ g/mL, 30 μ g/mL, 60 μ g/mL, 120 μ g/mL and 0.6 μ g/mL, 1.2 μ g/mL, 2.4 μ g/mL, 4.8 μ g/mL, 9.5 μ g/mL, 19 μ g/mL, 38 μ g/mL, 76 μ g/mL, 37 DEG C of stationary cultures in biochemical cultivation case For 24 hours, using dehydrated alcohol as control.Prepare 1% TTC solution after for 24 hours under dark surrounds, every hole is added 10 μ L, and 37 DEG C, 120r/min dark is incubated for 4h, observes color change, and test is set to be repeated three times.
Below with reference to the analysis of nano silver anti-tumor activity, the invention will be further described.
2, nano silver anti-tumor activity is analyzed
The routine culture of 2.1 cells
By Hela (cervical cancer cell) cell inoculation in the 1640 culture medium containing 10% fetal calf serum, at 37 DEG C, 5% CO2And it cultivates, pass under the conditions of saturated humidity.For testing when cell is in logarithmic growth phase.
2.2 plating cells
The Hela cell dissociation of logarithmic growth phase will be in front of nano silver processing for 24 hours, is prepared into cell suspension, and count, Adjusting cell concentration is 1 ' 105/ mL makes every hole cell about 1 ' 10 by 100 μ L cell inoculations in 96 orifice plates4It is a, cell is set It is cultivated in incubator.
The processing of 2.3 nano silvers
(1) nano silver 4-AgNPs and 13-AgNPs are freeze-dried, using sterile ultrapure water to nano silver washing three It is secondary, then, then by nano silver redissolution into 200 μ L ultrapure waters, and dispersed using ultrasonic wave, avoids nano silver from generating heavy It forms sediment.
(2) nano silver with complete medium be diluted to final concentration of 7.8ng/ μ L, 15.6ng/ μ L, 31.3ng/ μ L, 62.5ng/ μ L, 125ng/ μ L, 250ng/ μ L, 500ng/ μ L are mixed in the medium, are observed later for 24 hours.
2.4 CCK8 detection
(1) 10 μ L CCK8 solution (avoiding generating bubble during sample-adding, influence to read) is added into every hole.
(2) culture plate placement is incubated for 2h in the incubator.
(3) it is read at 450nm using microplate reader.
(4) inhibiting rate that nano silver is proliferated Hela is calculated:
Inhibiting rate=(blank control-test)/blank control * 100%
2.5, experimental data processing and analysis
Experimental data processing and mapping are carried out using Microsoft Excel2010, are statisticallyd analyze using SPSS20.0 soft Part carries out calculation processing and correlation analysis to data.
Below with reference to interpretation of result, the invention will be further described.
3, result and analysis
3.1 bulbus fritillariae cirrhosae endogenetic fungus biosynthesis nano silvers
3.1.1 the primary dcreening operation of synthesizing nano-silver
Pass through the screening to 15 plants of bulbus fritillariae cirrhosae endogenetic fungus, the results showed that bacterial strain CBY4 and CBY13 have biosynthesis The effect of nano silver.Analysis is found, when the soak and AgNO of CBY4 and CBY133After solution reaction 4h, the color of soak Significant change all has occurred, becomes brown color by light yellow, and blank control color is unchanged.This is because surface etc. from Caused by daughter resonance effects (SPR), brown color is the characteristic color for indicating nano-silver water solution.The variation of mixed liquor color Illustrate the soak of bulbus fritillariae cirrhosae endogenetic fungus CBY4 and CBY13 all with AgNO3Solution is chemically reacted, and preliminary judgement is whole A solution system has nano silver synthesis；
Using UV-2600 ultraviolet-uisible spectrophotometer respectively to CBY4 soak and CBY13 soak biosynthesis Nano silver is identified.CBY4 soak and AgNO as seen from Figure 23There is maximum suction at 400nm in the mixed liquor of solution Peak is received, Fig. 3 can be seen that CBY13 soak and AgNO3Also there is maximum absorption band at 400nm in the mixed liquor of solution, says The soak of two plants of bacterial strains of bright CBY4 and CBY13 can synthesizing nano-silver particle.The nano silver name that CBY4 soak is synthesized Nano silver for 4-AgNPs, the synthesis of CBY13 soak is named as 13-AgNPs.
3.1.2 the Morphological Identification of endogenetic fungus
It is identified by seminar's early period, CBY4 and F.tricinctum isolate HG52 (Accession No.KX099672.1) together, combining form feature, confirmation CBY4 is fusarium tricinctum (F.tricinctum) to cluster, Here CBY13 bacterial strain is only identified.
In CBY13 strain inoculated to PDA culture medium, in biochemical cultivation case 28 DEG C culture will be placed in.As a result, it has been found that bacterial strain Rapidly, 7d overgrows with entire culture medium for CBY13 growth, and the white villiform of a large amount of gas mycelia or flocculence can generate red Element is simultaneously secreted into culture medium, microstructure such as Fig. 4.Macroconidium is scattered on aerial hyphae as we can see from the figure Or be born on sporodochia, separate obviously, has 1-2 a every in sickle shaped；Microconidia is formed on aerial hyphae, In a manner of false head it is raw, it is kidney-shaped and oval, have 1-2 diaphragm.
3.1.3 molecular biology identification
The ITS1-5.8SrDNA-ITS2 sequence of bacterial strain CBY13 is submitted on NCBI GenBank database, sequence is obtained Column number (Accession No.): MH059783.It is subjected to Blast comparison on NCBI GenBank database data, point The phase of itself and Fusarium tricinctum isolate SH10 (Accession No.KP193137.1) is found after analysis result It is maximum like degree, reach 99%.Preceding 12 plants of similarities height is chosen simultaneously and representative sequence is adopted using MEGA5.1 software Systematic evolution tree (Fig. 7) is constructed with Neighbor-Joining (NJ) method.CBY13 and bacterial strain Fusarium as the result is shown Tricinctum strain NRRL 25481 (Accession No.HM068317.1) is clustered together.So combining form Feature is learned, confirmation CBY13 is fusarium tricinctum (F.tricinctum).Such as Fig. 5
3.1.4 nano silver synthesis process monitors
From fig. 6, it can be seen that the soak and AgNO of bulbus fritillariae cirrhosae endogenetic fungus CBY43After solution hybrid reaction 4h, also open There is nano silver synthesis in beginning, this explanation can be with AgNO using the soak of CBY43Solution biosynthesis nano silver., equally from figure As can be seen that with the extension of reaction time, the peak value of the absorption peak of each UV-Vis absorption spectrum curve is gradually increased in 6, Illustrate that the nano silver yield synthesized as time increases also gradually increases.But between 48h to 72h, peak value incrementss are very Few, after illustrating 48h, the reaction of synthesizing nano-silver has been approached completion.It can also be seen that from 4h to 72h, different time The maximum absorption band of point UV-Vis absorption spectrum curve all close to 400nm, say there is no significantly deviating by the position at peak The nano silver partial size of bright synthesis is relatively uniform, apparent agglomeration does not occur, has good stability.
From figure 7 it can be seen that the soak and AgNO of bulbus fritillariae cirrhosae endogenetic fungus CBY133After solution hybrid reaction 4h, start There is nano silver synthesis, this explanation can be with AgNO using the soak of CBY133Solution biosynthesis nano silver.And from Fig. 7 In as can be seen that with the extension of reaction time, the peak value of absorption peak is gradually increased, and illustrates to synthesize as time increases Nano silver yield gradually increases.But between 48h to 72h, peak value increasing degree is reduced, after illustrating 48h, synthesizing nano-silver Reaction has slowed down.Meanwhile from the figure, it can be seen that from 4h to 72h, the maximum of different time points UV-Vis absorption spectrum curve Absorption peak all close to 400nm, the position at peak there is no significantly deviating, illustrate the nano silver partial size of synthesis it is relatively uniform, Apparent agglomeration does not occur, has good stability.
3.1.5 the optimization of nano silver synthesis condition
3.1.5.1 the optimization of 4-AgNPs synthesis condition
Under normal temperature and pressure conditions, change the pH of CBY4 soak.As can be seen from Figure 8, the pH of CBY4 soak is different To the influence highly significant of nano silver synthesis, with the increase of reaction system pH, the UV-Vis absorption spectrum curve of nano silver The peak value first increases and then decreases of absorption peak shows that the synthetic quantity of nano silver in reaction system first increases and reduces afterwards.When pH is less than 6 When, the absorption peak strength of nano silver is constantly reinforced, and synthetic quantity increases.When pH is greater than 6, the absorption peak position of nano silver is not sent out Raw offset, but peak value constantly reduces.The synthetic quantity of nano silver reaches maximum when pH is equal to 6, when illustrating that in contrast pH is 6 It is more suitable for the synthesis of nano silver.
The pH of fixed CBY4 soak is 6, changes AgNO3The concentration of solution.It can be seen in figure 9 that working as AgNO3Solution When concentration is lower than 2.5mmol/L, with the increase of concentration, the peak value of the absorption peak of the UV-Vis absorption spectrum curve of nano silver First increases and then decreases, when concentration is 2mmol/L, peak value reaches maximum, but the position at peak is basically unchanged, and illustrates receiving for synthesis Rice silver particles partial size simultaneously has not been changed.Work as AgNO3When solution concentration is higher than 2.5mmol/L, red shift occurs for absorption peak, illustrates to synthesize Nano silver particles partial size become larger.Partial size is bigger, and corresponding biocidal property will weaken.Therefore, AgNO3Solution concentration is The opposite synthesis for being more suitable for nano silver when 2mmol/L.
Fixed pH is 6, AgNO3Solution concentration is 2mmol/L, changes intensity of illumination.It can be seen from fig. 10 that with light According to the enhancing of intensity, synthetic reaction rate is accelerated, and the peak value of the absorption peak of the UV-Vis absorption spectrum curve of nano silver constantly increases Greatly, when illustrating that the synthetic quantity of nano silver is continuously increased, but increasing to 2000Lux from 1500Lux, the increase of synthetic quantity pole It is few.From the point of view of economy, selection intensity of illumination is 2000Lux, does not continue to improve light intensity.
Fixed pH is 6, AgNO3Solution concentration is 2mmol/L, intensity of illumination 2000Lux, changes temperature.From Figure 11 As can be seen that as the temperature increases, synthetic reaction rate is accelerated, the absorption peak of the UV-Vis absorption spectrum curve of nano silver Peak value increasing, illustrate that the synthetic quantity of nano silver has increase.But when increasing to 50 DEG C from 25 DEG C, the increase of synthetic quantity compared with It is few.From the point of view of economy, it is proposed that selecting temperature is 50 DEG C, does not continue to improve temperature.
3.1.5.2 the optimization of 13-AgNPs synthesis condition
Under normal temperature and pressure conditions, change the pH of CBY13 soak.In figure 12 it can be seen that the pH of CBY13 soak is not With the influence highly significant synthesized to nano silver, with the increase of reaction system pH, the UV-Vis absorption spectrum curve of nano silver Absorption peak peak value first increases and then decreases, show that the synthetic quantity of nano silver in reaction system first increases and reduce afterwards.When pH is less than When 6, the synthesis of nano silver is seldom, and absorption peak is unobvious.When pH is greater than 6, the absorption peak position of nano silver does not shift, But peak value constantly reduces.The synthetic quantity of nano silver reaches maximum when pH is equal to 6, illustrates to be more suitable for receiving when in contrast pH is 6 The synthesis of meter Yin.
The pH of fixed CBY13 soak is 6, changes AgNO3The concentration of solution.It can be observed from fig. 13 that working as AgNO3It is molten When liquid concentration is lower than 2.5mmol/L, with the increase of concentration, the peak of the absorption peak of the UV-Vis absorption spectrum curve of nano silver It is worth first increases and then decreases, when concentration is 2mmol/L, peak value reaches maximum, but the position at peak is basically unchanged, and illustrates synthesis Nano silver particles partial size simultaneously has not been changed.Work as AgNO3When solution concentration is higher than 2.5mmol/L, red shift occurs for absorption peak, illustrates to close At nano silver particles partial size become larger.Panacek etc. proves that the particle size of nano silver influences its fungistatic effect by test, Usual partial size is smaller, and biocidal property is stronger.Therefore, AgNO3The opposite synthesis for being more suitable for nano silver when solution concentration is 2mmol/L.
Fixed pH is 6, AgNO3Solution concentration is 2mmol/L, changes intensity of illumination.As can be seen from Figure 14, with light According to the enhancing of intensity, synthetic reaction rate is accelerated, and the peak value of the absorption peak of the UV-Vis absorption spectrum curve of nano silver is increasing Greatly, illustrate that the synthetic quantity of nano silver has increase.Therefore, opposite when intensity of illumination is 2000Lux to be more suitable for nano silver synthesis.
Fixed pH is 6, AgNO3Solution concentration is 2mmol/L, intensity of illumination 2000Lux, changes temperature.From Figure 15 As can be seen that as the temperature increases, synthetic reaction rate is accelerated, the absorption peak of the UV-Vis absorption spectrum curve of nano silver Peak value increasing, illustrate that the synthetic quantity of nano silver has increase.Therefore, opposite when temperature is 50 DEG C to be more suitable for nano silver synthesis.
3.1.6 the characterization of optimum synthesis nano silver
According to above-mentioned optimum conditions as a result, the condition of Binding experiment room instrument and equipment temperature light, respectively will The soak pH of CBY4 and CBY13 is adjusted to 6, the AgNO for being 2mmol/L with concentration3Solution is in 2000Lux, intensity of illumination 48h is reacted under conditions of 50 DEG C, the nano silver particles of acquisition are subjected to transmission electron microscope.
As can be seen from Figure 16,4-AgNPs is spherical or subsphaeroidal, and size is more uniform, average grain diameter 10-40nm, Dispersion is good, is in single dispersity.
As can be seen from Figure 17,13-AgNPs is spherical or subsphaeroidal, and particle size distribution range is larger, is 20-80nm, have compared with For apparent agglomeration.
3.2 nano silver antibacterial activity analysis
3.2.1 nano silver inhibits bacterium
CBY4 soak has faint bacteriostatic activity as can be seen from Table 1, is capable of forming minimum inhibition zone, average to press down Bacterium diameter is respectively 10.28mm and 9.53mm；And 13-AgNPs then has significantly staphylococcus aureus and Escherichia coli Bacteriostatic activity, average bacteriostatic diameter is respectively 19.33mm and 19.97mm；Corresponding AgNO3The average antibacterial circle diameter of solution Respectively 19.87mm and 19.41mm.4-AgNPs and AgNO3Fungistatic effect it is very close, but nano silver have it is preferably raw Object safety, application range are wider.As shown in Figure 18,19,20；
Antibacterial circle diameter (n=3) of 1 4-AgNPs of table to staphylococcus aureus and Escherichia coli
Table 1 The mean inhibition zone of 4-AgNPs against S.aureus and E.coli (n=3)
Antibacterial circle diameter (n=3) of 2 13-AgNPs of table to staphylococcus aureus and Escherichia coli
Table 2 The mean inhibition zone of 13-AgNPs against S.aureus and E.coli (n=3)
3.2.2 the inhibiting effect that nano silver forms staphylococcus aureus and Escherichia coli biofilm
The formation of dehydrated alcohol control group as seen from Figure 20, biomembrane is totally constrained, and not formed biomembrane is by TTC Dyeing.And the 4-AgNPs of low concentration does not generate inhibiting effect to staphylococcus aureus and Escherichia coli biofilm, formation Biomembrane dyes pink colour or red by TTC.When 4-AgNPs concentration is greater than 38 μ g/mL, the formation quilt of Escherichia coli biofilm Inhibit, therefore 38 μ g/mL are MIC of the 4-AgNPs to Escherichia coli；When 4-AgNPs concentration is greater than 78 μ g/mL, Staphylococcus aureus The formation of bacterium biomembrane is suppressed, therefore 76 μ g/mL are MIC of the 4-AgNPs to Escherichia coli.
The formation of dehydrated alcohol control group as seen from Figure 21, biomembrane is totally constrained, and not formed biomembrane is by TTC Dyeing.And the 13-AgNPs of low concentration does not generate inhibiting effect to staphylococcus aureus and Escherichia coli biofilm, formation Biomembrane dyes pink colour or red by TTC.When 13-AgNPs concentration is greater than 30 μ g/mL, the formation quilt of Escherichia coli biofilm Inhibit, therefore 30 μ g/mL are MIC of the 13-AgNPs to Escherichia coli；When 13-AgNPs concentration is greater than 60 μ g/mL, golden yellow grape The formation of coccus biomembrane is suppressed, therefore 60 μ g/mL are MIC of the 13-AgNPs to Escherichia coli.
The analysis of 3.3 nano silver anti-tumor activities
3.2.1 CCK8 detects nano silver to the inhibiting effect of Hela cell Proliferation
Using CCK8 detect find, nano silver 4-AgNPs and 13-AgNPs to Hela cytosis for 24 hours after, to it Proliferation growth generates certain inhibiting effect.As can be seen from Figure 22, when nano silver final concentration of 7.8
OD when ng/ μ L450Light absorption value and blank control value it is almost the same, with the raising of nanometer silver concentration, OD450's Light absorption value is reducing, and shows that the quantity of Hela living cells is being reduced, it was demonstrated that nano silver 4-AgNPs and 13-AgNPs is thin to Hela The proliferation of born of the same parents is all inhibited, and with the increase of concentration, inhibiting effect enhancing.And 13-AgNPs is under various concentration Influence significant difference to light absorption value, 4-AgNPs significant difference under minimum concentration and maximum concentration, this is further demonstrated that The concentration of nano silver has a significant impact the proliferation of Hela.
Human cervical carcinoma Hela cell and nano silver observe the growth conditions of cell under inverted microscope after acting on for 24 hours, from Figure 23 and 24 can see, and the nano silver 4-AgNPs and 13-AgNPs of bulbus fritillariae cirrhosae endogenetic fungus synthesis can significantly inhibit Hela The proliferation of cell is grown.Compared with the control, after the nano silver 4-AgNPs and 13-AgNPs of 7.8ng/ μ L is added, cell number quantitative change Change less, with being continuously increased for nanometer silver concentration, the quantity of cell is constantly reduced, and density becomes smaller, when addition 500ng/ μ L's After 4-AgNPs and 13-AgNPs, cell, which has, to fall off, and the case where being rounded occurs, it was demonstrated that cell has dead and apoptosis It happens, this illustrates that nano silver 4-AgNPs and 13-AgNPs have the function of inhibiting the growth of Hela cell.
As can be seen from Figure 25, nano silver 4-AgNPs and 13-AgNPs is in agent to the inhibiting rate of Hela cell and its concentration Measure dependence, 4-AgNPs and 13-AgNPs can inhibit the proliferation growth of Hela cell, promote its apoptosis, inhibiting rate and its Concentration is positively correlated and otherness is significant.Hela cell reacts more sensitive to nano silver 4-AgNPs.
Below with reference to effect, the invention will be further described.
4 analyses
4.1 bulbus fritillariae cirrhosae endogenetic fungus biosynthesis nano silvers
Nano silver is as a kind of new material, because it has heat, light, electricity, magnetic, catalysis and the sensitivity different from conventional material Etc. characteristics, be widely used in catalyst material, antistatic material, low temperature superconducting material, electric slurry and bio-sensing equipment Material and biomedicine etc., market demand increasingly increases.Currently, synthesizing nano-silver material is generally adopted by the market Traditional physical method and chemical method, but physical method and chemical method all have a very big drawback, for example, it is at high cost, pollution is big etc., Although many experts and scholars have carried out a degree of optimization to physical method and chemical method, there is also inevitable Problem.Bioanalysis comes into being at this time, and bioanalysis is exactly that biomaterial and microorganism system is utilized to mix with silver nitrate solution instead A kind of free of contamination chemical reaction of nano silver should be generated.Bioanalysis is excellent because of its cheap, easy to operate, green non-pollution etc. Point receives more and more attention, and becomes the analysis hot spot of nano silver synthesis.In recent years, various plant leaching liquor immersions, true are utilized The report of the materials biosynthesis nano silver such as bacterium, bacterium emerges one after another, and more and more plants, fungi, bacterial species are all demonstrate,proved It in fact can be with synthesizing nano-silver.Jiang Yu etc. has found that the Aqueous extracts of hawthorn and alcohol extract can biosynthesis nano silvers.Open the card such as outstanding person Real hook-shaped trichoderma has the function of biosynthesis nano silver.Bao Jing, which walks slowly like a woman, finds that the Fusarium oxysporum separated from ginseng can With biosynthesis nano silver.Therefore more plants with synthesizing nano-silver function, fungal species are filtered out, to nano silver Preparation is of great significance, this is the analysis directions of a great potential.
The existing experience of present invention combination forefathers, the 15 plants of bulbus fritillariae cirrhosae endogenetic fungus saved to laboratory screen, benefit With the secondary fermentation liquid and silver nitrate solution of 15 plants of bacterial strains with the ratio hybrid reaction of 9:1, by solution colour variation (color by It is light yellow to become yellow, buff) and UV-Vis absorption spectrum (having characteristic absorption peak at 400-500nm) as tentatively sentencing Calibration is quasi-, it is found that two plants of endogenetic fungus CBY4 and CBY13 have the function of synthesizing nano-silver.It is reflected by traditional morphology The molecular biology identification of fixed and ITS sequencing combines, and qualification result shows that this two plants of bacterium of CBY4 and CBY13 are all three line sickles Knife bacterium (F.tricinctum), but because this two plants of bacterium are isolated from different specimen materials, it can speculate that sickle-like bacteria is to be easier to Laboratory dominant bacteria isolated from bulbus fritillariae cirrhosae, while being also the dominant bacteria for being easier to biosynthesis nano silver.
The optimization of 4.2 nano silver synthesis conditions
It, can be with nitric acid silver reaction synthesizing nano-silver for two plants of fusarium tricinctums CBY4 and CBY13 that screening obtains.For A large amount of nano silvers are more quickly and efficiently prepared, we it is necessary to optimize to nano silver synthesis condition.
It generally to the condition optimizing of biosynthesis nano silver is configured from prevailing conditions such as temperature, illumination.Liu Small jasmine etc. is optimized synthesis condition in terms of illumination, pH and temperature three, it is found that the change of these three conditions can shadow Ring the form and function of synthesizing nano-silver[33].Yang Suling etc. is in terms of silver nitrate concentration, pH value, illumination and microwave irradiation four The influence factor of synthesizing nano-silver is inquired into[106].In order to utmostly optimize, the present invention is molten from soak pH, silver nitrate respectively This 4 aspect of liquid concentration, intensity of illumination and temperature optimizes.As a result, it has been found that the synthetic quantity of nano silver has aobvious under different condition Write difference.1) pH of bacterial strain soak can influence the activity of enzyme and the utilization rate to silver nitrate in soak, in pH3- In the range of 11, the trend of reduction after appearance increases is presented in the synthetic quantity of 4-AgNPs and 13-AgNPs, and inhales when pH is 6 It receives peak-to-peak value and reaches maximum.2) concentration of silver nitrate solution directly affects available Ag in reaction+Quantity, be respectively set 0.5, 1, the concentration gradient of 1.5,2,2.5,3 and 3.5mmol/L, in the range of 0.5-2.5mmol/L, the synthesis of nano silver is It is less after first increasing, but after silver nitrate concentration reaches 3mmol/L, the partial size of synthesizing nano-silver will increase, and nano silver Partial size is usually related with its biocidal property, shows as that partial size is smaller, and biocidal property is stronger.Absorbing in map in UV-Vis can see When silver nitrate solution concentration is 2mmol/L, 4-AgNPs synthetic quantity obtained is maximum, partial size, minimum, 13-AgNPs synthetic quantity It is larger, partial size is minimum.3) intensity of illumination is a kind of important supplementary means of synthesizing nano-particle[33], nano silver can be improved Synthesis rate and yield, within the scope of 2000Lux intensity of illumination, as intensity of illumination enhances, 4-AgNPs and 13-AgNPs's Synthetic quantity is all increasing；4) temperature can influence the activity that enzyme in the soak of reaction is participated in mixed liquor, utilize illumination cultivation 4,25 and 50 DEG C of three temperature gradients are arranged in case, as a result, it has been found that, as temperature increases, the synthetic quantity of 4-AgNPs and 13-AgNPs All increasing.In view of synthetic quantity increase is not significant under 50 DEG C and 2000Lux of intensity of illumination by 4-AgNPs, from economic angle It spends and the reason of the appointed condition of Binding experiment room, final determine selects the pH to be for 6, silver nitrate concentration 2mmol/L, light intensity 2000Lux, the opposite biosynthesis for being particularly suited for 4-AgNPs and 13-AgNPs of 50 DEG C of conditions.
4.3 nano silver antibacterials activity
Recently as the abuse of antibiotic, more and more drug-resistant microorganisms are constantly generated, market urgently novel antibacterial The development and utilization of agent, nano antibacterial material have the advantages that efficiently, persistently, wide spectrum, have no drug resistance it is antibacterial, it is extensive Applied to antibacterials fields such as medical material disinfection, antibiotic fabric, antibiotic ceramic tiles, furthermore nano material is expected to as antibiotic Substitute, play an important role in terms of antibacterials research and development.Have analysis shows the nano silver synthesized using Fusarium graminearum There is significant inhibiting effect to staphylococcus aureus, Shigella and salmonella, illustrate that nano silver has good suppression Bacterium effect.
The present invention has carried out the Preliminary detection of bacteriostatic activity using the nano silver 4-AgNPs and 13-AgNPs of optimum synthesis. Conventional staphylococcus aureus (Gram-positive) and Escherichia coli (Gram-negative) is selected to indicate as bacteriostatic test Bacterium.First with plate well trap diffusion method Preliminary detection to 4-AgNPs and 13-AgNPs to staphylococcus aureus and large intestine bar Bacterium produces inhibiting effect, and and AgNO3The fungistatic effect difference of solution is no different, and shows good fungistatic effect.
Staphylococcus aureus and Escherichia coli biofilm are formed using TTC method detection 4-AgNPs and 13-AgNPs Inhibiting effect.It was found that certain density nano silver can the biofilm formation to two kinds of indicator bacterias generate inhibiting effect.4- The MIC that AgNPs inhibits staphylococcus aureus and Escherichia coli biofilm to be formed is respectively 76 μ g/mL and 38 μ g/mL；13- The MIC that AgNPs inhibits staphylococcus aureus and Escherichia coli biofilm to be formed is respectively 60 μ g/mL and 30 μ g/mL.Tentatively Conjecture nano silver may be the specific machine since nano silver inhibits the formation of bacterial biof iotalm to generate to the inhibiting effect of bacterium System need further to analyze.
4.4 nano silver anti-tumor activities
Malignant tumour is as the major hidden danger for endangering human health, and cell Proliferation crosses Sheng and Apoptosis inhibitor is considered as tumour The key of occurrence and development, urgent need analyze " specific drug " that more can effectively inhibit tumour cell.Before this have experiments have shown that The nano silver of isolated aspergillus fumigatus synthesis can significantly inhibit the growth of Proliferation of Human Ovarian Cell A2780 in greater celandine, have Good anti-tumor activity[107].Present invention demonstrates that the nano silver 4-AgNPs and 13-AgNPs of the synthesis of bulbus fritillariae cirrhosae endogenetic fungus are equal The proliferation growth of human cervical carcinoma Hela cell is significantly inhibited, the apoptosis of cancer cell can be successfully induced, also have There is good anti-tumor activity.
The discovery of CCK8 testing result, nano silver 4-AgNPs and 13-AgNPs play the growth of human cervical carcinoma Hela cell To inhibiting effect, when nanometer silver concentration is very low, the OD of Hela cell450It is consistent with blank control, but with nanometer silver concentration Increase, significantly raised to the inhibiting rate of Hela cell, inhibiting rate is positively correlated with concentration.And Hela cell is to 4-AgNPs's React more sensitive.It is observed under inverted microscope, it is and right after nano silver 4-AgNPs and 13-AgNPs act on Hela cell for 24 hours Photograph ratio, with the increase of nanometer silver concentration, cell quantity is gradually decreased, and density becomes smaller.In the 4- that 500ng/ μ L is added After AgNPs and 13-AgNPs, cell, which has, to fall off, and apoptosis occurs, illustrates the nano silver 4-AgNPs of bulbus fritillariae cirrhosae endogenetic fungus synthesis The growth of Hela cell can effectively be inhibited with 13-AgNPs.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all in essence of the invention Made any modifications, equivalent replacements, and improvements etc., should all be included in the protection scope of the present invention within mind and principle.
<110>Sichuan Agricultural University
<120>denomination of invention: a kind of bulbus fritillariae cirrhosae endogenetic fungus mediates biological synthesis method and the application of nano silver
<160> 2
<210> 1；
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400>1
TCCGTAGGTGAACCTGCGG
<210> 2；
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400>1
TCCTCCGCTTATTGATATGC

Claims (8)

1. the biological synthesis method that a kind of bulbus fritillariae cirrhosae endogenetic fungus mediates nano silver, which is characterized in that the bulbus fritillariae cirrhosae Nei Shengzhen Bacterium mediate nano silver biological synthesis method include:
Reacted using bulbus fritillariae cirrhosae endogenetic fungus soak with silver nitrate solution, to 15 plants of isolated bulbus fritillariae cirrhosae endogenetic fungus into After row primary dcreening operation, nano silver 4-AgNPs and 13- are prepared by biological synthesis process using bulbus fritillariae cirrhosae endogenetic fungus CBY4 and CBY13 AgNPs；
In biosynthetic process, synthesis condition are as follows: pH3-11, silver nitrate solution concentration are 2mmol/L, and 2000Lux illumination is strong, 50 ℃。
2. the biological synthesis method that bulbus fritillariae cirrhosae endogenetic fungus as described in claim 1 mediates nano silver, which is characterized in that described The synthetic method of bulbus fritillariae cirrhosae endogenetic fungus biosynthesis nano silver further comprises:
(1) fermentation of endogenetic fungus
Bacterial strain activation: it accesses in the PDA plate culture medium of Fresh, is placed in from picking mycelia in the inclined-plane PDA for saving strain 28 DEG C of culture 3-5d activation in biochemical cultivation case；
Fermentation liquid preparation: it is beatened to take bacteria cake at activated bacterial strain flat board edge with 5mm punch, bacteria cake according to one bottle of one bacteria cake Mode be inoculated into the triangular flask equipped with PDB；28 DEG C, 120r/min, shaken cultivation 7d are placed in constant-temperature shaking incubator；
(2) microorganism collection and secondary fermentation of endogenetic fungus
Endogenetic fungus fermentation liquid is filtered, thallus is collected, is washed repeatedly with deionized water 3-4 times until filtered solution is in colourless；Take one Quantitative thallus is immersed in and carries out secondary fermentation in the deionized water of former fermentation system same volume, 28 DEG C, 120r/min, shakes Swing culture for 24 hours.Thallus soak is filtered, filtrate is collected；
(3) primary dcreening operation of biosynthesis nano silver
Fresh concentration is the silver nitrate solution of 1mmol/L, by thallus soak and AgNO3Solution is carried out according to the ratio of 9:1 It mixes, reaction is stood under normal temperature and pressure conditions, AgNO will be not added with3Isometric soak of solution is set as blank control；Reaction After a period of time, nano silver characteristic absorption peak is detected in conjunction with UV-2600 ultraviolet-uisible spectrophotometer, judges whether there is nano silver The index being synthetically produced；
(4) identification of endogenetic fungus.
3. the biological synthesis method that bulbus fritillariae cirrhosae endogenetic fungus as claimed in claim 2 mediates nano silver, which is characterized in that interior life The identification of fungi includes:
A) Morphological Identification:
Micro-morphology analysis is carried out to the bacterial strain CBY4 and CBY13 of screening；
B) molecular biology identification:
The genomic DNA of bulbus fritillariae cirrhosae endogenetic fungus CBY13 is extracted using classical CTAB method:
It is put into mortar with the wet thallus of aseptic inoculation needle picking about 5g or so, liquid nitrogen grinding is added, ground fine powder is turned It moves on in the sterile centrifugation tube of 50mL, is stored in -20 DEG C of refrigerator overnights.
It takes out sample and 15mL buffer is added into sterile centrifugation tube, add NaCl the and 2mLCTAB lysate of 3mL 5mol, 65 DEG C of incubation 45min (, then 37 DEG C of incubation 15min.
20mLde chloroform: isoamyl alcohol=24:1 mixed liquor is added；It is uniformly mixed, after being placed at room temperature for 10min, 12000r/min centrifugation 20min discards supernatant the slow mixing of isopropanol of addition 11mL after liquid；
Nucleic acid particle is collected with centrifugal process 8000r/min centrifugation 10min, the nucleic acid particle to precipitate is washed with 70% ethyl alcohol Only, natural air drying 10min；
Obtained nucleic acid particle is suspended in 5mL sterile water；0.5mg DNase-free RNase, 37 DEG C of incubations are added 30min；
5mLde chloroform: isoamyl alcohol=24:1 mixed liquor, then plus 5mL phenol extraction DNA is added；
4mL isoamyl alcohol is added and precipitates DNA, then 8000r/min is centrifuged 10min.
Liquid is discarded supernatant, the DNA particle to precipitate is cleaned with 70% ethyl alcohol, and natural air drying is then dissolved in the TE of 0.5mL In buffer (10mM Tris-HCl and 0.1mmol EDTA, pH 7.5)；
The region target ITS1-5.8S rDNA-ITS2 is expanded with universal primer ITS1 and ITS4:
PCR primer: 5 '-TCCGTAGGTGAACCTGCGG-3 ' of upstream primer ITS1 and downstream primer ITS4 5 '- TCCTCCGCTTATTGATATGC-3′；
PCR system: 15 μ L of each 0.75 μ L of upstream and downstream primer, 2.0 μ L, 2 × Taq PCR Master Mix of DNA solution, water 11.5 μ L, whole system totally 30 μ L；
PCR reaction condition: 95 DEG C of initial denaturation 5min；94 DEG C of denaturation 45S, 52 DEG C of annealing 30S, 72 DEG C of extension 3min, 40 recycle, Then 72 DEG C of extension 15min；
Be sequenced after cutting glue purification to the PCR product come is amplified, column will be sequenced and be submitted to NCBI GenBank number According to BLAST comparison is carried out on library, the maximum and representative strain of similarity is chosen according to comparison result and utilizes MEGA5.10 Software carries out clustering using neighbor-joining (NJ) method.
4. the biological synthesis method that bulbus fritillariae cirrhosae endogenetic fungus as described in claim 1 mediates nano silver, which is characterized in that described The synthetic method of bulbus fritillariae cirrhosae endogenetic fungus biosynthesis nano silver further comprises:
The monitoring of nano silver synthesis process:
By the AgNO of soak and 1mmol/L3After solution is according to the ratio hybrid reaction of 9:1, in different times point 0h, 1h, 2h, 4h, 8h, 12h, for 24 hours, 48h and 72h take a certain amount of sample, sample is carried out using UV-2600 ultraviolet-uisible spectrophotometer Full wavelength scanner detects the variation of nano silver synthesis process；
The optimization of nano silver synthesis condition:
Analyze different illumination intensity, pH, AgNO3Influence of the concentration and temperature of solution to nano silver synthesis rate, to this 4 because Element optimizes；Different pH is 3.0,4.0,5.0,6.0,7.0,8.0,9.0,10.0 and 11.0；Different AgNO3Solution Concentration is 0.5,1,1.5,2,2.5,3,3.5mmol/L；Different intensities of illumination be 0,1000Lux, 1500Lux, 2000Lux and Different temperature is 4 DEG C, 25 DEG C and 50 DEG C.After reacting 48h at different conditions respectively, a small amount of sample is taken, UV, visible light is utilized Spectrophotometer carries out full wavelength scanner to sample；
The characterization of optimum synthesis nano silver:
Utilize the micromorphology of transmission electron microscope analysis nano silver:
It supports film copper mesh to place 3-5min in carbon sample drop, then sucks surplus liquid with filter paper；
It supports film copper mesh to place 2-3min in carbon 2% phosphotungstic acid drop, sucks surplus liquid, drying at room temperature with filter paper；
It is observed under transmission electron microscope, acquires image analysis.
5. a kind of bulbus fritillariae cirrhosae for the biological synthesis method synthesis for mediating nano silver using bulbus fritillariae cirrhosae endogenetic fungus described in claim 1 Endogenetic fungus mediates nano silver, which is characterized in that it is 4-AgNPs and 13- that the bulbus fritillariae cirrhosae endogenetic fungus, which mediates nano silver, AgNPs。
6. a kind of mediate the antibacterial to staphylococcus aureus of nano silver preparation using bulbus fritillariae cirrhosae endogenetic fungus described in claim 5 Drug.
7. a kind of medicine antibacterial to Escherichia coli for mediating nano silver preparation using bulbus fritillariae cirrhosae endogenetic fungus described in claim 5 Object.
8. a kind of anti-tumor agent for mediating nano silver preparation using bulbus fritillariae cirrhosae endogenetic fungus described in claim 5.
CN201811027521.0A 2018-09-04 2018-09-04 A kind of bulbus fritillariae cirrhosae endogenetic fungus mediates biological synthesis method and the application of nano silver Pending CN109097405A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811027521.0A CN109097405A (en) 2018-09-04 2018-09-04 A kind of bulbus fritillariae cirrhosae endogenetic fungus mediates biological synthesis method and the application of nano silver

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811027521.0A CN109097405A (en) 2018-09-04 2018-09-04 A kind of bulbus fritillariae cirrhosae endogenetic fungus mediates biological synthesis method and the application of nano silver

Publications (1)

Publication Number Publication Date
CN109097405A true CN109097405A (en) 2018-12-28

Family

ID=64865077

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811027521.0A Pending CN109097405A (en) 2018-09-04 2018-09-04 A kind of bulbus fritillariae cirrhosae endogenetic fungus mediates biological synthesis method and the application of nano silver

Country Status (1)

Country Link
CN (1) CN109097405A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112159765A (en) * 2020-10-22 2021-01-01 华侨大学 Ageratum endophytic fungus Letenadraea sp.WZ07 and application thereof in nano silver synthesis
CN113322191A (en) * 2021-07-05 2021-08-31 河南省科学院生物研究所有限责任公司 Aspergillus niger HQ-1 for preparing nano-silver and application thereof
CN115120614A (en) * 2022-07-07 2022-09-30 海南医学院 Composition for preparing nano silver composite, nano silver composite and application thereof

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102888428A (en) * 2011-07-21 2013-01-23 中国科学院过程工程研究所 Method for synthesizing nano silver by utilizing Bacillus amyloliquefaciensBacillus amyloliquefaciens LSSE-62
CN103331454A (en) * 2013-07-02 2013-10-02 南京大学 Nano-silver manufacturing technology
CN104450531A (en) * 2014-11-11 2015-03-25 四川农业大学 Bulbus fritillariae cirrhosae endophytic fungi CBY4 and application thereof
CN104762329A (en) * 2015-02-06 2015-07-08 东南大学 Method using fusarium venenatum 1281-2 to synthesize nano-silver
CN105039419A (en) * 2015-06-29 2015-11-11 山东师范大学 Method for utilizing trichoderma asperellum to synthetise nano silver
WO2016044716A1 (en) * 2014-09-19 2016-03-24 The American University In Cairo Nanoparticle-based combinatorial therapy
CN105935781A (en) * 2016-06-06 2016-09-14 江苏省农业科学院 Biological method for preparing nano-silver
CN107052360A (en) * 2017-04-13 2017-08-18 湖南工业大学 A kind of method that utilization spine spore mould prepares Nano Silver

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102888428A (en) * 2011-07-21 2013-01-23 中国科学院过程工程研究所 Method for synthesizing nano silver by utilizing Bacillus amyloliquefaciensBacillus amyloliquefaciens LSSE-62
CN103331454A (en) * 2013-07-02 2013-10-02 南京大学 Nano-silver manufacturing technology
WO2016044716A1 (en) * 2014-09-19 2016-03-24 The American University In Cairo Nanoparticle-based combinatorial therapy
CN104450531A (en) * 2014-11-11 2015-03-25 四川农业大学 Bulbus fritillariae cirrhosae endophytic fungi CBY4 and application thereof
CN104762329A (en) * 2015-02-06 2015-07-08 东南大学 Method using fusarium venenatum 1281-2 to synthesize nano-silver
CN105039419A (en) * 2015-06-29 2015-11-11 山东师范大学 Method for utilizing trichoderma asperellum to synthetise nano silver
CN105935781A (en) * 2016-06-06 2016-09-14 江苏省农业科学院 Biological method for preparing nano-silver
CN107052360A (en) * 2017-04-13 2017-08-18 湖南工业大学 A kind of method that utilization spine spore mould prepares Nano Silver

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
AL-ASKAR AA等: "Bioproduction of silver-nano particles by Fusarium oxysporum and their antimicrobial activity against some plant pathogenic bacteria and fungi", 《LIFE SCIENCE JOURNAL》 *
M. KARBASIAN等: "Optimizing Nano-silver Formation by Fusarium oxysporum PTCC 5115 Employing Response Surface Methodology", 《AMERICAN JOURNAL OF AGRICULTURAL AND BIOLOGICAL SCIENCES》 *
PAN,F.等: "Fusarium tricinctum strain CBY13 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence", 《GENBANK》 *
SWAPNIL C. GAIKWAD等: "Screening of different Fusarium species to select potential species for the synthesis of silver nanoparticles", 《JOURNAL OF THE BRAZILIAN CHEMICAL SOCIETY》 *
罗振: "《第四次工业革命-纳米技术》", 31 July 2014, 吉林人民出版社 *
苏天骄等: "川贝母内生真菌抑制酪氨酸酶活性的研究", 《天然产物研究与开发》 *
邓克莉: "川贝母内生真菌介导纳米银的生物合成及其活性分析", 《中国优秀硕士学位论文全文数据库 工程科技Ⅰ辑》 *
金征宇等: "《基因与纳米探针-医学分子成像理论与实践 上》", 30 November 2017, 天津科学技术出版社 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112159765A (en) * 2020-10-22 2021-01-01 华侨大学 Ageratum endophytic fungus Letenadraea sp.WZ07 and application thereof in nano silver synthesis
CN112159765B (en) * 2020-10-22 2022-06-07 华侨大学 Ageratum endophytic fungus Letenadraea sp.WZ07 and application thereof in nano silver synthesis
CN113322191A (en) * 2021-07-05 2021-08-31 河南省科学院生物研究所有限责任公司 Aspergillus niger HQ-1 for preparing nano-silver and application thereof
CN113322191B (en) * 2021-07-05 2022-08-12 河南省科学院生物研究所有限责任公司 Aspergillus niger HQ-1 for preparing nano-silver and application thereof
CN115120614A (en) * 2022-07-07 2022-09-30 海南医学院 Composition for preparing nano silver composite, nano silver composite and application thereof
CN115120614B (en) * 2022-07-07 2023-08-22 海南医学院 Composition for preparing nano silver compound, nano silver compound and application thereof

Similar Documents

Publication Publication Date Title
Win et al. Fungus-(Alternaria sp.) mediated silver nanoparticles synthesis, characterization, and screening of antifungal activity against some phytopathogens
Sadowski Biosynthesis and application of silver and gold nanoparticles
Dutta et al. Scope of green nanotechnology towards amalgamation of green chemistry for cleaner environment: A review on synthesis and applications of green nanoparticles
CN105586298B (en) A kind of application of bacillus subtilis, microbial inoculum, the preparation method of microbial inoculum and microbial inoculum
CN101423812B (en) Bacillus amyloliquefaciens and microbiological preparation and preparation method thereof
CN109097405A (en) A kind of bulbus fritillariae cirrhosae endogenetic fungus mediates biological synthesis method and the application of nano silver
CN106513707A (en) Nano silver bacteriostatic agent biosynthesized through blueberry leaf extracting solution and preparation process of nano silver bacteriostatic agent
Dananjaya et al. In vitro and in vivo anticandidal efficacy of green synthesized gold nanoparticles using Spirulina maxima polysaccharide
CN102703342B (en) Bacillus velezensis ZJ20 strain and liquid preparations thereof
Iqbal et al. Biosynthesis of silver nanoparticles from leaf extract of Litchi chinensis and its dynamic biological impact on microbial cells and human cancer cell lines
CN106119136B (en) Epicoccum nigrum and its application
Netala et al. Endophytic fungal assisted synthesis of silver nanoparticles, characterization, and antimicrobial activity
Qu et al. Biosynthesis of silver nanoparticles (AgNPs) employing Trichoderma strains to control empty-gut disease of oak silkworm (Antheraea pernyi)
CN104962500A (en) Phosphate-solubilizing bacterium, and separation and culture method and application thereof
CN105331545B (en) A kind of bacterial strain for preventing and treating apple tree canker, microbial bacterial agent and preparation method thereof
CN103436465B (en) Alcaligenes faecalis strain
CN107382511A (en) A kind of Chinese herbal medicine fermentation fertilizer for preventing and treating cucumber fusarium axysporum and preparation method thereof
CN102021131B (en) Bacillus licheniformis strain and application thereof
Saravanakumar et al. Nano Ag@ bioactive microspheres from marine sponge Clathria frondifera: Fabrication, fortification, characterization, anticancer and antibacterial potential evaluation
CN105769938B (en) One plant of light brown Aode mushroom and its application
CN109439582A (en) Raw bacillus megaterium and its application in Bo chrysanthemum
CN108002885A (en) A kind of Trichoderma-jinggangmeisu granule and preparation method thereof
CN107354175A (en) A kind of silver nano material and its biological preparation method and application
Bloch et al. Endophytic fungi-mediated synthesis of gold and silver nanoparticles
Ramamoorthy et al. Green synthesis of silver nanoparticles using red seaweed Portieria hornemannii (Lyngbye) PC silva and its antifungal activity against silkworm (Bombyx mori L.) Muscardine pathogens

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20181228

RJ01 Rejection of invention patent application after publication