CN104450531A - Bulbus fritillariae cirrhosae endophytic fungi CBY4 and application thereof - Google Patents

Abstract

The invention discloses bulbus fritillariae cirrhosae endophytic fungi CBY4 and application thereof. The bulbus fritillariae cirrhosae endophytic fungi CBY4 are separated from the living bulbs of bulbus fritillariae cirrhosae which belongs to fritillary in liliaceae by adopting a tissue-block separation and purification technology. The morphological identification and the molecular biological identification prove that the bulbus fritillariae cirrhosae endophytic fungi CBY4 are fusarfum tricinctum which belongs to fusarium. The bulbus fritillariae cirrhosae endophytic fungi CBY4 was collected in China General Microbiological Culture Collection Center (CGMCC) with the collection number of CGMCC NO. 9719 and the serial number of CBY4 on October 11, 2014. Fritillaria alkaloids including peimisine and peiminine are generated due to the liquid fermentation of the bulbus fritillariae cirrhosae endophytic fungi CBY4. The bulbus fritillariae cirrhosae endophytic fungi CBY4 are important microorganisms for searching major alkaloids of peimisine and peiminine which come from fritillary and serve as new resources.

Description

A kind of Unibract Fritillary Bulb endogenetic fungus CBY4 and application thereof

Technical field

The present invention relates to microbial technology field, specifically a kind of Unibract Fritillary Bulb endogenetic fungus CBY4 and application thereof.

Background technology

Unibract Fritillary Bulb (Fritillaria cirrhosa D.Don.) is Liliaceae Fritillaria Linn, is also called Fritillaria Cirrhosa D. Don, and pharmacopeia over the years is all included one of the Ji Yuan kind into Unibract Fritillary Bulb medicinal material.It is used as medicine with bulb, and primary efficacy is clearing heat and moistening lung, preventing phlegm from forming and stopping coughing.Because its growth year is long, output is relatively low, the west Sichuan plateau grown at height above sea level 3000 ~ 4000m, main product Sichuan Province Ganzi more.It is in imminent danger that quick growth due to the market requirement accelerates Unibract Fritillary Bulb resource, become China's three-level protective species.The main active ingredient of bulb of fritillary bulb is alkaloid, and has been separated in Unibract Fritillary Bulb and has determined that the alkaloid of structure mainly contains Imperialine, peimisine, peimine, Peininine, cloud shellfish ketone, different Bulbus Fritillariae cirrhosae alkali etc.This type of alkaloidal microorganism can be produced if searched out, the imbalance between supply and demand to medicinal materials such as Unibract Fritillary Bulbs on market can be alleviated, protect again the wild resource of Unibract Fritillary Bulb to a certain extent.

Endogenetic fungus (Eendophytic fungi) broad sense refers to live in plant materials always or the certain phase of its life history is in fungi in plant materials; Narrow sense refers to be present in the histoorgan of healthy plant, host is not formed to the fungi of obviously contaminating.Growing of the metabolite energy stimulating plant of endogenetic fungus, and host plant can be improved externally coerce resistivity.In recent years, find the research of many economy such as green onion, pteridophyte, willow, oily camphor tree, dragon tree, Endophytic Fungi of Medicinal Plant, endogenetic fungus can produce and the same or analogous meta-bolites with physiologically active of host.This is for some medicinal plants in imminent danger; the endogenetic fungus with the same or analogous activeconstituents of its host can be produced by screening; and by the artificial reconstructed bioactive ingredients reaching high-yield and high-efficiency, have important theory and realistic meaning to the protection of the wild resource of these medicinal plants and the exploitation of its Microbial resources undoubtedly.It is more worth it is to be noted that this seminar once obtained the bacterial strain WBS007 that can produce bulb of fritillary Alkaloid from watt cloth bulb of fritillary endogenetic fungus.So, obtain from endogenetic fungus, with the same or analogous activeconstituents of host plant, there is realistic feasibility.

Summary of the invention

The object of the present invention is to provide a kind of new Unibract Fritillary Bulb endogenetic fungus CBY4, and propose its purposes, namely can produce peimisine and Peininine alkaloid by fermentable, to solve the problem proposed in above-mentioned background technology.

For achieving the above object, the invention provides following technical scheme:

A kind of Unibract Fritillary Bulb endogenetic fungus CBY4, it is characterized in that, be the Fusarfum tricinctum in sickle-like bacteria, and its preservation registration number is CGMCC NO.9719, and Classification And Nomenclature is three line sickle spore Fusarium tricinctum, and strain number is CBY4.This bacterial strain is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, preservation address on October 11st, 2014: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, and preserving number is CGMCC NO.9719.

As the further scheme of the present invention: 28 DEG C of cultivations on PDA solid medium, mycelia fine hair shape, the edge initial stage is smooth, subsequently in wavy, bacterium colony is rounded, newborn mycelia is in white, to outgrowth, and fade to pink, the 3rd day starts, between the pink mycelia of edge white hypha and bacterium colony central authorities, occur faint yellow concentric circles mycelia, grow into the 10th day, bacterium colony presents pink, faint yellow, pink, white alternate concentric(al) circles from inside to outside, and cultivating the tenth day its colony diameter is 3.9 ± 0.1cm, and bacterium colony thickness is 0.2 ~ 0.5cm.

As the further scheme of the present invention: the liquid culture of described Unibract Fritillary Bulb endogenetic fungus CBY4 is:

(1) PDB substratum: containing fermented liquid 100ml in 250ml shaking flask, inoculation 6mm bacterium cake 5 pieces, shake-flask culture 4 days, culture temperature 28 ± 1 DEG C, concussion speed 130r/min, darkroom is cultivated, as the seed liquor of enlarged culturing; And then be substratum with PDB, containing fermented liquid 150ml in 250ml shaking flask, inoculum size is 1%, cultivates 7 days;

(2) fermentation culture feature:

Cultivate and within 1st ~ 3 days, have into the appearance of cotton shape mycelia, nutrient solution is clarified; Cultivate the 4th day, cotton shape mycelia increases and increases, and cotton shape band goes out ready-made ball local bulkiness, and fermented liquid is clarified; 5th ~ 6 days, fermented liquid had the spherical mycelia of two kinds of different sizes, and large spherical hyphal diameter is 5 ~ 15mm, and coccoid mycelia is directly 0.7 ~ 2mm, the muddiness that fermented liquid becomes; 7th ~ 8 days, spherical mycelia became large slightly, and obvious change does not appear in further feature; Whole process of growth mycelia is in white, and fermented liquid is become faint yellow from glassy yellow.

As the further scheme of the present invention: the microscopic morphology of Unibract Fritillary Bulb endogenetic fungus CBY4 is: mycelia have every; Macroconidium sickleshaped, fusiform to wide sickleshaped, be 3 every ~ 5 every, and be born in conidiophore top, size is 28 ~ 40 × 3 ~ 4 μm, and two ends are sharper; Bar-shaped or the oval of microconidium, the size of monospore, bar-shaped spore is 6 ~ 10 × 2 ~ 3 μm, and oval spore diameter is 2.2 ~ 4.1 μm; Chlamydospore is spherical in shape, and wall is smooth, and a life or top life, 5-15 bunchiness, diameter is 5 ~ 10 × 5 ~ 8.5 μm.

As the further scheme of the present invention: the ITS1-5.8S rDNA-ITS2 base sequence of Unibract Fritillary Bulb endogenetic fungus CBY4 is:

GGGTACGGGGTTTCACTCCAACCCCTGTGTACATACCTTAATGTTGCCTCGGCGGATCAGCCCGCGCCCCGTAAAACGGGACGGCCCGCCAGAGGACCCAAACTCTAATGTTTCTTATTGTAACTTCTGAGTAAAACAAACAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTGGTATTCCGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCTCTGCCCTTCTGGGCGGTGCCGCCCCCGAAATACATTGGCGGTCTCGCTGCAGCCTCCATTGCGTAGTAGCTAACACCTCGCAACTGGAACGCGGCGCGGCCATGCCGTAAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGGCGGAGGA。

The application of described Unibract Fritillary Bulb endogenetic fungus CBY4, for the preparation of peimisine and Peininine compound.

As the further scheme of the present invention: described Unibract Fritillary Bulb endogenetic fungus CBY4, for the preparation of peimisine and Peininine alkaloid, comprises the following steps:

(1) by Unibract Fritillary Bulb endogenetic fungus CBY4 after PDA substratum activates 4 days, cut-off footpath is that the bacterium block of 6mm is inoculated in the PDB nutrient solution of 100mL/250mL, is placed in 28 DEG C of constant-temperature table 130r/min and cultivates 4 days; Enlarged culturing in the PDB nutrient solution this fermented liquid being inoculated into 150mL/250mL, its inoculum size is 1%;

(2) ferment complete, collect after culture filters, utilize strong aqua that the pH of fermented liquid is transferred to 9 ~ 11, then use dichloromethane extraction 2 ~ 3 times, add that methylene chloride volume is fermentating liquid volume 1/4 at every turn; Collect methylene dichloride, and be placed on water-bath and volatilize with furnace pot, then redissolve residue namely obtain peimisine and Peininine alkaloid with organic membrane filtration of 0.22 μm with methyl alcohol.

Compared with prior art, the invention has the beneficial effects as follows: Unibract Fritillary Bulb endogenetic fungus CBY4 of the present invention, peimisine and Peininine compound can be produced by strain liquid fermentation, be the important microbe finding bulb of fritillary Alkaloid new resources, there is larger using value.

Accompanying drawing explanation

Fig. 1 is Unibract Fritillary Bulb endogenetic fungus CBY4 of the present invention on the PDA plate culture medium colonial morphology figure of 1 ~ 8 day;

Fig. 2 is the Unibract Fritillary Bulb endogenetic fungus CBY4 shaking flask liquid fermenting of the present invention aspect graph of 1 ~ 8 day;

Fig. 3 is the micro-structure diagram of Unibract Fritillary Bulb endogenetic fungus CBY4 of the present invention, comprises (A) microconidium, (B) chlamydospore, (C) macroconidium and (D) macroconidium stalk;

Fig. 4 is Unibract Fritillary Bulb endogenetic fungus CBY4 phylogenetic tree of the present invention;

Fig. 5 is the HPLC-ELSD color atlas of Unibract Fritillary Bulb endogenetic fungus CBY4 fermented liquid dichloromethane extract (A) of the present invention and three kinds of standard substance (B) [i.e. peimisine (1), sipeimine (2) and Peininine (3)];

Fig. 6 is Unibract Fritillary Bulb endogenetic fungus CBY4 fermented liquid dichloromethane extract (A) of the present invention, the total ion current figure of the UPLC-MS of peimisine (B) and Peininine (C);

Fig. 7 is the UPLC-MS mass spectrum of Unibract Fritillary Bulb endogenetic fungus CBY4 fermented liquid dichloromethane extract of the present invention and peimisine and Peininine, comprise peimisine standard substance (A) and fermentation broth extract (B) is 4.5min place mass spectrum in retention time, Peininine standard substance (C) and fermentation broth extract (D) are 4.9min place mass spectrum in retention time.

Embodiment

Below in conjunction with the embodiment of the present invention, be clearly and completely described the technical scheme in the embodiment of the present invention, obviously, described embodiment is only the present invention's part embodiment, instead of whole embodiments.Based on the embodiment in the present invention, those of ordinary skill in the art, not making the every other embodiment obtained under creative work prerequisite, belong to the scope of protection of the invention.

Embodiment 1

In the embodiment of the present invention, a kind of Unibract Fritillary Bulb endogenetic fungus CBY4 and application thereof.

1. strains separation purifying:

Unibract Fritillary Bulb endogenetic fungus CBY4 of the present invention is the bacterial strain obtained from the healthy bulb of 3 years raw Unibract Fritillary Bulbs of bridge Unibract Fritillary Bulb base, Chengdu En Wei group new capital plantation.Unibract Fritillary Bulb endogenetic fungus CBY4 of the present invention is separated acquisition according to the following steps: clear water rinses 3 ~ 4-75% alcohol rinsing 30s-aseptic water washings, 3 ~ 5-0.1% mercuric chloride sterilization 3 ~ 5min-aseptic water washings 3 times.The flat board that material adopts three print methods to be placed in PDA substratum is cultivated, light culture in 28 DEG C of incubators, observe after 3 ~ 4 days and produce with or without bacterium colony, if find aseptic in PDA substratum being born into, prove the sterilization of this material surface thoroughly, three print methods print three time by n-trans-positive order by material on substratum.Sample sterile mortar thoroughly of sterilizing wears into homogenate shape, then get and smear evenly in PDA media surface in right amount, each process in triplicate, put in 28 DEG C of thermostat containers and cultivate 5 ~ 7 days, after having mycelia to grow, picking mycelia tip is transferred to purifying on new PDA substratum and is cultivated, and merges by form, finally obtains Unibract Fritillary Bulb endogenetic fungus CBY4 bacterial strain of the present invention.Then forward in the slant tube containing PDA and seal up for safekeeping with paraffin, put in 4 DEG C of refrigerators and preserve bacterial classification.Above as add-on 30 μ g Vetstrep and 30 μ g penbritin sodium salts in separation PDA substratum every milliliter of substratum.

2. bacterial strain screening and target component analysis

(1) get Unibract Fritillary Bulb endogenetic fungus CBY4 bacterial classification of the present invention, aseptically, with a small amount of mycelia of inoculating needle picking, access on the flat board of sterilized solid PDA medium, in 28 DEG C of activation culture 4 days.The form of Unibract Fritillary Bulb endogenetic fungus CBY4 on the flat board of PDA substratum as shown in Figure 1.

(2) bacterial classification after activation culture is got, aseptically, cut-off footpath is that the bacterium block of 6mm is inoculated into (100mL/250mL) in potato dextrose broth PDB, every bottle graft kind 5 bacterium blocks, be placed in 28 DEG C of constant-temperature table 130r/min and cultivate 4 days as seed liquor, be then inoculated into again PDB liquid nutrient medium (150mL/250mL) and expand fermentation 7 days.The form of Unibract Fritillary Bulb endogenetic fungus CBY4 in PDA substratum as shown in Figure 2.

(3) ferment complete, after collecting culture filtration, with strong aqua, fermented liquid is adjusted pH9 ~ 11, add methylene chloride extraction 2 ~ 3 times, methylene chloride is 1/4th of fermentating liquid volume, collect dichloromethane layer, volatilize with furnace pot in water-bath, needed for obtaining with 0.22 μm of organic membrane filtration after residue methyl alcohol redissolves, prepare liquid.

(4) operation of alkaloid color reaction is as follows: Dragendorff's reagent, Wagner's reagent, Mayer's reagent, improvement Dragendorff's reagent, it is all with reference to " Chinese Pharmacopoeia " 2010 editions preparation.Configure the standardized solution of about 1mg/mL with peimisine and Peininine standard substance simultaneously, and as positive reference substance.Sample thief prepares liquid and positive reference substance, drip less than 1 ~ 2 reagent respectively: Dragendorff's reagent, Wagner's reagent, Mayer's reagent, improvement Dragendorff's reagent, observe colour-change, be negative control with empty substratum, positive control solution is positive control.If generation yellow-orange precipitate, then it is positive reaction; If it is muddy to produce blue or green brown, be negative reaction.

(5) HPLC-ELSD analysis operation is as follows:

Prepared by test sample: configuration peimisine, sipeimine and Peininine standard solution, concentration is about 1mg/mL, and then mixed diluting is to suitable concn.Bacterial strain CBY4 is for manufacturing experimently standby liquid according to this example (2), (3) described preparation.HPLC chromatographic condition: chromatographic column is InertsilODS-3,4.6*150mm, 5um; Moving phase is acetonitrile (A) and the ultrapure water (B) containing 0.1% triethylamine, and flow velocity 1mL/min, adopts gradient elution, concrete as table 1; Column temperature is 25 DEG C; Sample size is 20 μ L.

Table 1

Time/min	0	10	18	25	28	36	37	48
									A％	45	52	62	62	90	90	45	45

ELSD optimum configurations is: take pressurized air as carrier gas, and flow velocity is 3.0L/min, drift tube temperature 100 DEG C.

(6) UPLC-MS analysis operation is as follows:

Prepared by test sample: because HPLC-ELSD detects in fermented liquid the peak only having peimisine retention time identical with Peininine, therefore this test only selects these two kinds of standardized solution to test further.Fermentation broth extract is prepared the same.

UPLC chromatographic condition:

INSTRUMENT MODEL: the UPLC-Xevo of U.S. Waters ^tMtQ MS; Chromatographic column is ACQUITY UPLC BEH-C18 post, 2.1 × 50mm, 1.7 μm, and moving phase is 0.1% formic acid water (B) and acetonitrile (A), flow velocity 0.4mL/min, adopts gradient elution, concrete as table 2; Column temperature 50 DEG C; Sample disc temperature: 15 DEG C, sample size 2 μ L.

Table 2

Time	Initial	10	12	15	17	18	20
								B％	5	45	45	70	95	95	5

MS condition: desolvation temperature 400 DEG C, desolvation gas velocity 400 DEG C, capillary voltage 3KV, taper hole voltage 30V, ion source temperature 150 DEG C, sweep limit: 400 ~ 650, ion source: electron spray ionisation.

(7) as shown in Figure 5, through above alkaloid color reaction, HPLC-ELSD analyzes, and shows that Unibract Fritillary Bulb endogenetic fungus CBY4 strain liquid of the present invention fermentation may produce peimisine and Peininine compound.Thus tested further by UPLC-MS.As shown in Figure 6, there is the appearance time of 2 quasi-molecular ions consistent with peimisine and Peininine in sample.And the ion scan collection of illustrative plates of Fig. 7 B of No. 1 its correspondence of peak in Fig. 6 A has the molecule of identical mass-to-charge ratio (m/z) with the ion scan collection of illustrative plates of Fig. 7 A corresponding to Fig. 6 B peimisine mark product; The ion scan collection of illustrative plates of Fig. 7 D of No. 2 its correspondences of peak in same Fig. 6 A has the molecule of identical mass-to-charge ratio (m/z) with the ion scan collection of illustrative plates of Fig. 7 C corresponding to Fig. 6 C Peininine mark product.Therefore combine above analysis and can prove that Unibract Fritillary Bulb endogenetic fungus CBY4 can produce peimisine and Peininine two kinds of bulb of fritillary Alkaloids.

3. identification of strains:

(1) extraction of DNA: get Unibract Fritillary Bulb endogenetic fungus CBY4 bacterial classification of the present invention, collects mycelia 45 DEG C oven dry by fermentation afterwards.Get about 0.5g mycelia, use liquid nitrogen grinding powdered.Join in EP pipe, and add wherein at 1.5 × CTAB (containing beta-mercaptoethanol) the solution 600 μ L of 65 DEG C of preheatings, shake up rearmounted 65 DEG C of water-bath 30 ~ 60min, period puts upside down 3 ~ 5 times back and forth.Get again after EP pipe is cooled to room temperature and add isopyknic phenol, chloroform, iso pentane alcohol mixture, wherein phenol: chloroform: the volume ratio of primary isoamyl alcohol is 25: 24: 1, fully puts upside down mixing, by the protein removing contained in extracting solution.The centrifugal 10min of 12000r/min.Getting supernatant liquor proceeds in new EP pipe, it should be noted that and be not drawn onto intermediate protein layer, add isopyknic chloroform, iso pentane alcohol mixture, wherein chloroform: the health check-up of primary isoamyl alcohol and than being 24: 1, fully put upside down mixing, extracting protein wherein, and the phenol that extraction is residual, the centrifugal 10min of 12000r/min.Supernatant liquor is being transferred in another centrifuge tube, and is adding in the cold Virahol of 1 times of volume, fully putting upside down mixing, be statically placed in-20 DEG C of place 10 ~ 20min, DNA is separated out from solution.The centrifugal 5min of 12000r/min again.Finally respectively rinse 1 ~ 2 time with the alcohol of 75%, 85% and 95% respectively.Volatilize rear use 50 μ LTE solution and check whether with gel electrophoresis and extract DNA, the DNA extracted is ITS1-5.8SrDNA-ITS2 sequence PCR further and reacts.

(2) PCR reaction

Reaction system is: each 0.75 μ L of ITS1 and ITS2 primer, and DNA solution 2.0 μ L, 2 × Taq PCR Master Mix15 μ L, add water 11.5 μ L, and whole system is totally 30 μ L.

Reaction conditions:

A.95 DEG C denaturation 5min;

B.94 DEG C sex change 45s;

C.52 DEG C annealing 30s;

D.72 DEG C extension 3min;

E.72 DEG C extension 15min;

F.4 DEG C preservation.Wherein step b-d needs through 40 loop cycles.

Check order again after glue purification is cut to amplification PCR primer out.

(3) cluster analysis

Be submitted to by checked order row on NCBI Gene bank database and carry out BLAST comparison, the similarity of result display Unibract Fritillary Bulb endogenetic fungus CBY4 and Fusarfum tricinctum (AB369468) is 98%.Choose the highest sequence of front 10 strain similarities utilizes MEGA5.1 software to adopt Neighbor-Joining (NJ) method constructing system evolutionary tree simultaneously, as shown in Figure 4.CBY4 is together with Fusarfum tricinctum (KJ598869) cluster in result display, so combining form feature, confirmation CBY4 is Fusarfum tricinctum.

To those skilled in the art, obviously the invention is not restricted to the details of above-mentioned one exemplary embodiment, and when not deviating from spirit of the present invention or essential characteristic, the present invention can be realized in other specific forms.Therefore, no matter from which point, all should embodiment be regarded as exemplary, and be nonrestrictive, scope of the present invention is limited by claims instead of above-mentioned explanation, and all changes be therefore intended in the implication of the equivalency by dropping on claim and scope are included in the present invention.

In addition, be to be understood that, although this specification sheets is described according to embodiment, but not each embodiment only comprises an independently technical scheme, this narrating mode of specification sheets is only for clarity sake, those skilled in the art should by specification sheets integrally, and the technical scheme in each embodiment also through appropriately combined, can form other embodiments that it will be appreciated by those skilled in the art that.

Claims (7)

1. a Unibract Fritillary Bulb endogenetic fungus CBY4, is characterized in that, is the Fusarfum tricinctum in sickle-like bacteria, and its preservation registration number is CGMCC NO.9719, and strain number is CBY4.

2. Unibract Fritillary Bulb endogenetic fungus CBY4 according to claim 1, it is characterized in that, 28 DEG C of cultivations on PDA solid medium, mycelia fine hair shape, the edge initial stage is smooth, subsequently in wavy, bacterium colony is rounded, newborn mycelia is in white, to outgrowth, and fade to pink, between the pink mycelia of edge white hypha and bacterium colony central authorities, faint yellow concentric circles mycelia is there is when the 3rd day, grow into the 10th day, bacterium colony presents pink from inside to outside, faint yellow, pink, the alternate concentric(al) circles of white, cultivating the tenth day its colony diameter is 3.9 ± 0.1cm, bacterium colony thickness is 0.2 ~ 0.5cm.

3. Unibract Fritillary Bulb endogenetic fungus CBY4 according to claim 1, is characterized in that, its liquid culture is:

(1) PDB substratum: containing fermented liquid 100ml in 250ml shaking flask, inoculation 6mm bacterium cake 5 pieces, shake-flask culture 4 days, culture temperature 28 ± 1 DEG C, concussion speed 130r/min, darkroom is cultivated, as the seed liquor of enlarged culturing; And then be substratum with PDB, containing fermented liquid 150ml in 250ml shaking flask, inoculum size is 1%, cultivates 7 days;

(2) fermentation culture feature:

Cultivate and within 1st ~ 3 days, have into the appearance of cotton shape mycelia, nutrient solution is clarified; Cultivate the 4th day, cotton shape mycelia increases and increases, and cotton shape band goes out ready-made ball local bulkiness, and fermented liquid is clarified; 5th ~ 6 days, fermented liquid had the spherical mycelia of two kinds of different sizes, and large spherical hyphal diameter is 5 ~ 15mm, and coccoid mycelia is directly 0.7 ~ 2mm, and fermented liquid becomes muddy; 7th ~ 8 days, spherical mycelia became large 0.1 ~ 1mm; Whole process of growth mycelia is in white, and fermented liquid is become faint yellow from glassy yellow.

4. Unibract Fritillary Bulb endogenetic fungus CBY4 according to claim 1, is characterized in that, its microscopic morphology is: mycelia have every; Macroconidium sickleshaped, fusiform, wide sickleshaped, be 3 every ~ 5 every, and be born in conidiophore top, size is 28 ~ 40 × 3 ~ 4 μm; Bar-shaped or the oval of microconidium, the size of monospore, bar-shaped spore is 6 ~ 10 × 2 ~ 3 μm, and oval spore diameter is 2.2 ~ 4.1 μm; Chlamydospore is spherical in shape, and wall is smooth, and a life or top life, 5-15 bunchiness, diameter is 5 ~ 10 × 5 ~ 8.5 μm.

5. Unibract Fritillary Bulb endogenetic fungus CBY4 according to claim 1, is characterized in that, its ITS1-5.8SrDNA-ITS2 base sequence is:

GGGTACGGGGTTTCACTCCAACCCCTGTGTACATACCTTAATGTTGCCTCGGCGGATCAGCCCGCGCCCCGTAAAACGGGACGGCCCGCCAGAGGACCCAAACTCTAATGTTTCTTATTGTAACTTCTGAGTAAAACAAACAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTGGTATTCCGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCTCTGCCCTTCTGGGCGGTGCCGCCCCCGAAATACATTGGCGGTCTCGCTGCAGCCTCCATTGCGTAGTAGCTAACACCTCGCAACTGGAACGCGGCGCGGCCATGCCGTAAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGGCGGAGGA。

6. an application of the Unibract Fritillary Bulb endogenetic fungus CBY4 as described in as arbitrary in claim 1-5, is characterized in that, for the preparation of peimisine and Peininine compound.

7. the application of Unibract Fritillary Bulb endogenetic fungus CBY4 according to claim 6, is characterized in that, for the preparation of peimisine and Peininine alkaloid, comprise the following steps:

(1) by Unibract Fritillary Bulb endogenetic fungus CBY4 after PDA substratum activates 4 days, cut-off footpath is that the bacterium block of 6mm is inoculated in PDB nutrient solution, is placed in 28 DEG C of constant-temperature table 130r/min and cultivates 4 days; This fermented liquid is being inoculated into enlarged culturing in another PDB nutrient solution, and its inoculum size is 1%;

(2) ferment complete, collect after culture filters, utilize strong aqua that the pH of fermented liquid is transferred to 9 ~ 11, then use dichloromethane extraction 2 ~ 3 times, add that methylene chloride volume is fermentating liquid volume 1/4 at every turn; Collect methylene dichloride, and be placed on water-bath and volatilize with furnace pot, then redissolve residue namely obtain peimisine and Peininine alkaloid with organic membrane filtration of 0.22 μm with methyl alcohol.