CN109082442B - A kind of preparation method for the mescenchymal stem cell for releasing immunosupress and enhancing tumor-targeting killing - Google Patents

A kind of preparation method for the mescenchymal stem cell for releasing immunosupress and enhancing tumor-targeting killing Download PDF

Info

Publication number
CN109082442B
CN109082442B CN201810784680.9A CN201810784680A CN109082442B CN 109082442 B CN109082442 B CN 109082442B CN 201810784680 A CN201810784680 A CN 201810784680A CN 109082442 B CN109082442 B CN 109082442B
Authority
CN
China
Prior art keywords
stem cell
gene
transfected
cell
sgrna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201810784680.9A
Other languages
Chinese (zh)
Other versions
CN109082442A (en
Inventor
李程
周海波
丁秋蓉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hangzhou View Health Technology Co Ltd
Original Assignee
Hangzhou View Health Technology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hangzhou View Health Technology Co Ltd filed Critical Hangzhou View Health Technology Co Ltd
Priority to CN201810784680.9A priority Critical patent/CN109082442B/en
Priority to PCT/CN2018/119852 priority patent/WO2020015279A1/en
Publication of CN109082442A publication Critical patent/CN109082442A/en
Application granted granted Critical
Publication of CN109082442B publication Critical patent/CN109082442B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Immunosupress can be released present disclose provides one kind and enhances the preparation method of the mescenchymal stem cell of tumor-targeting killing, and this method comprises the following steps: S1, will be mixed to form RNP compound for sgRNA the and Cas9 albumen for knocking in site of PD-1 gene；S2, the AAV virion to be transfected for carrying trail dna is formed；S3, the suspension of stem cell is mixed to the suspension of the RNP compound and is carried out electricity turn, obtain the culture after electricity turns；S4, culture of the suspension of AAV virion to be transfected to be transfected, after being transfected is added into the material after the electricity turn；S5, monoclonal culture will be carried out after the culture Method of Limited Dilution after the transfection, pass through PCR and sequencing and filtering out and carried out gene and orient the monoclonal cell strain knocked in.Through the above technical solutions, the present invention is prepared for a kind of human mesenchymal stem cell that can release immunosupress and enhance tumor-targeting killing.

Description

A kind of mescenchymal stem cell releasing immunosupress and enhance tumor-targeting killing Preparation method
Technical field
This disclosure relates to technical field of pharmaceutical biotechnology, and in particular, to one kind can release immunosupress and enhance tumor target The preparation method of the mescenchymal stem cell of tropism killing.
Background technique
The study found that mescenchymal stem cell (MSCs) has specific migration to primary tumor site and neoplasm metastasis Feature, and itself antitumor characteristic is shown, it can make to include liver cancer, lymthoma and insulinoma Cellular retention in G0/G1 Phase inhibits growth of tumour cell, cancer cell specific induction of apoptosis.Therefore, mescenchymal stem cell is expected to as the excellent of neoplasm targeted therapy Good carrier.The mescenchymal stem cell being genetically engineered can overcome conventional medicine half as a kind of effective alternative medicine Declining, the phase is short and the clinical limitation of high drug toxicity.Existing research discovery is transduceed in MSCs using adenovirus expresses IL-12, Have to renal cancer tumor cell and inhibits growth.With the retrovirus of expression herpes simplex virus thymidine kinase (HSV-tk) MSCs is transfected, using HSV-tk/gcv suicide gene therapy, there is the effect of inducing neural glioma cell death in vitro in vivo Fruit.But the efficiency of the elimination tumour of mescenchymal stem cell is still to be improved.
CRISPR gene editing technology forms DNA double by carrying out accurate targeting shearing in genome specific site Chain notch (Double-strand breaks, DSBs) links (Non-homologous end by intracellular nonhomologous end Joining, NHEJ) it realizes to the knockout of gene in situ, pass through homologous recombination (Homology directed repair, HDR) In the presence of external source gene template, the introducing of point mutation and inserting for reparation and large fragment gene (such as reporter gene) are realized Enter.As described in patent document CN105985985A, slow virus is constructed using CRISPR/Cas9 system, to umbilical cord source Immunizing antigen B2M, inflammatory factor TNF-α in MSCs are knocked out, so that realizing reduces allosome mescenchymal stem cell immunogen The purpose of property.But in mammalian cells, NHEJ revision points account for dominant pattern, realize gene knockout than realizing gene knock-in It is easy very much.And the segment of gene knock-in is bigger, it is lower to integrate probability, and technology is realized more difficult.It has had not yet to see The report of large fragment gene knock-in is carried out in MSCs.
Summary of the invention
The purpose of the disclosure is to overcome mescenchymal stem cell there are immunosupress and lack to the killing-efficiency of tumour is lower It falls into, releases the immunosupress of mescenchymal stem cell and improve mescenchymal stem cell to the killing-efficiency of tumour.
To achieve the goals above, immunosupress can be released present disclose provides one kind and enhance tumor-targeting killing The preparation method of mescenchymal stem cell, this method comprises the following steps: S1, the sgRNA for knocking in site that will be directed to PD-1 gene RNP compound is mixed to form with Cas9 albumen；S2, will inserted with template DNA homologous recombination carrier package to AAV virus in, Form AAV virion to be transfected；The template DNA includes the left homology arm sequence for knocking in site and the right side for PD-1 gene Homology arm sequence, inserted with trail dna between the left homology arm sequence and the right homology arm sequence；And it can pass through The orientation of trail dna knocks in the expression silencing so that PD-1 gene；S3, the suspension of mescenchymal stem cell and the RNP are answered The suspension for closing object, which mixes and carries out electricity, to be turned, and the culture after electricity turns is obtained；S4, electricity turn after 1-30 minutes in, Xiang Suoshu The suspension of AAV virion to be transfected is added to carry out transfection in 4-30 hours, after being transfected in material after electricity turn Culture；S5, monoclonal culture will be carried out after the culture Method of Limited Dilution after the transfection, and pass through PCR and sequencing screening Gene has been carried out out orients the monoclonal cell strain knocked in.
Through the above technical solutions, the present invention, which establishes one kind, efficiently to knock in long segment report base in mescenchymal stem cell The method of cause is inserted into tumor necrosin relative death inducing ligand while knocking out PD-1 gene in mescenchymal stem cell (TRAIL, TNF-related apoptosis-inducing ligand) gene is realized by knocking out PD-1 to CD8+T cell The releasing (G0/G1 phase cell quantity is reduced, and S phase cell quantity increases) of inhibition, is selectively induced by knocking in TRAIL realization Apoptosis of tumor cells is prepared for a kind of human mesenchymal stem cell that can release immunosupress and enhance tumor-targeting killing.This That invention solves in microenvironment common in oncotherapy that there are immunosupress and conventional medicine toxicity simultaneously is big, does not have and targets The problem of property.
Other feature and advantage of the disclosure will the following detailed description will be given in the detailed implementation section.
Specific embodiment
The specific embodiment of the disclosure is described in detail below.It should be understood that described herein specific Embodiment is only used for describing and explaining the disclosure, is not limited to the disclosure.
Immunosupress can be released present disclose provides one kind and enhances the system of the mescenchymal stem cell of tumor-targeting killing Preparation Method, this method comprises the following steps: S1, by for PD-1 gene knock in site sgRNA and Cas9 albumen mix with Form RNP compound；S2, AAV virus to be transfected will be formed inserted with template DNA homologous recombination carrier package into AAV virus Particle；The template DNA includes the left homology arm sequence and right homology arm sequence for knocking in site for PD-1 gene, the left side Inserted with trail dna between homology arm sequence and the right homology arm sequence；And it can be knocked in by the orientation of trail dna So that the expression silencing of PD-1 gene；S3, the suspension of mescenchymal stem cell is mixed and is carried out with the suspension of the RNP compound Electricity turns, and obtains the culture after electricity turns；S4, electricity turn after 1-30 minute in, to it is described electricity turn after material in addition to Culture of the suspension of the AAV virion of transfection to carry out transfection in 4-30 hours, after being transfected；S5, by the transfection After culture Method of Limited Dilution afterwards carry out monoclonal culture, and by PCR and sequencing filter out carried out gene orientation knock in Monoclonal cell strain.
SgRNA and Cas9 albumen is transferred in cell in such a way that electricity turns by the present invention RNP compound, and after electricity turns The suitable time in selection AAV virus by the homologous recombination vector transfection inserted with fluorescent protein report gene such as cell In, come sgRNA, Cas9 albumen and the carrier inserted with template DNA commonly through CRISPR gene editing so that big The foreign gene of segment is able to orientation and knocks in target position.
Wherein, PD-1 gene is defined with Gene Symbol in ncbi database, and NCBIGene ID is 5133。
Wherein, optionally, the sgRNA has chemical modification group；The chemical modification group is preferably methyl chemistry Modification group or phosphorothioate chemical modification group；It rubs for the dosage of the sgRNA and Cas9 albumen for knocking in site of PD-1 gene You are than being 1:1 to 1:5.Wherein it is possible to using online sgRNA design tool (http://crispr.mit.edu/) according to PD-1 The sequence for knocking in site design sgRNA of gene is simultaneously synthesized.Wherein, 5 ' ends of sgRNA sequence and 3 ' end ends can be with It is added with methyl (- O-Me) chemical modification group or phosphorothioate (- phosphorothioate) chemical modification group respectively.
It wherein, optionally, is 5-20 by the time mixed for sgRNA the and Cas9 albumen for knocking in site of PD-1 gene Minute, temperature is 10-40 DEG C.
Wherein, optionally, in step S3, when the suspension of the mescenchymal stem cell is mixed with the RNP compound, relatively In every 106A mescenchymal stem cell, with the meter of sgRNA, the dosage of the RNP compound is 1-50 μm of ol；Described In the suspension of mesenchymal stem cells, cell concentration is (1-5) × 107A/mL；With the meter of sgRNA, the end of the RNP compound Concentration is 0.1-1.5 μm of ol/ μ L.
Wherein, optionally, in step S3, the condition that electricity turns includes: that electric field strength is 50-250V/cm, single pulse time For 2-15ms, the time interval between adjacent two subpulse is 10-60s, and total pulses are 2-10 times.
Wherein, optionally, it in step S4, after electricity turns in 5-20 minutes, is added in the material after turning to the electricity Culture of the suspension of AAV virion to be transfected to carry out transfection in 8-24 hours, after being transfected.
Wherein, optionally, in step S4, the additional amount of the suspension of AAV virion to be transfected makes AAV to be transfected The MOI value of virion is 104-106.The ratio of virus and cell quantity when MOI value is infection.
Wherein it is preferred to which the mescenchymal stem cell is mesenchymal stem cell, fat mesenchymal stem cell, umbilical cord Mescenchymal stem cell, palace blood mescenchymal stem cell and dental pulp mescenchymal stem cell.The serotype of the AAV virus can be AAV- 1 virus, AAV-2 are viral, AAV-3 is viral, AAV-4 virus, AAV-5 virus, AAV-6 virus, AAV-7 is viral, AAV-8 is viral, AAV-9 virus, AAV-DJ virus and AAV-DJ/8 virus, preferably AAV-DJ virus, AAV-6 virus, AAV-1 virus or AAV9 Virus, the serotype of the more preferable AAV virus are AAV9 virus, under the preferable case, can further increase large fragment The efficiency of gene knock-in stem cell.
Wherein, the site of knocking in of the PD-1 gene enables to knock in by the orientation of trail dna so that PD-1 base The site of knocking in of the expression silencing of cause, the preferably described PD-1 gene is located on the First Exon of PD-1 gene.
Wherein, the trail dna refers to tumor necrosin relative death inducing ligand (TRAIL, TNF-related Apoptosis-inducing ligand) gene can be film mating type trail dna or secretion-type T RAIL gene.
Wherein, the template DNA may include left homology arm sequence, knock in segment and right homology arm sequence；Preferably, institute It states and is inserted with cmv enhancer, CMV promoter, trail dna between left homology arm sequence and the right homology arm sequence Expression cassette and SV40poly A；Preferably, the sequence being inserted between the left homology arm sequence and the right homology arm sequence is such as Shown in SEQ ID NO.4 or SEQ ID NO.10.
Wherein it is preferred to which the sgRNA is as shown in SEQ ID NO.1；Correspondingly, the left homology arm sequence such as SEQ Shown in ID NO.2；Correspondingly, the right homology arm sequence is as shown in SEQ ID NO.3.
Wherein, optionally, the frame sequence of the carrier is as shown in SEQ ID NO.7.The frame sequence of the carrier is Refer to the sequence for being not inserted into the carrier of template DNA.
Present invention be described in more detail by the following examples:
Embodiment 1
Film mating type is inserted into building in the Exon1 of umbilical cord mesenchymal stem cells programmed death receptor 1 gene (PD-1) The cell model of trail dna expression Cassette.
1, sgRNA design and synthesis
(1) through online sgRNA design tool (http://crispr.mit.edu/) on 1 exon of PD-1 gene The PD-1sgRNA of targets identification is designed, preferred result is as follows: 5 '-cgacuggccagggcgccuguguuuuagagcuagaaa uagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu-3’(SEQ ID NO.1)。
Wherein 1-20 sequences are identification motif, remaining sequence is tracrRNA.
(2) sgRNA is synthesized by Integrated DNA Technologies, Inc. (IDT) and in the sgRNA sequence 5 ' end and 3 ' end ends three bases No. two positions and third place on do not add repairing for O-Me, phosphorothioate Decorations.
2, the activity of in vitro method detection sgRNA
(1) target sequence segment (1456bp) is identified from genome amplification, primer is had by giving birth to work bioengineering (Shanghai) share The synthesis of limit company.
PD-1-FW:5 '-ggaaagaggccacagcagtg-3 ' (SEQ ID NO.5),
PD-1-REV:5’-agtcgcctgccacagtgaag-3’(SEQ ID NO.6)。
(2) pcr amplification product 200ng, sgRNA 100ng, SpCas9 200ng (are purchased from Sigma-Aldrich, goods Number: TGEN-CP-500UG), 10 × buffer, 2 μ L is configured to 20 μ L reaction systems.Reaction system keeps the temperature one hour at 37 degree, 70 degree keep the temperature one hour.
(3) using TAE configuration 1% BioWest agarose gel, the electrophoresis 30min under the voltage of 90V, using gel at As instrument observes result.
3, the selection of AAV packaging system and plasmid construction
(1) cell to be edited is umbilical cord mesenchymal stem cells, and according to the AAV tissue affinity table of comparisons, preferably serotype is The packaging system of AAV-9.
(2) the overall package capacity of AAV-9 is 4.7Kb.The segment being inserted into the carrier loaded of AAV packaging system should wrap Containing left homology arm (500bp or so), Insert Fragment and right homology arm (500bp or so).
Left homology arm sequence is SEQ ID NO.2.
Right homology arm sequence is SEQ ID NO.3.
Insert Fragment one complete Cassette include CMV increase son, CMV promoter, film mating type TRAIL CDS and SV40poly A, total 1487bp, sequence is as shown in SEQ ID NO.4.Using seamless clone, (NEBuilder high-fidelity DNA is assembled Kit is purchased from NEB (Beijing) Co., Ltd, article No.: E2621S) method Cassette is inserted on pAAV carrier, carry Body sequence is SEQ ID NO.7.
4, AAV virus packaging and purifying
(1) virus packaging on the day before by HEK293T cell according to every ware 5 × 106Quantity plant to diameter 10cm's Contain 10mL complete medium: DMEM (being purchased from ThermoFisherScientific, Inc., article No.: C11995500BT)+ + 1%P/S is dual anti-(is purchased from by 10%FBS (being purchased from ThermoFisherScientific, Inc., article No.: sv30087.02) ThermoFisher Scientific, Inc., article No.: SV30010) CORNING culture dish in, plant 30 wares altogether.37 Degree, 5%CO2Cell incubator in cultivate 24 hours.
(2) the virus packaging same day checks whether HEK293T cell confluency degree reaches 80%.Every ware is independent according to the following steps Configure rotaring redyeing system: by the pAAV-Cassette of 10 μ g, use is without blood after the pAAV9-RC mixing of the pHelper of 10 μ g, 10 μ g It is mixed after clear DMEM adjustment volume to 910 μ L through vortex oscillator, the PEI that 90 μ L are added (is purchased from Polysciences Asia Pacific, Inc. article No.: 23966-2) after reuse vortex oscillator mixing, stand 15 minutes.By CORNING culture dish In complete medium be substituted for 9mL serum free medium, then will be dropped evenly before by the DNA-PEI compound stood In culture dish, softly shakes and even be placed on 37 degree, 5%CO2Cell incubator in cultivate 6 hours.CORNING is trained after transfection 6h The serum free medium supported in ware is substituted for complete medium, in 37 degree, 5%CO2Cell incubator in continue to cultivate.
(3) after transfection 60 hours, supernatant cell is harvested respectively.
Obtained supernatant will be collected and discard impurity after ten minutes through 4 degree of centrifugations of 4000rpm.It will go on deimpurity to reset and add Enter Amicon Ultra-15 and surpass and (be purchased from Merck Chemical Engineering Technology (Shanghai) Co., Ltd., article No.: UFC 905096) from column, passes through Volume concentration to 10 was arrived into 15mL in centrifugation 30 minutes after 4000rpm several times, 4 degree.The HEK293T scraped with cell scraper is thin Born of the same parents blow even and are transferred in 50mL centrifuge tube with appropriate culture medium, abandon supernatant, Suo Youchen after 1500rpm, 4 degree of centrifugation 10min It forms sediment in total plus 3mL cell lysis buffer solution (150mM NaCl, 20mM tris pH8.0) makes its resuspension.Cell will be resuspended -80 Multigelation is three times in DEG C alcohol bath and 37 DEG C of water-baths.The cell suspension of the supernatant freeze thawing of concentration is mixed, 1M is added MgCl2To final concentration of 1mM.Addition Benzonase (is purchased from Merck Chemical Engineering Technology (Shanghai) Co., Ltd., article No.: 70746- 1kU) to final concentration of 25U/mL, 37 DEG C of reaction 40min after mixing.50mL centrifuge tube is taken out, 4 DEG C, 4000rpm is centrifuged 20min, Take supernatant.
(4) Sigma-Aldrich (is purchased from, article No.: D1556- using Iodixanol density-gradient centrifugation method purified virus 250mL).Configure Iodixanol gradient 17%:5mL 10 × PBS, 0.05mL 1M MgCl2,0.125mL 1M KCl,10mL 5M NaCl, 12.5mL Optiprep, adds water to supply 50mL.25%:5mL 10 × PBS, 0.05mL 1M MgCl2, 0.125mL 1M KCl, 20mL Optiprep, 0.1mL 0.5%phenol red, adds water to supply 50mL.40%:5mL 10 ×PBS,0.05mL 1M MgCl2, 0.125mL 1M KCl, 33.3mL Optiprep adds water to supply 50mL.60%: 0.05mL 1M MgCl2, 0.125mL 1M KCl, 50mL Optiprep, 0.025mL 0.5%phenol red.To hypervelocity from The Iodixanol of 3.5mL 60%, 3.5mL 40%, 4mL 25%, 4mL 17% are successively slowly added in heart pipe from the bottom to top. The supernatant cell pyrolysis liquid of concentration is slowly added in centrifuge tube top layer, fills centrifuge tube with cell lysis buffer solution.It uses Beckman L-80XP landing ultracentrifuge, 70Ti determine angle rotor, accelerate 6, slow down 4 degree of 9,60000rpm and are centrifuged 2 hours.With Tack syringe draws 40% concentration layer Iodixanol, is transferred to Amicon Ultra-15 and surpasses from column, 10mL PBS is added 4 DEG C of 4000rpm are centrifuged 20 minutes, are repeated 3 times.By viral centrifugal concentrating to 1mL.
(5) titre detection is carried out to AAV9 using qPCR.According to EGFP primers, make the length of qPCR product about 200bp.QPCR primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd..
AAV-TRAIL-F:5’-gatcttcacagtgctcctgc-3’(SEQ ID NO.8)。
AAV-TRAIL-R:5’-tgacggagttgccacttgac-3’(SEQ ID NO.9)。
7 AAV9 recombinant plasmid standard items are prepared, gradient dilution is carried out with the ratio of 1:10.It is below dense from 10ng/ μ L Degree start to dilute, respectively 10ng/ μ L, 1ng/ μ L, 0.1ng/ μ L, 0.01ng/ μ L, 0.001ng/ μ L, 0.0001ng/ μ L and 0.00001ng/μL。
Diluted DNA copy number is calculated according to the following formula:
Virus Sample is pre-processed using DNase (it is purchased from precious bioengineering (Dalian) Co., Ltd, article No.: 2270A).(Japan is purchased from and spins (Shanghai) Biotechnology Co., Ltd, article No.: QPS-201) configuration using 2 × SYBR PCR mix QPCR reaction system.Use Roche480II real-time fluorescence quantitative PCR system carries out quantitative PCR.According to Ct Value draws standard curve, and calculates the titre of AAV9.
5, the assembling of RNP compound and the pretreatment of cell to be edited
(1) by SpCas9 (final concentration 300ug/ml) and PD1sgRNA (175 μ g/ml of final concentration) according to the molar ratio of 1:3 It carries out being blended in incubation at room temperature 10min, to form SpCas9/sgRNA RNP compound.
(2) observation umbilical cord mesenchymal stem cells, which converge rate and reach 80%, moves back except the DMEM/F12 culture medium containing 10%FBS (it is purchased from ThermoFisher Scientific, article No.: 11320082) Inc., is rinsed primary with PBS.0.05% pancreatin is added (being purchased from ThermoFisher Scientific, Inc., article No.: 25200-072) is allowed to that ware bottom is completely covered.37 DEG C of incubation 3-5 Stop digestion after minute, sucks pancreatin.At once fresh DMEM/F12 complete medium is added, is blown and beaten and is cultivated with 1mL rifle sector Ware bottom, the stem cell colonies for attaching ware/bottom of bottle fall off, and soft slowly pressure-vaccum mixes, and stem cell suspension is made.Use hemocytometer Number plate counts cell density.Using Opti-MEM, (magnesium chloride of ATP, 23.6mM of 14.5mM, are purchased from Article No.: 11058021) ThermoFisher Scientific, Inc. adjust cell density to 5 × 107/mL。
(3) (with the meter of sgRNA, the RNP is multiple for the SpCas9/sgRNA SNP compound by 10 μ L by incubation at room temperature It closes the content of object and passes through umbilical cord mesenchymal stem cells suspension (its for counting and being resuspended using Opti-MEM for 7.5 μm of ol) and 10 μ L Middle cell quantity is 5 × 105It is a) it mixes, 20 μ L mixed liquors are transferred in 16 hole electricity rotating plate items.Use Lonza 4D consideration convey Contaminate Systematic selection CB150 mode (electric field strength 150V/cm, single pulse time are 10ms, between adjacent two subpulse when Between between be divided into 20s, total pulses are 5 times) carry out electricity and turn.Cell is transferred to contain by electricity at once after the completion of turning is added to 10% tire In 37 degree, 5%CO in 24 orifice plates of the DMEM/F12 complete medium of cow's serum2Cell incubator in continue to cultivate.
(4) electricity has turned to start in the 5 to 20th minute according to 1 × 105MOI value be gently added dropwise AAV9, and turned in electricity It is added dropwise in 20 minutes.
(5) electricity removes old culture medium after having turned 24 hours, is changed to DMEM/F12 complete medium.
6, the culture of monoclonal cell strain:
(1) electricity has turned to rinse a culture dish using PBS on the 48th hour.Pancreatin is added to be allowed to that ware bottom is completely covered.37℃ Stop digestion after being incubated for 3-5 minutes, sucks pancreatin.At once fresh DMEM/F12 complete medium is added, is blown with 1mL rifle sector Culture dish/bottom of bottle is beaten, the stem cell colonies for attaching ware bottom fall off, and soft slowly pressure-vaccum mixes, guarantee that iuntercellular does not have adhesion, Stem cell suspension is made.Cell density is counted using blood counting chamber.By 15000 cells of each 10cm culture dish Ratio in the 10cm CORNING culture dish of cell seeding to the complete medium containing DMEM/F12 in 37 degree, 5%CO2Cell Continue to cultivate in incubator.
(2) it is observed and is removed old culture medium within every 24 hours, be changed to new DMEM/F12 complete medium.72 is small When after can microscopic observation to clone formation.
(3) 12 to 14 days sizes that can see clone under ten times of object lens have been equivalent to a coin after electricity turns. Clone cannot be allowed to continue to become larger or intersect.120 μ L DMEM/F12 complete mediums are added in each hole on 96 orifice plates, Marking plate O.It is observed in super-clean bench by microscope, P200 pipettor is adjusted to 45 μ L and uses the pipette tips with filter core Broken clone is scraped, collect cell with pipettor and is transferred in the aperture of 96 orifice plates.
(4) old culture medium is removed after every 24 hours after clone's picking, is changed to new DMEM/F12 and cultivates completely Base, cell confluency rate reaches 80% after four days.
(5) DMEM/F12 of the 133 μ L containing 10% fetal calf serum is added in each hole on two piece of 96 orifice plate to cultivate completely Base is respectively labeled as plate A, plate B.Every hole of plate O is rinsed using the PBS of 150 μ L.The pancreatin of 35 μ L, digestion 5 are added in every hole The DMEM/F12 complete medium of 165 μ L is added into every hole after ten minutes.The cell suspension for pipetting 66 μ L respectively from hole turns It moves on in the respective apertures of plate A and plate B.Plate A is extracted for genome, and plate B is spare.165 are directly added in each hole of plate O It is stored after the cells frozen storing liquid of μ L as profound hypothermia refrigerator.
Embodiment 2
Building is inserted into secreting type in the Exon1 of umbilical cord mesenchymal stem cells programmed death receptor 1 gene (PD-1) The cell model of trail dna expression Cassette.
Carried out using the method for embodiment 1, difference is: Insert Fragment is that a complete Cassette includes that CMV increases Add son, CMV promoter, recombinant secretor type trail dna CDS and SV40polyA, total 1349bp, sequence such as SEQ ID NO.10 It is shown.
Comparative example 1
It carries out according to the method for embodiment 1, the difference is that electricity has turned 35min and started according to 1 × 105MOI it is soft AAV9 is added dropwise, and has turned to be added dropwise in 50 minutes in electricity.
Comparative example 2
It is carried out according to the method for embodiment 2, the difference is that electricity has turned 35min and started according to 1 × 105MOI it is soft AAV9 is added dropwise, and has turned to be added dropwise in 50 minutes in electricity.
Testing example 1
1, gene editing Efficiency testing (allele insertion detection)
(1) design primer (nonconformity site PCR product about 1341bp or so, for embodiment 1 and comparison outside homology arm 1 film mating type TRAIL integration site PCR product 2828bp of example, for 2 secretion-type T RAIL integration site of embodiment 2 and comparative example PCR product 2690bp).Primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd..
PD1-HR-FW:5 '-ggagccgattagccatggac-3 ' (SEQ ID NO.11),
PD1-HR-REV:5’-agaagaactgtcctcactcg-3’(SEQ ID NO.12)。
(2) 96 clones are chosen and do not edit umbilical cord mesenchymal stem cells cell strain and are used as control, it will be in 96 orifice plates It clones genome obtained and carries out PCR amplification.
(3) PCR product is subjected to electrophoresis and analyzed.Only 1341bp or so band is non-editor's cell, only 2828bp's or 2690bp be diallele editor's cell, existing 1341bp or so band also has 2828bp's or 2690bp It is monoallelic editor's cell.The ratio of these three types of editing types is marked and counted respectively.The results are shown in Table 1.
Table 1
Group Non- editor's cell proportion Diallele editor's cell Monoallelic editor's cell
Embodiment 1 31.2% 23.6% 45.2%
Comparative example 1 95.9% 1.0% 3.1%
Embodiment 2 40.3% 24.6% 35.1%
Comparative example 2 93.7% 2.1% 4.2%
2, Examples 1 and 2 obtain umbilical cord mesenchymal stem cells and act on to immunosuppressive releasing (relative to not knocking in Umbilical cord mesenchymal stem cells):
Cell cycle checkpoint (checkpoint) be a set of guarantee DNA replication dna in cell cycle (cell cycle) and Chromosome (chromosome) distributes the checking mechanism of quality, is a kind of negative-feedback regu- lation mechanism.When in cell cycle progression go out Existing anomalous event, when being obstructed such as DNA damage or DNA replication dna, this kind of adjustment mechanism is just activated, and interrupts the cell cycle in time Operation.After cell repair or debugging, the cell cycle could restore to operate.Examples 1 and 2 are obtained umbilical cord mesenchyma to do Cell and the umbilical cord mesenchymal stem cells that do not knocked in are implanted into BALB/c mouse respectively, observe that Examples 1 and 2 obtain Umbilical cord mesenchymal stem cells are to CD8+The releasing (G0/G1 phase cell quantity is reduced, and S phase cell quantity increases) that T cell inhibits, knot Fruit is as shown in table 2.
Table 2
Group G0/G1 phase cell proportion S phase cell proportion
Embodiment 1 21.6% 67.8%
Embodiment 2 23.1% 65.9%
It does not knock in 68.4% 21.2%
3, the tumor suppression of tumor-bearing mice is tested:
Method in reference literature " Tea Saponin studies tumor-bearing mice tumor inhibition effect ", prepares human breast carcinoma (EAC) Lotus knurl kunming mice model (18~22g of weight), and the umbilical cord mesenchymal stem cells that are obtained with Examples 1 and 2 and do not struck The umbilical cord mesenchymal stem cells entered carry out tail vein injection to tumor-bearing mice respectively, and (injection dosage is 1 × 106Cell/0.1ml), Check tumor inhibitory effect, the results are shown in Table 3, show Examples 1 and 2 obtain umbilical cord mesenchymal stem cells relative to not into The umbilical cord mesenchymal stem cells that row is knocked in can significantly improve tumor suppression efficiency:
(tumour control group average knurl weight-experimental group average knurl weight)/tumour control group average knurl weight × 100%.
Table 3
Group Average knurl weight (g) Tumor suppression efficiency
Embodiment 1 0.94±0.13 58.4%
Embodiment 2 1.01±0.21 55.3%
Umbilical cord mesenchymal stem cells are not knocked in 1.92±0.46 15.0%
Control group 2.26±0.52 /
The preferred embodiment of the disclosure is described in detail above, still, during the disclosure is not limited to the above embodiment Detail a variety of simple variants can be carried out to the technical solution of the disclosure in the range of the technology design of the disclosure, this A little simple variants belong to the protection scope of the disclosure.
It is further to note that specific technical features described in the above specific embodiments, in not lance In the case where shield, can be combined in any appropriate way, in order to avoid unnecessary repetition, the disclosure to it is various can No further explanation will be given for the combination of energy.
In addition, any combination can also be carried out between a variety of different embodiments of the disclosure, as long as it is without prejudice to originally Disclosed thought equally should be considered as disclosure disclosure of that.
Sequence table
<110>Hangzhou Guan Zi health Science and Technology Ltd.
<120>a kind of preparation method for the mescenchymal stem cell that can be released immunosupress and enhance tumor-targeting killing
<130> 10969-K-HZGZ
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 103
<212> RNA
<213>artificial sequence (Artificial Sequence)
<400> 1
cgacuggcca gggcgccugu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu uuu 103
<210> 2
<211> 500
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
caggaacctg agcccagagg gggccaccca ccttccccag gcagggaggc ccggccccca 60
gggagatggg ggggatgggg gaggagaagg gcctgccccc acccggcagc ctcaggaggg 120
gcagctcggg cgggatatgg aaagaggcca cagcagtgag cagagacaca gaggaggaag 180
gggccctgag ctggggagac ccccacgggg tagggcgtgg gggccacggg cccacctcct 240
ccccatctcc tctgtctccc tgtctctgtc tctctctccc tcccccaccc tctccccagt 300
cctaccccct cctcacccct cctcccccag cactgcctct gtcactctcg cccacgtgga 360
tgtggaggaa gagggggcgg gagcaagggg cgggcaccct cccttcaacc tgacctggga 420
cagtttccct tccgctcacc tccgcctgag cagtggagaa ggcggcactc tggtggggct 480
gctccaggca tgcagatccc 500
<210> 3
<211> 500
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
acaggcgccc tggccagtcg tctgggcggt gctacaactg ggctggcggc caggatggtt 60
cttaggtagg tggggtcggc ggtcaggtgt cccagagcca ggggtctgga gggaccttcc 120
accctcagtc cctggcaggt cggggggtgc tgaggcgggc ctggccctgg cagcccaggg 180
gtcccggagc gaggggtctg gagggacctt tcactctcag tccctggcag gtcggggggt 240
gctgtggcag gcccagcctt ggcccccagc tctgcccctt accctgagct gtgtggcttt 300
gggcagctcg aactcctggg ttcctctctg ggccccaact cctcccctgg cccaagtccc 360
ctctttgctc ctgggcaggc aggacctctg tcccctctca gccggtcctt ggggctgcgt 420
gtttctgtag aatgacgggt caggctggcc agaaccccaa accttggccg tggggagtct 480
gcgtggcggc tctgccttgc 500
<210> 4
<211> 1487
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 60
gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca 120
atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc 180
aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta 240
catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac 300
catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg 360
atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg 420
ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt 480
acggtgggag gtctatataa gcagagctat ggctatgatg gaggtccagg ggggacccag 540
cctgggacag acctgcgtgc tgatcgtgat cttcacagtg ctcctgcagt ctctctgtgt 600
ggctgtaact tacgtgtact ttaccaacga gctgaagcag atgcaggaca agtactccaa 660
aagtggcatt gcttgtttct taaaagaaga tgacagttat tgggacccca atgacgaaga 720
gagtatgaac agcccctgct ggcaagtcaa gtggcaactc cgtcagctcg ttagaaagat 780
gattttgaga acctctgagg aaaccatttc tacagttcaa gaaaagcaac aaaatatttc 840
tcccctagtg agagaaagag gtcctcagag agtagcagct cacataactg ggaccagagg 900
aagaagcaac acattgtctt ctccaaactc caagaatgaa aaggctctgg gccgcaaaat 960
aaactcctgg gaatcatcaa ggagtgggca ttcattcctg agcaacttgc acttgaggaa 1020
tggtgaactg gtcatccatg aaaaagggtt ttactacatc tattcccaaa catactttcg 1080
atttcaggag gaaataaaag aaaacacaaa gaacgacaaa caaatggtcc aatatattta 1140
caaatacaca agttatcctg accctatatt gttgatgaaa agtgctagaa atagttgttg 1200
gtctaaagat gcagaatatg gactctattc catctatcaa gggggaatat ttgagcttaa 1260
ggaaaatgac agaatttttg tttctgtaac aaatgagcac ttgatagaca tggaccatga 1320
agccagtttt tttggggcct ttttagttgg ctaaatgctt tatttgtgaa atttgtgatg 1380
ctattgcttt atttgtaacc attataagct gcaataaaca agttaacaac aacaattgca 1440
ttcattttat gtttcaggtt cagggggagg tgtgggaggt tttttaa 1487
<210> 5
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
ggaaagaggc cacagcagtg 20
<210> 6
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
agtcgcctgc cacagtgaag 20
<210> 7
<211> 2949
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60
gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120
actccatcac taggggttcc tgcggccgcg aatgctgcgg cgcgcggcta gcctgatttt 180
gtaggtaacc acgtgcggac cgagcggccg caggaacccc tagtgatgga gttggccact 240
ccctctctgc gcgctcgctc gctcactgag gccgggcgac caaaggtcgc ccgacgcccg 300
ggctttgccc gggcggcctc agtgagcgag cgagcgcgca gctgcctgca ggggcgcctg 360
atgcggtatt ttctccttac gcatctgtgc ggtatttcac accgcatacg tcaaagcaac 420
catagtacgc gccctgtagc ggcgcattaa gcgcggcggg tgtggtggtt acgcgcagcg 480
tgaccgctac acttgccagc gccctagcgc ccgctccttt cgctttcttc ccttcctttc 540
tcgccacgtt cgccggcttt ccccgtcaag ctctaaatcg ggggctccct ttagggttcc 600
gatttagtgc tttacggcac ctcgacccca aaaaacttga tttgggtgat ggttcacgta 660
gtgggccatc gccctgatag acggtttttc gccctttgac gttggagtcc acgttcttta 720
atagtggact cttgttccaa actggaacaa cactcaaccc tatctcgggc tattcttttg 780
atttataagg gattttgccg atttcggcct attggttaaa aaatgagctg atttaacaaa 840
aatttaacgc gaattttaac aaaatattaa cgtttacaat tttatggtgc actctcagta 900
caatctgctc tgatgccgca tagttaagcc agccccgaca cccgccaaca cccgctgacg 960
cgccctgacg ggcttgtctg ctcccggcat ccgcttacag acaagctgtg accgtctccg 1020
ggagctgcat gtgtcagagg ttttcaccgt catcaccgaa acgcgcgaga cgaaagggcc 1080
tcgtgatacg cctattttta taggttaatg tcatgataat aatggtttct tagacgtcag 1140
gtggcacttt tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt 1200
caaatatgta tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa 1260
ggaagagtat gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt 1320
gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt 1380
tgggtgcacg agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt 1440
ttcgccccga agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg 1500
tattatcccg tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga 1560
atgacttggt tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa 1620
gagaattatg cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga 1680
caacgatcgg aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa 1740
ctcgccttga tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca 1800
ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta 1860
ctctagcttc ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac 1920
ttctgcgctc ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc 1980
gtgggtctcg cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag 2040
ttatctacac gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga 2100
taggtgcctc actgattaag cattggtaac tgtcagacca agtttactca tatatacttt 2160
agattgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata 2220
atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag 2280
aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa 2340
caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt 2400
ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc 2460
cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa 2520
tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa 2580
gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc 2640
ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa 2700
gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa 2760
caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg 2820
ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc 2880
tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg 2940
ctcacatgt 2949
<210> 8
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
gatcttcaca gtgctcctgc 20
<210> 9
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
tgacggagtt gccacttgac 20
<210> 10
<211> 1349
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 60
gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca 120
atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc 180
aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta 240
catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac 300
catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg 360
atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg 420
ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt 480
acggtgggag gtctatataa gcagagctat ggctacaggc tcccggacgt ccctgctcct 540
ggcttttggc ctgctctgcc tgccctggct tcaagagggc agtgccagtg ctagaaaccg 600
tcagaagaga agaatgaagc agatcgagga caagatcgag gagatcctga gcaagatcta 660
ccacatcgag aacgagatcg ccagaatcaa gaagctgatc ggcgagagag tgagagaaag 720
aggtcctcag agagtagcag ctcacataac tgggaccaga ggaagaagca acacattgtc 780
ttctccaaac tccaagaatg aaaaggctct gggccgcaaa ataaactcct gggaatcatc 840
aaggagtggg cattcattcc tgagcaactt gcacttgagg aatggtgaac tggtcatcca 900
tgaaaaaggg ttttactaca tctattccca aacatacttt cgatttcagg aggaaataaa 960
agaaaacaca aagaacgaca aacaaatggt ccaatatatt tacaaataca caagttatcc 1020
tgaccctata ttgttgatga aaagtgctag aaatagttgt tggtctaaag atgcagaata 1080
tggactctat tccatctatc aagggggaat atttgagctt aaggaaaatg acagaatttt 1140
tgtttctgta acaaatgagc acttgataga catggaccat gaagccagtt tttttggggc 1200
ctttttagtt ggctaaatgc tttatttgtg aaatttgtga tgctattgct ttatttgtaa 1260
ccattataag ctgcaataaa caagttaaca acaacaattg cattcatttt atgtttcagg 1320
ttcaggggga ggtgtgggag gttttttaa 1349
<210> 11
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
ggagccgatt agccatggac 20
<210> 12
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
agaagaactg tcctcactcg 20

Claims (7)

1. one kind can release immunosupress and enhance the preparation method of the mescenchymal stem cell of tumor-targeting killing, feature exists In this method comprises the following steps:
S1, RNP compound will be mixed to form for sgRNA the and Cas9 albumen for knocking in site of PD-1 gene；
S2, AAV virion to be transfected will be formed inserted with template DNA homologous recombination carrier package into AAV virus；It is described Template DNA includes the left homology arm sequence and right homology arm sequence for knocking in site for PD-1 gene, the left homology arm sequence Inserted with trail dna between column and the right homology arm sequence；And it can be knocked in by the orientation of trail dna so that PD-1 The expression silencing of gene；
The sgRNA is as shown in SEQ ID NO.1, and the left homology arm sequence is as shown in SEQ ID NO.2, the right homology arm Sequence is as shown in SEQ ID NO.3；The sequence such as SEQ being inserted between the left homology arm sequence and the right homology arm sequence Shown in ID NO.4 or SEQ ID NO.10；
S3, the suspension of mescenchymal stem cell is mixed to the suspension of the RNP compound and is carried out electricity turn, obtain the training after electricity turns Support object；The mescenchymal stem cell is umbilical cord mesenchymal stem cells, and the serotype of the AAV virus is AAV9 virus；
S4, in 1-30 minutes, the outstanding of AAV virion to be transfected is added in the material after turning to the electricity after electricity turns Culture of the liquid to carry out transfection in 4-30 hours, after being transfected；
S5, will after the culture Method of Limited Dilution after the transfection carry out monoclonal culture, and by PCR and sequencing filter out into Gene of having gone orients the monoclonal cell strain knocked in.
2. according to the method described in claim 1, wherein, the sgRNA has chemical modification group；The chemical modification group For methyl chemistry modification group or phosphorothioate chemical modification group；For sgRNA the and Cas9 egg for knocking in site of PD-1 gene White dosage molar ratio is 1:1 to 1:5.
3. method according to claim 1 or 2, wherein sgRNA the and Cas9 egg for knocking in site of PD-1 gene will be directed to The white mixed time is 5-20 minutes, and temperature is 10-40 DEG C.
4. according to the method described in claim 1, wherein, in step S3, the suspension of the mescenchymal stem cell and the RNP are multiple When closing object mixing, relative to every 106A mescenchymal stem cell, with the meter of sgRNA, the dosage of the RNP compound is 10-50 μm of ol, in the suspension of the mescenchymal stem cell, cell concentration is (1-5) × 107A/mL；With the meter of sgRNA, institute State the final concentration of 0.1-1.5 μm of ol/ μ L of RNP compound.
5. method according to claim 1 or 4, wherein in step S3, the condition that electricity turns includes: that electric field strength is 50- 250V/cm, single pulse time are 2-15ms, and the time interval between adjacent two subpulse is 10-60s, and total pulses are 2-10 times.
6. according to the method described in claim 1, wherein, in step S4, after electricity turns in 5-20 minutes, turning to the electricity Culture of the suspension of AAV virion to be transfected to carry out transfection in 8-24 hours, after being transfected is added in material afterwards Object.
7. method according to claim 1 or 6, wherein in step S4, the suspension of AAV virion to be transfected adds Entering amount makes the MOI value of AAV virion to be transfected be 104-106。
CN201810784680.9A 2018-07-17 2018-07-17 A kind of preparation method for the mescenchymal stem cell for releasing immunosupress and enhancing tumor-targeting killing Expired - Fee Related CN109082442B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201810784680.9A CN109082442B (en) 2018-07-17 2018-07-17 A kind of preparation method for the mescenchymal stem cell for releasing immunosupress and enhancing tumor-targeting killing
PCT/CN2018/119852 WO2020015279A1 (en) 2018-07-17 2018-12-07 Method for gene-directed-knock-in in stem cells

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810784680.9A CN109082442B (en) 2018-07-17 2018-07-17 A kind of preparation method for the mescenchymal stem cell for releasing immunosupress and enhancing tumor-targeting killing

Publications (2)

Publication Number Publication Date
CN109082442A CN109082442A (en) 2018-12-25
CN109082442B true CN109082442B (en) 2019-09-20

Family

ID=64837634

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810784680.9A Expired - Fee Related CN109082442B (en) 2018-07-17 2018-07-17 A kind of preparation method for the mescenchymal stem cell for releasing immunosupress and enhancing tumor-targeting killing

Country Status (1)

Country Link
CN (1) CN109082442B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20230045174A1 (en) * 2019-11-27 2023-02-09 Board Of Regents, The University Of Texas System Large-scale combined car transduction and crispr gene editing of msc cells
CN114107291B (en) * 2020-08-27 2024-05-03 苏州因特药物研发有限公司 Gene editing system and method for exogenous gene fixed-point insertion

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014121085A1 (en) * 2013-01-31 2014-08-07 Thomas Jefferson University Pd-l1 and pd-l2-based fusion proteins and uses thereof
CN105647872A (en) * 2016-03-04 2016-06-08 苏州大学 Liver injury targeted mesenchymal stem cell and preparation method and application thereof
CN105985985A (en) * 2016-05-06 2016-10-05 苏州大学 Preparation method of allogeneic mesenchymal stem cells edited by CRISPR technology and optimized by IGF (insulin-like growth factor) and application of allogeneic mesenchymal stem cells in treatment of myocardial infarction
CN106350540A (en) * 2016-08-26 2017-01-25 苏州系统医学研究所 High-efficient inducible type CRISPR/Cas9 gene knockout carrier mediated by lentivirus and application thereof
CN106636000A (en) * 2016-12-23 2017-05-10 广东圣赛生物科技有限公司 hESCs-TK cell line and building method and application thereof
CN107699547A (en) * 2017-09-05 2018-02-16 上海科技大学 The targeting CD133 of the gene silencings of PD 1 CAR T cells and its application
CN107955817A (en) * 2016-10-14 2018-04-24 北京百奥赛图基因生物技术有限公司 The preparation method and application of humanization genetic modification animal model

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014121085A1 (en) * 2013-01-31 2014-08-07 Thomas Jefferson University Pd-l1 and pd-l2-based fusion proteins and uses thereof
CN105647872A (en) * 2016-03-04 2016-06-08 苏州大学 Liver injury targeted mesenchymal stem cell and preparation method and application thereof
CN105985985A (en) * 2016-05-06 2016-10-05 苏州大学 Preparation method of allogeneic mesenchymal stem cells edited by CRISPR technology and optimized by IGF (insulin-like growth factor) and application of allogeneic mesenchymal stem cells in treatment of myocardial infarction
CN106350540A (en) * 2016-08-26 2017-01-25 苏州系统医学研究所 High-efficient inducible type CRISPR/Cas9 gene knockout carrier mediated by lentivirus and application thereof
CN107955817A (en) * 2016-10-14 2018-04-24 北京百奥赛图基因生物技术有限公司 The preparation method and application of humanization genetic modification animal model
CN106636000A (en) * 2016-12-23 2017-05-10 广东圣赛生物科技有限公司 hESCs-TK cell line and building method and application thereof
CN107699547A (en) * 2017-09-05 2018-02-16 上海科技大学 The targeting CD133 of the gene silencings of PD 1 CAR T cells and its application

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
"Enhanced CRISPR/Cas9-mediated precise genome editing by improved design and delivery of gRNA, Cas9 nuclease, and donor DNA";Xiquan Liang等;《Journal of Biotechnology》;20161111;第241卷;摘要，第137页左栏第2段至138页左栏第2段 *
"Programmed Death Ligand 1 (PD-L1)-targeted TRAIL combines PD-L1-mediated checkpoint inhibition with TRAIL-mediated apoptosis";Djoke Hendriks等;《ONCOIMMUNOLOGY》;20160706;第5卷(第8期);摘要 *

Also Published As

Publication number Publication date
CN109082442A (en) 2018-12-25

Similar Documents

Publication Publication Date Title
CN110856724B (en) Therapeutic agents comprising nucleic acids and CAR-modified immune cells and uses thereof
AU2021202866B2 (en) Muscle-specific nucleic acid regulatory elements and methods and use thereof
AU2017248259A1 (en) Chimeric antigen receptor T cell compositions
CN107574179A (en) A kind of CRISPR/Cas9 high efficiency gene editing systems for kluyveromyces optimization
KR101961667B1 (en) Transgenic cloned pig resistant to the Porcine epidemic diarrhea virus and producing method thereof
KR20210154176A (en) Long-lasting analgesia by targeted in vivo epigenetic inhibition
CN106687592B (en) Recombinant plasmid, recombinant plasmodium constructed by recombinant plasmid and application of recombinant plasmid
KR20180113990A (en) Gene therapy for the treatment of familial hypercholesterolemia
CN106755036A (en) A kind of bacterium and antibody combine the preparation method that solid tumor drugs are killed in double targeting suppressions
CN111448321A (en) SOD1 double expression vector and its use
CN109082442B (en) A kind of preparation method for the mescenchymal stem cell for releasing immunosupress and enhancing tumor-targeting killing
CN106591208A (en) Vector strain of recombinant single-chain antibody expressing DNase I, AIF or integrating toxins, and application of strain
CN114846141B (en) Isolated nucleic acid molecule and application thereof
CN112501139B (en) Recombinant Newcastle disease virus strain and preparation method and application thereof
US20040197317A1 (en) Persistent expression of candidate molecule in proliferating stem and progenitor cells for delivery of therapeutic products
JP2023065516A (en) Gene therapy for tuberous sclerosis
CN108949690B (en) A method of prepare can real-time detection mescenchymal stem cell bone differentiation cell model
CN108949691B (en) A method of prepare can real-time detection mescenchymal stem cell aging cell model
CN106755105A (en) One plasmid Rescue System is used for the preparation and application of influenza virus vaccine strain
CN109082443A (en) A method of preparing can the cell model that breaks up to mature hepatic lineage of real-time detection mescenchymal stem cell
CN104357409B (en) Express chicken IL2 recombinant Newcastle disease virus and its application in vaccine
CN104328136B (en) The preparation of Newcastle disease poison strain rClone30 fliC and its application in Newcastle disease prevention
CN113667017A (en) Method capable of improving homologous recombination efficiency of CRISPR/Cas9 system and application
CN112921007A (en) Recombinant adeno-associated virus for preventing cat from infecting new coronavirus, construction method and application thereof
RU2800264C1 (en) Method of obtaining genetically modified laboratory animals with inducible systemic and tissue-specific expression of human cyclophilin a

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20190920

CF01 Termination of patent right due to non-payment of annual fee