KR101961667B1 - Transgenic cloned pig resistant to the Porcine epidemic diarrhea virus and producing method thereof - Google Patents

Abstract

The present invention relates to a transgenic cloned pig resistant to porcine epidemic diarrhea virus and a producing method thereof, and more specifically, to a transgenic cloned pig resistant to porcine epidemic diarrhea virus, which is produced by using a recombinant vector including small guide RNA (sgRNA) and Cas9 gene, and to a producing method thereof. According to the present invention, the recombinant vector using specific sgRNA and a CRISPR/Cas9 method for knocking out the APN gene is capable of knocking out a DNA strand for encoding the APN gene in a transgenic animal, thereby effectively inducing resistance to porcine epidemic diarrhea virus. Accordingly, APN gene knockout pigs can be effectively used in the development and research of porcine pandemic virus treatment drugs, and thus it is possible to significantly reduce farmers′ economic losses from the porcine pandemic viruses.

Description

TECHNICAL FIELD [0001] The present invention relates to a transgenic cloned pig resistant to porcine epidemic diarrhea virus and a method for producing the same,

The present invention relates to a transgenic reproduction pig resistant to porcine epidemic diarrhea virus and a method for producing the same, and more particularly, to a method for producing a transgenic reproduction pig resistant to porcine epidemic diarrhea virus, The present invention relates to a transgenic reproduction pig and a method for producing the same.

CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat) is an adaptive immune system to defend against virus attacks and has evolved from bacteria. Upon exposure to the virus, a short segment of the viral DNA is integrated into the CRISPR locus. RNA is transcribed from a portion of the CRISPR locus, including the viral sequence. The corresponding RNA containing the sequence complementary to the viral genome mediates the targeting of the Cas9 protein to the target sequence in the viral genome. The Cas9 protein is cleaved, thereby silencing the virus target. That is, targeted gene regulation is possible based on the CRISPR / Cas system.

On the other hand, porcine epidemic diarrhea (PED) is an infectious disease of pigs caused by infection with PED virus regardless of age, and has vomiting and hydrosoluble symptoms. Pandemic diarrhea has very similar symptoms to pig infectious gastroenteritis (TGE), but the mortality rate of newborn piglets less than 2 weeks old is lower than that of swine infectious gastroenteritis, and the incidence in finishing pigs and piglets is more common than infectious gastroenteritis. Pandemic strains of diarrhea were first detected in pig farms in Europe, but the incidence has recently increased in Asian countries such as Korea, China, Japan, the Philippines and Thailand. In Korea, the first case of pandemic diarrhea in 1992 was reported, and then spread nationwide. As a result, the economic loss of pig farms due to swine diarrhea is increasing every year.

In order to solve the problems of the prior art as described above, the inventors of the present invention prepared a recombinant vector containing sgRNA and Cas9 gene, and knocked out the pig APN gene efficiently using the recombinant vector to transform the transformant resistant to pandemic diarrhea The present inventors have completed the present invention by confirming that a replica pig can be produced.

Accordingly, an object of the present invention is to provide a DNA sequence encoding a sgRNA, which is represented by any one of SEQ ID NOS: 1 and 2; And a Cas9 gene; and a transformed cell line into which the recombinant vector is introduced.

Another object of the present invention is to provide a method for producing a nuclear transfer embryo, comprising the steps of: transplanting the transformed cell line into a enucleated oocyte to form a nuclear transfer embryo; And transplanting the nuclear transfer embryos into a tubal duct of a surrogate mother. The present invention also provides a method for producing a transgenic reproduction pig having resistance to a porcine epidemic diarrhea virus and a transgenic reproduction pig produced by the method.

In order to achieve the above object, the present invention provides a DNA sequence encoding a sgRNA, wherein the DNA sequence is represented by any one of SEQ ID NOS: 1 and 2; And a Cas9 gene, which are resistant to porcine epidemic diarrhea virus.

In addition, the present invention provides a transgenic reproduction pig which is resistant to porcine epidemic diarrhea virus to which the recombinant vector is introduced.

In addition, the present invention provides a method for producing a nuclear transfer embryo, comprising: transplanting the transformed cell line into a enucleated oocyte to form a nuclear transfer embryo; And transplanting the nuclear transfer embryo into the tubal passage of the surrogate mother. The present invention also provides a method for producing a transgenic reproduction pig having resistance to the swine flu epidemic virus.

In addition, the present invention provides a transgenic reproduction pig which is resistant to the porcine epidemic diarrhea virus produced by the above method.

The recombinant vector using the specific sgRNA and the CRISPR / Cas9 method for knocking out the APN gene according to the present invention can effectively induce tolerance to the pandemic influenza virus by knocking out the DNA strand encoding the APN gene in the transformed animal have. Therefore, the APN gene knockout pig according to the present invention can be effectively used in the field of development and research of a swine infectious virus therapeutic agent, and can greatly reduce the economic loss of the farm due to the swine infectious virus.

FIG. 1 is a diagram illustrating a method for producing pigs knocked out of a pig APN gene using the CRISPR / Cas 9 system according to the present invention.
Figure 2 shows a CRISPR / Cas9 system targeting exon 2 of the porcine APN gene according to the invention.
FIGS. 3 and 4 are graphs showing the results of confirming APN gene knockout of a donor cell line according to the present invention through T7 endonuclease first analysis. FIG.
FIG. 5 is a graph showing the results of confirming pig knockout of a porcine APN gene of a donor cell line according to the present invention through ginger sequencing.
6 is a diagram showing an APN gene knockout pig produced by a somatic cell nuclear transfer method.
FIG. 7 is a diagram showing the results of analysis of the genotype of APN gene knockout pig through Western blotting, T7E1 analysis, and germline sequencing.
8 is a graph showing the results of immunohistochemical staining of small intestine isolated from APN gene knockout pigs according to the present invention and analysis of expression of APN protein in various tissues.
9 is a diagram showing a standard curve for PED virus quantification.
10 is a graph showing the results of quantifying PED virus from small intestine and stool samples of APN gene knockout piglets inoculated with PED virus.
11 is a diagram showing the result of pathological analysis of APN gene knockout piglets inoculated with PED virus.
FIG. 12 shows the results of confirming the detection of PEDV nucleocapsid protein in small intestine and large intestine samples of APN gene knockout piglets inoculated with PED virus through immunohistochemical staining.
13 is a diagram showing a vector map of a recombinant vector for knocking out a porcine APN (pAPN) gene according to the present invention.

Hereinafter, the present invention will be described in detail.

According to an aspect of the present invention, the present invention provides a DNA sequence encoding a sgRNA, wherein the DNA sequence is represented by any one of SEQ ID NOS: 1 and 2; And a Cas9 gene, which are resistant to porcine epidemic diarrhea virus.

In the present invention, the term " vector " means a gene construct comprising a base sequence of a gene operably linked to a suitable regulatory sequence so as to express the gene of interest in a suitable host, Promoters capable of initiating, any operator sequences for modulating such transcription, and sequences that regulate the termination of transcription and translation. The vector of the present invention is not particularly limited as long as it is replicable in cells, and any vector known in the art may be used, and may be, for example, a plasmid, a cosmid, a phage particle, or a viral vector.

In the present invention, the above-mentioned " recombinant vector " means an expression vector of a desired polypeptide capable of expressing the desired polypeptide at a high efficiency in an appropriate host cell when the coding gene of the desired polypeptide to be expressed is operatively linked , And the recombinant vector can be expressed in host cells. The host cell is preferably a eukaryotic cell. Depending on the type of the host cell, an expression control sequence such as a promoter, a terminator, an enhancer, etc., a sequence for membrane targeting or secretion, And can be variously combined according to the purpose.

In the present invention, the sgRNA can form a complex with the Cas9 protein, and can bring the Cas protein into the target DNA, and can be transcribed from the DNA represented by the nucleotide sequence of SEQ ID NO: 1 or 2. In particular, the sgRNA preferably includes an sgRNA transcribed from a DNA represented by the nucleotide sequence of SEQ ID NO: 1 or 2 for binding with a target DNA of interest, but is not limited thereto.

The relatively small size of the Cas gene (e.g., Cas9 at 4.2 kbp) provides advantages for RNA-guided endonuclease compositions in some applications, such as virus-mediated gene delivery. Additionally, these sgRNAs do not have an off-target effect and therefore do not cause unwanted mutations, deletions, inversions and redundancies.

In the present invention, the Cas9 protein means an essential protein element in the CRISPR / Cas system. When composing a complex with two RNAs called CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA) To form an active endonuclease or nickase. The gene encoding the Cas9 protein is generally associated with the CRISPR repeat-spacer array, and there are more than 40 different Cas protein families. Typically, there are three types of CRISPR-Cas systems, of which type II CRISPR / Cas systems are associated with Cas9 proteins.

In one embodiment of the present invention, the Cas9 gene encoding the Cas9 protein may be represented by the nucleotide sequence of SEQ ID NO: 3, but the present invention is not limited thereto.

The restriction enzymes used in the production of the recombinant vector may be EcoRI, BamHI, Bg / II, HindIII, PvuIII, BbsI, preferably BbsI, and the present invention is not limited thereto.

Variants of the nucleotide sequence represented by SEQ ID NO: 1, 2, or 3 are also included within the scope of the present invention. The present invention is based on the finding that although equivalents of the above base sequences, for example, some base sequences, have been modified by deletion, substitution or insertion, but are capable of functionally equivalent to APN knockout sgRNA and Cas9 It is a concept that includes variants. Specifically, the sgRNA and the Cas9 each have at least 70% sequence identity, more preferably at least 80% sequence identity, more preferably at least 90% sequence identity, and most preferably at least 95% sequence identity with the nucleotide sequence of SEQ ID NO: 1, And may include nucleotide sequences having homology with each other. &Quot;% of sequence homology to polynucleotides " is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI >

In the present invention, the recombinant vector can target the base sequence of the APN gene and delete the base sequence in the biallelic gene, but in general, deletion or insertion of the base sequence occurs in any one of the alleles . The deletion or insertion can result in a transgenic cloned pig that is resistant to the porcine epidemic virus.

In another embodiment of the present invention, the nucleotide sequence deletion in the above-mentioned double-stranded character comprises deletion of the nucleotide sequence in the exon 2 of the APN gene represented by SEQ ID NO: 4 and deletion of all or part of the exon 2 is possible, But is not limited thereto.

In another embodiment of the present invention, the recombinant vector preferably has a cleavage map as shown in the following figures, but is not limited thereto, provided that the vector is capable of achieving knockout of the APN gene of the present invention.

[Degree]

In addition, the recombinant vector may be composed of the nucleotide sequence shown in SEQ ID NO: 4, and the present invention is not limited thereto.

According to another aspect of the present invention, there is provided a transformed cell line into which a recombinant vector for producing transgenic reproduction pigs resistant to swine epidemic diarrhea virus has been introduced.

In the present invention, the term " cell line " refers to each individual cell line when cells are separated and cultured and subcultured, wherein the cell line can be distinguished from other cell lines by genetic traits, It is said to be maintained.

In one embodiment of the present invention, the cell line can be an oocyte, fibroblast or kidney cell line, preferably a fibroblast cell line. The cell line can be more specifically a fetal-derived cell line, and at the same time, a primary cell line can be used. Since the cell line of the present invention is most preferably a primary fetal fibroblast cell line, It is not.

In the present invention, " transformation " means that the genetic property of a living organism is changed by DNA given from outside, that is, when DNA, which is a kind of nucleic acid extracted from a cell of a certain line of an organism, It is a phenomenon that the genetic traits are changed by entering the cell, and it is called transformation, transformation, or transformation. In other words, " transformation " means introducing a gene into a host cell so that the gene can be expressed in the host cell.

The recombinant vector of the present invention can be transformed by introducing the recombinant vector into a cell line by transforming the recombinant vector of the present invention by a method known in the art such as, but not limited to, transient transfection, microinjection, transfection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE dextran-mediated transfection, polybrene- mediated transfection, and electroporation. The transformant can be transformed into a eukaryotic cell, and preferably, it can be transformed using a microscan method.

In the present invention, the transformed cell line was deposited at the Korean Cell Line Bank on Jul. 12, 2017, and received the accession number KCLRF-BP-00406.

In another embodiment of the present invention, the present invention provides a method for producing a nuclear transfer embryo, comprising: transplanting the transformed cell line into a enucleated oocyte to form a nuclear transfer embryo; And transplanting the nuclear transfer embryo into the tubal passage of the surrogate mother, wherein the method comprises the steps of:

The method for producing transgenic reproduction pigs resistant to the porcine epidemic diarrhea virus is by somatic cell nuclear transfer (SCNT).

In the present invention, the above-mentioned " somatic cell nuclear transfer " is a genetic manipulation technique capable of producing a progeny without passing through the meiosis and hemispheric genital germ cells normally produced during the reproductive process. And the embryo is transplanted in vivo to generate a new individual.

In the present invention, the term "nuclear transfer embryo" refers to an oocyte into which nuclear donor cells are introduced or fused.

In the present invention, the " fusion " means the binding of the nuclear donor cell to the lipid membrane portion of the egg. For example, a lipid membrane can be a plasma membrane or a nuclear membrane of a cell. Fusion can occur by applying electrical stimulation when the nuclear donor cell and the oocyte are adjacent to each other or when the nuclear donor cell is located in the perivitelline space of the recipient oocyte.

In the present invention, the " transformed cell line " is a cell line into which a recombinant vector for transgenic reproduction pig production resistant to porcine epidemic diarrhea virus has been introduced and used as a nuclear donor cell. The transformed cell line refers to a nucleus of a cell or a cell that transfers a nucleus to an oocyte, which is a nuclear receptor.

In the present invention, the term " oocyte " refers to a mature oocyte which has reached the middle stage of the second meiosis, preferably a porcine oocyte.

A method for producing transgenic reproduction pigs resistant to swine epidemic diarrhea virus according to a preferred embodiment of the present invention is shown in Fig. The above manufacturing method has an advantage that the target efficiency of the CRISPR / Cas 9 system is remarkably high.

In another aspect of the present invention, the present invention provides a transgenic reproduction pig that is resistant to the swine epidemic virus produced by the above method.

In the present invention, " viral resistance " means resistance to certain viruses, which include (1) non-susceptible; (2) localized viruses that are localized around the infected area and not spread throughout the body, even if infected; And (3) the resistance of the virus to proliferation but scarcity of disease.

Pigs have been recognized for their similarity to human anatomy physiologically and have already been used for pathological mechanisms and treatments of various diseases. Especially, they are valued as economical animals for a long time and are more ethical It is possible to avoid the problems, and it has a stable breeding system and it is easy to maintain and manage when developing an animal model.

The transgenic reproduction pig having resistance to swine epidemic diarrhea virus according to the present invention is characterized in that deletion or insertion mutation of the nucleotide sequence in the exon 2 of the APN gene occurs. Transgenic cloned pigs resistant to the porcine epidemic diarrhea virus may have sequence deletions or insertions in either the DNA strand or both DNA strands of the APN gene and preferably deletion or deletion Or insertion takes place. However, the present invention is not limited thereto, and transgenic reproduction pigs resistant to porcine epidemic diarrhea virus can be produced through deletion or insertion of the APN gene sequence as described above, regardless of the females and males.

The transgenic pigs resistant to the swine epidemic virus according to the present invention are extremely infectious against the swine epidemic diarrhea virus and thus can be usefully used in the field of development and research of pandemic virus therapeutic agents. The economic loss of pig farmers can be greatly reduced.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

A method for producing pigs knocked out of a pig APN gene using the CRISPR / Cas 9 system described in Examples 1 to 4 below is shown in FIG.

Example  One. CRISPR / Cas 9 system Pigs through APN (Porcine aminopeptidase  N) Production of gene knockout recombinant vector

The sgRNA (small guide RNA) used to prepare the recombinant vector for knocking out the pig APN (pAPN) gene (GenBank ACCESSION No. NM_214277) is available from the online CRISPR design tool (http://zifit.partners.org/) ZiFiT / Disclaimer.aspx). Specifically, the sequences shown in SEQ ID NOS: 1 and 2 in Table 1 below were used, which specifically recognized the APN gene of pigs, It is a sequence designed to knock out all of the strands. The bold-colored letters indicate PAM nucleotide sequences.

Base sequence sgRNA 1 5 '- CACCACAGACAGAGCGATGA (SEQ ID NO: 1) TGG -3' sgRNA 2 5 '- CCTTGGACCAGAGCAAGCCG (SEQ ID NO: 2) TGG -3'

The sgRNA thus prepared was introduced into pCas9-H2K ^k vector using BbsI restriction enzyme. The pCas9-H2Kk vector can enrich Cas9-expressing cells using MACSelect K ^k microbeads and a MACS® cell separation system (Miltenyi Biotech, Bergisch Gladbach, Germany). The pCas9-H2Kk in the vector and the cut Cas9 H2K ^k is 2A, and is connected to the self-cleavage peptide (self-cleavage peptide 2A), the self-cleavage peptide 2A may be translated independently under the control of a promoter 2A. The vector was used as a template for producing sgRNA transcribed from DNA represented by the nucleotide sequence of SEQ ID NO: 1 or 2 and Cas9 mRNA represented by the nucleotide sequence of SEQ ID NO: 3 at the time of in vivo transcription. The CRISPR / Cas9 system targeting exon 2 of the porcine APN gene is shown in FIG. Also, the entire sequence of the recombinant vector produced is represented by the nucleotide sequence of SEQ ID NO: 4, and its vector map is shown in FIG.

Example  2. Donor cell line  making

Donor cell lines were prepared using porcine primary fetal fibroblasts (PFFs). The pig primary fibroblasts have a genetic background of farm pigs. A donor cell line was prepared from a 35-day-old porcine fetus (male or female). the pCas9-H2K ^k vector containing a target pAPN sgRNA (sgRNA sgRNA 1 or 2) was introduced into a primary fetal fibroblasts. The vector was introduced into cells by electroporation using Nucleofector ™ (LONZA, Basel, Switzerland), and the experiment was carried out according to the manufacturer's manual. Forty-eight hours after transduction, cells transfected with the MACS (R) cell sorting system using H2K ^k microbeads were isolated. The concentrated cells were seeded with limiting dilution method and cultured to obtain single cell-derived colonies. Each colony was successively subcultured in 48-well plates, 24-well plates, 6-well plates and 100 mm culture dishes.

The donor cell line produced through the above process has knocked out the pig APN gene, deposited with the Korean Cell Line Bank on Jul. 12, 2017, and granted accession number KCLRF-BP-00406.

Example  3. Donor cell line APN  Check for gene knockout

3-1. Nested PCR nested PCR )

PCR was carried out to confirm whether or not the pig APN gene knockout occurred normally in the donor cell line prepared in Example 2 before the somatic cell transplantation.

Genomic DNA of donor cells (cells derived from each colony) prepared in Example 2 was extracted using a genomic DNA extraction kit (iNtRon Biotechnology, Seongnam, Korea). The extracted genomic DNA was used as a template for polymerase chain reaction (PCR). In order to confirm the genetic modification of the pig APN gene, nested PCR was performed using a primer set specific for the target site and PCR was performed using Pfu Plus 5x Master Mix (ELPIS biotech, Daejeon, Korea) The fragment of the target site was amplified from the APN gene.

Specifically, the first PCR was performed using the genomic DNA extracted from each colony and the first PCR primer set (Forward; 5'-GTTGTCATAGCTCACAGCTCACA-3 ', Reverse; 5'-CAAAGTCTCCAGAAGGTTCCAAG-3') using the following conditions . The PCR was performed once at 95 < 0 > C for 5 min; Denaturation at 95 ° C for 30 seconds, annealing at 60 ° C for 30 seconds and extension at 72 ° C for 30 seconds were repeated 30 times; Finally, post-extension was performed once at 72 ° C for 10 minutes.

Then, a second PCR was performed. The second PCR was performed using a diluted first PCR product (1: 100) as a template and a second PCR primer set (Forward; 5 '- CAAGGGATTCTACATTTCCAAGG-3', Reverse; 5 '- GGTACTCAGTGAGCTCTACCAGC-3' It was carried out under the following conditions. The second PCR was performed once at 95 < 0 > C for 5 min. Denaturation at 95 DEG C for 30 seconds, annealing at 60 DEG C for 30 seconds and extension at 72 DEG C for 30 seconds were repeated 35 times; Followed by a one-time post-extension at 72 ° C for 10 minutes. The PCR product of the second PCR was used for T7 endonuclease 1 (T7E1) analysis and Sanger sequencing.

3-2. T7 Endonuclease  One( T7E1 ) analysis

T7E1 analysis confirmed the transformation of the porcine APN gene target site in the donor cell line. The purified nested PCR product was denatured at 95 ° C for 5 minutes and then reheated at -2 ° C / sec to 85 ° C, -0.1 ° C / sec to 25 ° C, and then T7E1 enzyme (ToolGen, Seoul, Korea) And treated for 30 minutes. Nested PCR products and T7E1 digests were electrophoresed using 2% agarose gel (in TAE buffer) and visualized with a UN transilluminator. The results of the T7 endonuclease first assay are shown in Figures 3 and 4.

As shown in Figs. 3 and 4, a potential mutation was detected in the porcine APN gene of the donor cell line prepared in Example 2 above.

3-3. Sanger  Sequencing Pigs through APN  Confirm gene knockout

More specifically, in order to confirm the deformation of the porcine APN gene target site of the donor cell line, the sanger sequencing of the PCR product prepared in Example 3-1 was carried out, and the result is shown in Fig.

As shown in FIG. 5, the donor cell line prepared in Example 2 was mutated in the porcine APN gene region, and more specifically, it was confirmed that double allelic transformation with base deletion or insertion occurred at the target site.

3-4. Target efficiency analysis

From the T7 endonuclease first analysis and the ginger sequencing results, the target efficiency of the CRISPR / Cas 9 system targeting exon 2 of the pig APN gene was analyzed. The results of the target efficiency analysis are shown in Table 2.

sgRNA Number of colonies obtained Number of colonies analyzed Number of transformed colonies Target efficiency
(%) sgRNA # 1 48 48 43 89.6 sgRNA # 2 48 44 40 90.9

As shown in Table 2, the target efficiencies of the CRISPR / Cas 9 system targeting exon 2 of the pig APN gene were 89.6% (sgRNA # 1) and 90.9% (sgRNA # 2), respectively.

Example  4. Somatic cells of donor cells Nuclear transfer ( SCNT ; Somatic cell nuclear transfer) and APN  gene Knockout pig  Produce

4-1. On SCNT  Manufacture of oocytes used

Porcine eggs collected from local slaughterhouses were transferred to a laboratory in a solution of 0.9% (W / V) NaCl at 25 to 30 ° C to prepare donor cells to be injected with nuclear donor cells to perform SCNT. The ova were obtained from an antral follicle (now 3-6 mm in size) and cultured in mature medium under 5% carbon dioxide and 39 ° C conditions. After 44 hours, the matured oocytes were transferred to a first polar body (diameter 20 μm) in a manipulated medium supplemented with cytokalase B (5 mg / ml stock (stock), 1.5 μm per 10 ml manipulation medium) And adjacent cytoplasm were inhaled and exonucleated. Later, it was used as an egg to inject nuclei of donor cells used for SCNT.

4-2. Nuclear donor cell SCNT  Perform

One nuclear donor cell (accession number: KCLRF-BP-00406) in which the swine APN gene target site was selected through the procedures of Examples 3-1 to 3-3 was observed, And then injected into the perivitelline space of the irradiated oocytes. The oocyte cytoplasmic-cell complexes were fused and activated with an electrical pulse (ECM 2001; BTX, two 1.1 kV / cm DC pulses for 60 seconds). The reconstituted oocytes were cultured in PZM3 medium supplemented with 0.5 μM histidine deacetylase inhibitor, Scriptaid, in an incubator in the presence of 5% carbon dioxide at a temperature of 39 ° C. for 14 to 16 hours.

A donor cell line which has been confirmed to be transformed into the target region of the APN gene obtained in Example 3 was screened to obtain a donor cell line, and nucleus transplantation through the SCNT method was performed to make a more accurate APN gene knockout pig.

4-3. APN  gene Knockout pig  Produce

The surrogate mothers whose estrus was 2 days old were selected, and the reproductive embryos prepared in Example 4-2 were injected into the fallopian tubes (average 250 eggs) through open surgery. The success of the first pregnancy was confirmed by abdominal ultrasonography 28 days after the transplanted embryo. Pregnancy progress was monitored every two weeks. Cloned embryos After approximately 114 days of transplantation, cloned pigs were obtained through surrogate mother c-section or natural pat- tition. The cloned piglets were biopsied for genomic DNA extraction and genotyping at birth. The produced APN gene knockout pig is shown in Fig.

Example  5. APN  gene Knockout pig  Genotype and phenotypic analysis

5-1. Genomic DNA extraction

Using a genomic DNA extraction kit, the genomic DNA was extracted from the piglet produced in Example 4. Nestled PCR, T7E1 analysis and Sanger sequencing were performed by the method of Example 3 to confirm the genetic modification of the pig APN target region of each piglet.

5-2. APN  gene Knockout pig  Genetic analysis

To confirm protein expression of the APN gene, tissues (heart, liver, lung, kidney, spleen and small intestine) were isolated from piglets. Western blotting was performed using the separated tissues, and small intestine was subjected to immunohistochemical staining (IHC). The anti-pig APN mouse serum used in the experiment was provided by Dr. Hur Sung Hoon of Seoul National University and the serum was used for Western blotting and immunohistochemical staining.

Each tissue (heart, liver, lung, kidney, spleen and small intestine) was dissolved with RIPA buffer (Biosesang, Seongnam, Korea) for Western blotting. A total of 100 μg of total lysate was loaded onto a gel (Mini-PROTEAN® TGX Stain-Free ™ gel, Bio-Rad, CA, USA) and then electrophoresed. The membrane was then transferred to a PVDF membrane using the Trans-Blot® Turbo ™ transfer system (Bio-Rad, CA, USA) according to the manufacturer's manual. After transfer, the membrane was reacted with primary anti-pig APN mouse serum (1: 500) and blocked with 5% skim milk. The blocked membrane was washed and reacted with a secondary antibody, HRP-conjugated goat anti-mouse IgG (1: 5,000, Santa Cruz Biotechnology, TX, USA). The washed membranes were developed using EzWestLumi plus (ATTO, Tokyo, Japan) and visualized with a ChemiDoc ™ imaging system (Bio-Rad, CA, USA). T7E1 analysis and germline sequencing were also performed to identify mutant sites in the porcine APN gene. Western blotting, T7E1 assay and germline sequencing results are shown in FIG.

As shown in Fig. 7, all the piglets prepared in Example 4 were found to mutate in exon 2 of the pig APN gene. From the results of singer sequencing, we also confirmed the double allele mutation that occurred in the locus of the pig APN gene.

5-3. APN  gene Knockout pig  Phenotypic analysis

Immunohistochemical staining was performed using a small intestine isolated from APN gene knockout piglets. The control group of this experiment used wild type piglets of similar age. Specifically, the isolated small intestine was fixed with 10% formalin, and the fixed tissue was immersed in paraffin. The paraffin block in which the small intestine was embedded was sliced to prepare a thin film having a thickness of 3 to 4 탆. Anti-pig APN mouse serum was used as the primary antibody for immunohistochemical staining. The slices were treated with a primary antibody diluent (1: 200) containing a background reducing component (S3022, Dako, CA, USA) and incubated overnight at 4 ° C. The primary antibody was incubated and the flakes were washed with PBS. The washed flakes were incubated with REAL EnVsion ™ / HRP, Rabbit / Mouse (K5007, Dako, CA, USA) for 30 min at 37 ° C. The cultured flakes were treated with 3,3'-diaminobenzidine tetrahydrochloride (K5007, Dako) for 30 to 40 seconds. The flakes were counterstained with hematoxylin.

Next, the expression of APN protein in tissues (heart, liver, lung, kidney, spleen and small intestine) isolated from piglets was confirmed by the Western blotting method of Example 5-2.

APN gene knockout Results of immunohistochemical staining of small intestine isolated from piglets and analysis of APN protein expression in various tissues are shown in Fig.

As shown in FIG. 8, APN protein was expressed in wild-type piglets, but APN protein was not expressed in APN gene knockout piglets.

Example  6. PED  Infectiousness test for virus

6-1. Inoculation of virus

For infectivity testing, subcultured PEDV DR13 virus was propagated in viral cells (vero cell, ATCC, CCL-81) using viral replication medium. The viral replication medium is? -MEM medium supplemented with 0.02% yeast extract, 0.3% tryptophosphate broth, and 2 μg trypsin (T-VM). The proliferation of DR13 strain (10 ^5.8 to 10 ^{6. 0} TCID ₅₀ /0.1ml) piglets was vaccinated by oral route and similar to wild-type swine (Duroc x Yorkshire x Landrace) of age, not inoculated with the negative control the strain DR13 The piglets were grown in separate rooms.

6-2. PED  Create a standard curve for virus quantification

The standard curve for quantification of PED virus was confirmed using log ₁₀ 50% tissue culture infected dose (log ₁₀ TID ₅₀ / mL). The infectivity test results were calculated using a regression curve of cycle threshold (Ct) values obtained from serially diluted viruses, the results of which are shown in FIG.

As shown in Figure 9, the virus titer (log TCID ₅₀ / ml) was determined from real-time RT-PCR results using a standard curve of Ct values of serially diluted virus. The equation generated by plotting the Ct value of the standard curve and the TCID titer is y = -3.642x + 36.56 and the linear regression coefficient (R ² ) is 0.9988.

6-3. From piglet PED  Virus quantification

In order to quantitate PED virus in pigs inoculated with PED virus, DNA is extracted from small intestine tissue and stool sample of piglets inoculated with PED virus and real-time reverse transcription-polymerase chain reaction (RT-PCR) Respectively.

Specifically, 500 mg of Jejunum samples were homogenized and resuspended in 500 μL MEM. 5 g of stool sample was resuspended in 5 ml MEM. According to the manufacturer's manual, virus RNA was extracted from the small intestine and feces samples. The RNA extraction was performed using a chemagic virus DNA / RNA kit (PerkinElmer chemagen Technology GmbH, Baesweiler, Germany). The viral RNA contained 0.4 μM of nucleoside gene specific primer (forward: CGCAAAGACTGAACCCACTAATTT; reverse: TTGCCTCTGTTGTTACTTGGAGAT) and 0.1 μM probe (FAM-TGTTGCCATTGCCACGACTCCTGC-BHQ-1) Real-time RT-PCR of viral RNA was performed using a polymerase chain reaction (RT-PCR) kit (SensiFASTTM, Bioline, London, UK). The real-time RT-PCR was repeated for 40 cycles of reverse transcription at 50 캜 for 10 minutes, initial denaturation at 95 캜 for 2 minutes, denaturation at 95 캜 for 10 seconds after initial denaturation, and annealing at 60 캜 for 30 seconds. The results of quantifying PED virus from piglets using the standard curve of Example 6-2 are shown in FIG.

As shown in Fig. 10, there was a significant difference in wild-type piglets and APN gene knockout piglet virus levels. In other words, Viral shedding of APN gene knockout pigs showed low titer in the stool at 3 and 7 days after infection, and it was confirmed that the viral value was not detectable in the small intestine. On the other hand, the virus serotype in wild type pigs remained highly elevated for 7 days after inoculation, with titers in stool.

Example  7. PED  virus Infected pig  Pathological analysis

Pathological analysis of the intestinal and colon tissues of PED virus infected pigs was performed. The pathological analysis was performed by immunohistochemically staining a sample of PED virus infected pigs and then evaluating the veterinary pathologist. More specifically, the evaluation was conducted by a blind test, and the evaluation items were inflammation of the small intestine and large intestine, villous atrophy and necrosis. The pathological evaluation results are shown in Fig.

As shown in Fig. 11, no characteristic lesions were found in the papn-KO # 1 embryos (Fig. 11A). On the other hand, wild type # 1 embryos (Figure 11B) showed characteristic lesions of swine diarrhea. Porcine lesions infected with the swine diarrhea are the accumulation of liquid in the thin, transparent small intestine wall and intestinal lumen.

Next, a PEDV-specific monoclonal antibody (Optipharm solution, Republic of Korea) was used for the detection of PED virus-specific antigens, and paraffin sections prepared using small intestine and colon samples were immunohistochemically stained. Immunohistochemical staining results are shown in Fig.

As shown in Fig. 12, the PEDV nucleocapsid protein was detected in wild-type piglets inoculated with PED virus. On the other hand, there was no virus infection in the main tissues after PEDV inoculation because there was no PEDV antigen in the intestinal tissue of the APN gene knockout pig.

From the above results, it was confirmed that the recombinant vector using the specific sgRNA and the CRISPR / Cas9 method for knocking out the porcine APN gene according to the present invention knock out the DNA strand encoding the swine APN gene in the transformed pig. In addition, the APN gene knockout pig was found to be resistant to the swine epidemic virus, the APN gene knockout pig according to the present invention can be effectively used in the field of development and research of a vaccine against porcine infectious virus, Economic losses can be greatly reduced.

Having described specific portions of the present invention in detail, those skilled in the art will appreciate that these specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

Korea Cell Line Research Foundation KCLRF-BP-00406 20170712

<110> MGENPLUS CO., LTD. <120> Transgenic cloned pig resistant to the Porcine epidemic diarrhea          virus and producing method thereof <130> 1-5P <160> 4 <170> KoPatentin 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sgRNA 1 coding DNA sequence <400> 1 caccacagac agagcgatga 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sgRNA 2 coding DNA sequence <400> 2 ccttggacca gagcaagccg 20 <210> 3 <211> 4269 <212> DNA <213> Artificial Sequence <220> <223> Cas9 coding DNA sequence <400> 3 atggactata aggaccacga cggagactac aaggatcatg atattgatta caaagacgat 60 gacgataaga tggccccaaa gaagaagcgg aaggtcggta tccacggagt cccagcagcc 120 gacaagaagt acagcatcgg cctggacatc ggcaccaact ctgtgggctg ggccgtgatc 180 accgacgagt acaaggtgcc cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac 240 agcatcaaga agaacctgat cggagccctg ctgttcgaca gcggcgaaac agccgaggcc 300 acccggctga agagaaccgc cagaagaaga tacaccagac ggaagaaccg gatctgctat 360 ctgcaagaga tcttcagcaa cgagatggcc aaggtggacg acagcttctt ccacagactg 420 gaagagtcct tcctggtgga agaggataag aagcacgagc ggcaccccat cttcggcaac 480 atcgtggacg aggtggccta ccacgagaag taccccacca tctaccacct gagaaagaaa 540 ctggtggaca gcaccgacaa ggccgacctg cggctgatct atctggccct ggcccacatg 600 atcaagttcc ggggccactt cctgatcgag ggcgacctga accccgacaa cagcgacgtg 660 gacaagctgt tcatccagct ggtgcagacc tacaaccagc tgttcgagga aaaccccatc 720 aacgccagcg gcgtggacgc caaggccatc ctgtctgcca gactgagcaa gagcagacgg 780 ctggaaaatc tgatcgccca gctgcccggc gagaagaaga atggcctgtt cggaaacctg 840 attgccctga gcctgggcct gacccccaac ttcaagagca acttcgacct ggccgaggat 900 gccaaactgc agctgagcaa ggacacctac gacgacgacc tggacaacct gctggcccag 960 atcggcgacc agtacgccga cctgtttctg gccgccaaga acctgtccga cgccatcctg 1020 ctgagcgaca tcctgagagt gaacaccgag atcaccaagg cccccctgag cgcctctatg 1080 atcaagagat acgacgagca ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag 1140 cagctgcctg agaagtacaa agagattttc ttcgaccaga gcaagaacgg ctacgccggc 1200 tacattgacg gcggagccag ccaggaagag ttctacaagt tcatcaagcc catcctggaa 1260 aagatggacg gcaccgagga actgctcgtg aagctgaaca gagaggacct gctgcggaag 1320 cagcggacct tcgacaacgg cagcatcccc caccagatcc acctgggaga gctgcacgcc 1380 attctgcggc ggcaggaaga tttttaccca ttcctgaagg acaaccggga aaagatcgag 1440 aagatcctga ccttccgcat cccctactac gtgggccctc tggccagggg aaacagcaga 1500 ttcgcctgga tgaccagaaa gagcgaggaa accatcaccc cctggaactt cgaggaagtg 1560 gtggacaagg gcgcttccgc ccagagcttc atcgagcgga tgaccaactt cgataagaac 1620 ctgcccaacg agaaggtgct gcccaagcac agcctgctgt acgagtactt caccgtgtat 1680 aacgagctga ccaaagtgaa atacgtgacc gagggaatga gaaagcccgc cttcctgagc 1740 ggcgagcaga aaaaggccat cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg 1800 aagcagctga aagaggacta cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc 1860 ggcgtggaag atcggttcaa cgcctccctg ggcacatacc acgatctgct gaaaattatc 1920 aaggacaagg acttcctgga caatgaggaa aacgaggaca ttctggaaga tatcgtgctg 1980 accctgacac tgtttgagga cagagagatg atcgaggaac ggctgaaaac ctatgcccac 2040 ctgttcgacg acaaagtgat gaagcagctg aagcggcgga gatacaccgg ctggggcagg 2100 ctgagccgga agctgatcaa cggcatccgg gacaagcagt ccggcaagac aatcctggat 2160 ttcctgaagt ccgacggctt cgccaacaga aacttcatgc agctgatcca cgacgacagc 2220 ctgaccttta aagaggacat ccagaaagcc caggtgtccg gccagggcga tagcctgcac 2280 gagcacattg ccaatctggc cggcagcccc gccattaaga agggcatcct gcagacagtg 2340 aaggtggtgg acgagctcgt gaaagtgatg ggccggcaca agcccgagaa catcgtgatc 2400 gaaatggcca gagagaacca gaccacccag aagggacaga agaacagccg cgagagaatg 2460 aagcggatcg aagagggcat caaagagctg ggcagccaga tcctgaaaga acaccccgtg 2520 gaaaacaccc agctgcagaa cgagaagctg tacctgtact acctgcagaa tgggcgggat 2580 atgtacgtgg accaggaact ggacatcaac cggctgtccg actacgatgt ggaccatatc 2640 gtgcctcaga gctttctgaa ggacgactcc atcgacaaca aggtgctgac cagaagcgac 2700 aagaaccggg gcaagagcga caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac 2760 tactggcggc agctgctgaa cgccaagctg attacccaga gaaagttcga caatctgacc 2820 aaggccgaga gaggcggcct gagcgaactg gataaggccg gcttcatcaa gagacagctg 2880 gtggaaaccc ggcagatcac aaagcacgtg gcacagatcc tggactcccg gatgaacact 2940 aagtacgacg agaatgacaa gctgatccgg gaagtgaaag tgatcaccct gaagtccaag 3000 ctggtgtccg atttccggaa ggatttccag ttttacaaag tgcgcgagat caacaactac 3060 caccacgccc acgacgccta cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac 3120 cctaagctgg aaagcgagtt cgtgtacggc gactacaagg tgtacgacgt gcggaagatg 3180 atcgccaaga gcgagcagga aatcggcaag gctaccgcca agtacttctt ctacagcaac 3240 atcatgaact ttttcaagac cgagattacc ctggccaacg gcgagatccg gaagcggcct 3300 ctgatcgaga caaacggcga aaccggggag atcgtgtggg ataagggccg ggattttgcc 3360 accgtgcgga aagtgctgag catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag 3420 acaggcggct tcagcaaaga gtctatcctg cccaagagga acagcgataa gctgatcgcc 3480 agaaagaagg actgggaccc taagaagtac ggcggcttcg acagccccac cgtggcctat 3540 tctgtgctgg tggtggccaa agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa 3600 gagctgctgg ggatcaccat catggaaaga agcagcttcg agaagaatcc catcgacttt 3660 ctggaagcca agggctacaa agaagtgaaa aaggacctga tcatcaagct gcctaagtac 3720 tccctgttcg agctggaaaa cggccggaag agaatgctgg cctctgccgg cgaactgcag 3780 aagggaaacg aactggccct gccctccaaa tatgtgaact tcctgtacct ggccagccac 3840 tatgagaagc tgaagggctc ccccgaggat aatgagcaga aacagctgtt tgtggaacag 3900 cacaagcact acctggacga gatcatcgag cagatcagcg agttctccaa gagagtgatc 3960 ctggccgacg ctaatctgga caaagtgctg tccgcctaca acaagcaccg ggataagccc 4020 atcagagagc aggccgagaa tatcatccac ctgtttaccc tgaccaatct gggagcccct 4080 gccgccttca agtactttga caccaccatc gaccggaaga ggtacaccag caccaaagag 4140 gtgctggacg ccaccctgat ccaccagagc atcaccggcc tgtacgagac acggatcgac 4200 ctgtctcagc tgggaggcga caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa 4260 aagaaaaag 4269 <210> 4 <211> 9609 <212> DNA <213> Artificial Sequence <220> <223> recombinant vector <400> 4 gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60 ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120 aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180 atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240 cgaaacaccg accacagaca gagcgatgag ttttagagct agaaatagca agttaaaata 300 aggctagtcc gttatcaact tgaaaaagtg gcaccgagtc ggtgcttttt tgttttagag 360 ctagaaatag caagttaaaa taaggctagt ccgtttttag cgcgtgcgcc aattctgcag 420 acaaatggct ctagaggtac ccgttacata acttacggta aatggcccgc ctggctgacc 480 gcccaacgac ccccgcccat tgacgtcaat agtaacgcca atagggactt tccattgacg 540 tcaatgggtg gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat 600 gccaagtacg ccccctattg acgtcaatga cggtaaatgg cccgcctggc attgtgccca 660 gtacatgacc ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat 720 taccatggtc gaggtgagcc ccacgttctg cttcactctc cccatctccc ccccctcccc 780 acccccaatt ttgtatttat ttatttttta attattttgt gcagcgatgg gggcgggggg 840 gggggggggg cgcgcgccag gcggggcggg gcggggcgag gggcggggcg gggcgaggcg 900 gagaggtgcg gcggcagcca atcagagcgg cgcgctccga aagtttcctt ttatggcgag 960 gcggcggcgg cggcggccct ataaaaagcg aagcgcgcgg cgggcgggag tcgctgcgac 1020 gctgccttcg ccccgtgccc cgctccgccg ccgcctcgcg ccgcccgccc cggctctgac 1080 tgaccgcgtt actcccacag gtgagcgggc gggacggccc ttctcctccg ggctgtaatt 1140 agctgagcaa gaggtaaggg tttaagggat ggttggttgg tggggtatta atgtttaatt 1200 acctggagca cctgcctgaa atcacttttt ttcaggttgg accggtgcca ccatggacta 1260 taaggaccac gacggagact acaaggatca tgatattgat tacaaagacg atgacgataa 1320 gatggcccca aagaagaagc ggaaggtcgg tatccacgga gtcccagcag ccgacaagaa 1380 gtacagcatc ggcctggaca tcggcaccaa ctctgtgggc tgggccgtga tcaccgacga 1440 gtacaaggtg cccagcaaga aattcaaggt gctgggcaac accgaccggc acagcatcaa 1500 gaagaacctg atcggagccc tgctgttcga cagcggcgaa acagccgagg ccacccggct 1560 gaagagaacc gccagaagaa gatacaccag acggaagaac cggatctgct atctgcaaga 1620 gatcttcagc aacgagatgg ccaaggtgga cgacagcttc ttccacagac tggaagagtc 1680 cttcctggtg gaagaggata agaagcacga gcggcacccc atcttcggca acatcgtgga 1740 cgaggtggcc taccacgaga agtaccccac catctaccac ctgagaaaga aactggtgga 1800 cagcaccgac aaggccgacc tgcggctgat ctatctggcc ctggcccaca tgatcaagtt 1860 ccggggccac ttcctgatcg agggcgacct gaaccccgac aacagcgacg tggacaagct 1920 gttcatccag ctggtgcaga cctacaacca gctgttcgag gaaaacccca tcaacgccag 1980 cggcgtggac gccaaggcca tcctgtctgc cagactgagc aagagcagac ggctggaaaa 2040 tctgatcgcc cagctgcccg gcgagaagaa gaatggcctg ttcggaaacc tgattgccct 2100 gagcctgggc ctgaccccca acttcaagag caacttcgac ctggccgagg atgccaaact 2160 gcagctgagc aaggacacct acgacgacga cctggacaac ctgctggccc agatcggcga 2220 ccagtacgcc gacctgtttc tggccgccaa gaacctgtcc gacgccatcc tgctgagcga 2280 catcctgaga gtgaacaccg agatcaccaa ggcccccctg agcgcctcta tgatcaagag 2340 atacgacgag caccaccagg acctgaccct gctgaaagct ctcgtgcggc agcagctgcc 2400 tgagaagtac aaagagattt tcttcgacca gagcaagaac ggctacgccg gctacattga 2460 cggcggagcc agccaggaag agttctacaa gttcatcaag cccatcctgg aaaagatgga 2520 cggcaccgag gaactgctcg tgaagctgaa cagagaggac ctgctgcgga agcagcggac 2580 cttcgacaac ggcagcatcc cccaccagat ccacctggga gagctgcacg ccattctgcg 2640 gcggcaggaa gatttttacc cattcctgaa ggacaaccgg gaaaagatcg agaagatcct 2700 gaccttccgc atcccctact acgtgggccc tctggccagg ggaaacagca gattcgcctg 2760 gatgaccaga aagaccgagg aaaccatcac cccctggaac ttcgaggaag tggtggacaa 2820 gggcgcttcc gcccagagct tcatcgagcg gatgaccaac ttcgataaga acctgcccaa 2880 cgagaaggtg ctgcccaagc acagcctgct gtacgagtac ttcaccgtgt ataacgagct 2940 gaccaaagtg aaatacgtga ccgagggaat gagaaagccc gccttcctga gcggcgagca 3000 gaaaaaggcc atcgtggacc tgctgttcaa gaccaaccgg aaagtgaccg tgaagcagct 3060 gaaagaggac tacttcaaga aaatcgagtg cttcgactcc gtggaaatct ccggcgtgga 3120 agatcggttc aacgcctccc tgggcacata ccacgatctg ctgaaaatta tcaaggacaa 3180 ggacttcctg gacaatgagg aaaacgagga cattctggaa gatatcgtgc tgaccctgac 3240 actgtttgag gacagagaga tgatcgagga acggctgaaa acctatgccc acctgttcga 3300 cgacaaagtg atgaagcagc tgaagcggcg gagatacacc ggctggggca ggctgagccg 3360 gaagctgatc aacggcatcc gggacaagca gtccggcaag acaatcctgg atttcctgaa 3420 gtccgacggc ttcgccaaca gaaacttcat gcagctgatc cacgacgaca gcctgacctt 3480 taaagaggac atccagaaag cccaggtgtc cggccagggc gatagcctgc acgagcacat 3540 tgccaatctg gccggcagcc ccgccattaa gaagggcatc ctgcagacag tgaaggtggt 3600 ggacgagctc gtgaaagtga tgggccggca caagcccgag aacatcgtga tcgaaatggc 3660 cagagagaac cagaccaccc agaagggaca gaagaacagc cgcgagagaa tgaagcggat 3720 cgaagagggc atcaaagagc tgggcagcca gatcctgaaa gaacaccccg tggaaaacac 3780 ccagctgcag aacgagaagc tgtacctgta ctacctgcag aatgggcggg atatgtacgt 3840 ggaccaggaa ctggacatca accggctgtc cgactacgat gtggaccata tcgtgcctca 3900 gagctttctg aaggacgact ccatcgacaa caaggtgctg accagaagcg acaagaaccg 3960 gggcaagagc gacaacgtgc cctccgaaga ggtcgtgaag aagatgaaga actactggcg 4020 gcagctgctg aacgccaagc tgattaccca gagaaagttc gacaatctga ccaaggccga 4080 gagaggcggc ctgagcgaac tggataaggc cggcttcatc aagagacagc tggtggaaac 4140 ccggcagatc acaaagcacg tggcacagat cctggactcc cggatgaaca ctaagtacga 4200 cgagaatgac aagctgatcc gggaagtgaa agtgatcacc ctgaagtcca agctggtgtc 4260 cgatttccgg aaggatttcc agttttacaa agtgcgcgag atcaacaact accaccacgc 4320 ccacgacgcc tacctgaacg ccgtcgtggg aaccgccctg atcaaaaagt accctaagct 4380 ggaaagcgag ttcgtgtacg gcgactacaa ggtgtacgac gtgcggaaga tgatcgccaa 4440 gagcgagcag gaaatcggca aggctaccgc caagtacttc ttctacagca acatcatgaa 4500 ctttttcaag accgagatta ccctggccaa cggcgagatc cggaagcggc ctctgatcga 4560 gacaaacggc gaaaccgggg agatcgtgtg ggataagggc cgggattttg ccaccgtgcg 4620 gaaagtgctg agcatgcccc aagtgaatat cgtgaaaaag accgaggtgc agacaggcgg 4680 cttcagcaaa gagtctatcc tgcccaagag gaacagcgat aagctgatcg ccagaaagaa 4740 ggactgggac cctaagaagt acggcggctt cgacagcccc accgtggcct attctgtgct 4800 ggtggtggcc aaagtggaaa agggcaagtc caagaaactg aagagtgtga aagagctgct 4860 ggggatcacc atcatggaaa gaagcagctt cgagaagaat cccatcgact ttctggaagc 4920 caagggctac aaagaagtga aaaaggacct gatcatcaag ctgcctaagt actccctgtt 4980 cgagctggaa aacggccgga agagaatgct ggcctctgcc ggcgaactgc agaagggaaa 5040 cgaactggcc ctgccctcca aatatgtgaa cttcctgtac ctggccagcc actatgagaa 5100 gctgaagggc tcccccgagg ataatgagca gaaacagctg tttgtggaac agcacaagca 5160 ctacctggac gagatcatcg agcagatcag cgagttctcc aagagagtga tcctggccga 5220 cgctaatctg gacaaagtgc tgtccgccta caacaagcac cgggataagc ccatcagaga 5280 gcaggccgag aatatcatcc acctgtttac cctgaccaat ctgggagccc ctgccgcctt 5340 caagtacttt gacaccacca tcgaccggaa gaggtacacc agcaccaaag aggtgctgga 5400 cccccaccctg atccaccaga gcatcaccgg cctgtacgag acacggatcg acctgtctca 5460 gctgggaggc gacaaaaggc cggcggccac gaaaaaggcc ggccaggcaa aaaagaaaaa 5520 ggaattcgat agagccgagg gcaggggaag tctactaaca tgcggggacg tggaggaaaa 5580 tcccgggccg atcaagctta tggcaccctg catgctgctc ctgctgttgg cggccgccct 5640 ggccccgact cagacccgcg cgggcccaca ttcgctgagg tatttccaca ccgccgtgtc 5700 ccggcccggc ctcgggaagc cccggttcat ctctgtcggc tacgtggacg acacgcagtt 5760 cgtgcgcttc gacagcgacg cggagaatcc gaggtatgag ccgcgggtgc ggtggatgga 5820 gcaggtggag cccgagtatt gggagcggaa cacgcagatc gccaagggca atgagcagat 5880 tttccgagtg aacctgagga ccgcgctgcg ctactacaac cagagcgcgg gcggctctca 5940 cacgttccaa cggatgtacg gctgtgaggt ggggtcggac tggcgcctcc tccgcgggta 6000 cgagcagtac gcatacgacg gctgcgatta catcgccctg aacgaggacc tgaaaacgtg 6060 gacggcggcc gacatggcgg cgctgatcac caaacacaag tgggagcagg ctggtgatgc 6120 agagagagac cgggcctacc tggagggcac gtgcgtggag tggctccgca gatacctgca 6180 gctcgggaac gcgacgctgc cgcgcacaga ttccccaaag gcccatgtga cccgtcacag 6240 cagacctgaa gataaagtca ccctgaggtg ctgggccctg ggcttctacc ctgctgacat 6300 caccctgacc tggcagttga atggggagga gctgacccag gacatggagc ttgtggagac 6360 caggcctgca ggggatggaa ccttccagaa gtgggcatct gtggtggtgc ctcttgggaa 6420 ggagcagtat tacacatgcc atgtgtacca tcaggggctg cctgagcccc tcaccctgag 6480 atgggagcct cctccatcca ctgtctccaa cacggtaatc attgctgttc tggttgtcct 6540 tggagctgca atagtcactg gagctgtggt ggcttttgtg atgaagatga gaaggagaaa 6600 cacaggtgga aaaggagggt aggaattcta actagagctc gctgatcagc ctcgactgtg 6660 ccttctagtt gccagccatc tgttgtttgc ccctcccccg tgccttcctt gaccctggaa 6720 ggtgccactc ccactgtcct ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt 6780 aggtgtcatt ctattctggg gggtggggtg gggcaggaca gcaaggggga ggattgggaa 6840 gagaatagca ggcatgctgg ggagcggccg caggaacccc tagtgatgga gttggccact 6900 ccctctctgc gcgctcgctc gctcactgag gccgggcgac caaaggtcgc ccgacgcccg 6960 ggctttgccc gggcggcctc agtgagcgag cgagcgcgca gctgcctgca ggggcgcctg 7020 atgcggtatt ttctccttac gcatctgtgc ggtatttcac accgcatacg tcaaagcaac 7080 catagtacgc gccctgtagc ggcgcattaa gcgcggcggg tgtggtggtt acgcgcagcg 7140 tgaccgctac acttgccagc gccctagcgc ccgctccttt cgctttcttc ccttcctttc 7200 tcgccacgtt cgccggcttt ccccgtcaag ctctaaatcg ggggctccct ttagggttcc 7260 gatttagtgc tttacggcac ctcgacccca aaaaacttga tttgggtgat ggttcacgta 7320 gtgggccatc gccctgatag acggtttttc gccctttgac gttggagtcc acgttcttta 7380 atagtggact cttgttccaa actggaacaa cactcaaccc tatctcgggc tattcttttg 7440 atttataagg gattttgccg atttcggcct attggttaaa aaatgagctg atttaacaaa 7500 aatttaacgc gaattttaac aaaatattaa cgtttacaat tttatggtgc actctcagta 7560 caatctgctc tgatgccgca tagttaagcc agccccgaca cccgccaaca cccgctgacg 7620 cgccctgacg ggcttgtctg ctcccggcat ccgcttacag acaagctgtg accgtctccg 7680 ggagctgcat gtgtcagagg ttttcaccgt catcaccgaa acgcgcgaga cgaaagggcc 7740 tcgtgatacg cctattttta taggttaatg tcatgataat aatggtttct tagacgtcag 7800 gtggcacttt tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt 7860 caaatatgta tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa 7920 ggaagagtat gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt 7980 gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt 8040 tgggtgcacg agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt 8100 ttcgccccga agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg 8160 tattatcccg tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga 8220 atgacttggt tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa 8280 gagaattatg cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga 8340 caacgatcgg aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa 8400 ctcgccttga tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca 8460 ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta 8520 ctctagcttc ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac 8580 ttctgcgctc ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc 8640 gtggaagccg cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag 8700 ttatctacac gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga 8760 taggtgcctc actgattaag cattggtaac tgtcagacca agtttactca tatatacttt 8820 agattgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata 8880 atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag 8940 aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa 9000 caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt 9060 ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc 9120 cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa 9180 tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa 9240 gcgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc 9300 ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa 9360 gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa 9420 caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg 9480 ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc 9540 tggccttttg 9600 ctcacatgt 9609

Claims (12)

a DNA sequence represented by any one of SEQ ID NOS: 1 and 2 that encodes sgRNA (small guide RNA); And a Cas9 gene,
A recombinant vector for producing transgenic reproduction pigs resistant to Porcine epidemic diarrhea (PED) virus, which is represented by the nucleotide sequence shown in SEQ ID NO: 4.
The method according to claim 1,
Wherein the Cas9 gene is represented by the nucleotide sequence of SEQ ID NO: 3.
The method according to claim 1,
Said recombinant vector knocking out the APN gene.
delete The method according to claim 1,
Wherein said recombinant vector has a cleavage map as set forth in the following figures.
[Degree]

delete A transformed cell line for the production of a transgenic cloned pig having resistance to a porcine epidemic diarrhea virus to which the recombinant vector of any one of claims 1, 2, 3 and 5 has been introduced.
8. The method of claim 7,
Wherein said cell line is a marrow cell line, fibroblast cell line, or kidney cell line.
Transplanting the transformed cell line of claim 7 into an enucleated porcine oocyte to form a nuclear transfer embryo; And
And transplanting said nuclear transfer embryos into the fallopian tubes of a surrogate mother pig.
Transgenic cloned pigs resistant to porcine epidemic diarrhea virus produced by the method of paragraph 9.
11. The method of claim 10,
Wherein the transgenic cloned pig is an APN gene knockout.
delete

Images