CN108949690B

CN108949690B - A method of prepare can real-time detection mescenchymal stem cell bone differentiation cell model

Info

Publication number: CN108949690B
Application number: CN201810784678.1A
Authority: CN
Inventors: 李程; 鲍烈明; 丁秋蓉
Original assignee: Hangzhou View Health Technology Co Ltd
Current assignee: Hangzhou View Health Technology Co Ltd
Priority date: 2018-07-17
Filing date: 2018-07-17
Publication date: 2019-08-13
Anticipated expiration: 2038-07-17
Also published as: CN108949690A

Abstract

Present disclose provides it is a kind of prepare can the differentiation of real-time detection mescenchymal stem cell bone cell model method, this method comprises the following steps: S1, will be mixed to form RNP compound for sgRNA the and Cas9 albumen for knocking in site of bone differentiation associated gene；S2, AAV virion to be transfected is formed；S3, the suspension of stem cell is mixed to the suspension of the RNP compound and is carried out electricity turn, obtain the culture after electricity turns；S4, culture of the suspension of AAV virion to be transfected to be transfected, after being transfected is added into the material after the electricity turn；S5, monoclonal culture will be carried out after the culture Method of Limited Dilution after the transfection, pass through PCR and sequencing and filtering out and carried out gene and orient the monoclonal cell strain knocked in.Through the above technical solutions, the present invention may be implemented in stem cell drugs preparation process, the Osteoblast Differentiation state of the cell of real-time monitoring continuous passage.

Description

A method of prepare can real-time detection mescenchymal stem cell bone differentiation cell model

Technical field

This disclosure relates to field of biotechnology, and in particular, to a kind of prepare can real-time detection mescenchymal stem cell bone point The method of the cell model of change.

Background technique

Mescenchymal stem cell (MSCs) has extensive bed application prospect as the target cell that a kind of novel gene is treated, Advantage is as follows: (1) it is from a wealth of sources, it can be obtained from self or allosome, belong to homograft, be not related to ethics problem；(2) it is easy to Culture has proliferative capacity, and inside and outside keeps multi-lineage potential；(3) have site of tissue damage of going back to the nest, secretion a large amount of The ability of cell factor.But it is current the study found that the individual difference of donor, differentiation caused by the difference at age of drawing materials are latent The difference of energy constrains clinical application of the mescenchymal stem cell as cell transplantation drug.Amplification how is passed in vitro and is divided The differentiation state of monitoring MSCs also becomes difficult point and bottleneck in stem cell industry Quality Control in time during changing.

CRISPR gene editing technology forms DNA double by carrying out accurate targeting shearing in genome specific site Chain notch (Double-strand breaks, DSBs) links (Non-homologous by intracellular nonhomologous end End joining, NHEJ) realize to the knockout of gene in situ, by homologous recombination (Homology directed repair, HDR) in the presence of external source gene template, introducing and reparation and large fragment gene (such as report base of point mutation are realized Cause) insertion.As described in patent document CN105985985A, slow virus is constructed using CRISPR/Cas9 system, to umbilical cord Immunizing antigen B2M, inflammatory factor TNF-α in the MSCs in source are knocked out, and are done carefully to realize and reduce allosome mesenchyma The purpose of born of the same parents' immunogenicity.But in mammalian cells, NHEJ revision points account for dominant pattern, realize gene knockout than real Existing gene knock-in is easy very much.And the segment of gene knock-in is bigger, it is lower to integrate probability, and technology is realized more difficult.At present still It there are no the report that large fragment gene knock-in is carried out in MSCs.

Summary of the invention

The purpose of the disclosure is to realize that providing can fill between real-time detection to the real-time detection of mescenchymal stem cell bone differentiation The cell model of matter stem cell bone differentiation is to carry out drug screening.

To achieve the goals above, present disclose provides it is a kind of prepare can real-time detection mescenchymal stem cell bone differentiation The method of cell model, this method comprises the following steps: S1, by for bone differentiation associated gene the sgRNA for knocking in site and Cas9 albumen is mixed to form RNP compound；The bone differentiation associated gene include SPP1, COL1A1, BMP-2, Runx2, At least one of SLP1, IBSP and BGLAP；The site of knocking in of the bone differentiation associated gene is that the bone breaks up dependency basis Between the last sense codon and terminator codon of cause；S2, it will be packaged into inserted with template DNA homologous recombination vector In AAV virus, AAV virion to be transfected is formed；The template DNA includes knocking in for the bone differentiation associated gene The left homology arm sequence and right homology arm sequence in site, are inserted between the left homology arm sequence and the right homology arm sequence There are self cleavage 2A peptide-coding sequence and fluorescent protein report gene, so that orientation, which forms coding after knocking in, breaks up correlation by bone The fusion for the fusion protein that gene, 2A peptide and fluorescin are connected in series；S3, by the suspension of mescenchymal stem cell and institute The suspension for stating RNP compound, which mixes and carries out electricity, to be turned, and the culture after electricity turns is obtained；S4, electricity turn after 1-30 minutes It is interior, the suspension of AAV virion to be transfected is added to carry out transfection in 4-30 hours in the material after turning to the electricity, obtains Culture after to transfection；S5, monoclonal culture will be carried out after the culture Method of Limited Dilution after the transfection, and pass through PCR And sequencing filters out and has carried out the monoclonal cell strain that gene orientation is knocked in.

Through the above technical solutions, the present invention, which establishes one kind, efficiently to knock in long segment report in mescenchymal stem cell The method of gene, it is in situ to be inserted into reporter gene in the case where not influencing the expression of bone differentiation associated gene, it is possible thereby to construct A variety of cell models relevant to the differentiation of mescenchymal stem cell bone, and may be implemented in turn in stem cell drugs preparation process In, the cell Osteoblast Differentiation state of real-time monitoring continuous passage, and the mescenchymal stem cell of preparation can be detected in animal model Drug migrates to internal different tissues, in the tissue microenvironment that disease or bone break up, the cell factor of tissue specificity and Whether unwanted metabolic products, which will affect the bone of mescenchymal stem cell in vivo, is broken up and influences time-to-live and function in cell body Can, convenient for furtheing investigate to action time in mescenchymal stem cell body with validity, promote its clinic conversion and industry Metaplasia produces the quality-monitoring in preparation.

Other feature and advantage of the disclosure will the following detailed description will be given in the detailed implementation section.

Specific embodiment

The specific embodiment of the disclosure is described in detail below.It should be understood that described herein specific Embodiment is only used for describing and explaining the disclosure, is not limited to the disclosure.

Present disclose provides it is a kind of prepare can real-time detection mescenchymal stem cell bone differentiation cell model method, should Method includes the following steps: S1, will mix for sgRNA the and Cas9 albumen for knocking in site of bone differentiation associated gene with shape At RNP compound；The bone differentiation associated gene includes in SPP1, COL1A1, BMP-2, Runx2, SLP1, IBSP and BGLAP At least one；The bone differentiation associated gene knock in site be the bone differentiation associated gene the last ariyoshi it is close Between numeral and terminator codon；S2, it will be packaged into AAV virus, be formed wait turn inserted with template DNA homologous recombination vector Contaminate AAV virion；The template DNA includes the left homology arm sequence for knocking in site for the bone differentiation associated gene With right homology arm sequence, inserted with self cleavage 2A peptide code sequence between the left homology arm sequence and the right homology arm sequence Column and fluorescent protein report gene, so that orientation forms coding by bone differentiation associated gene, 2A peptide and fluorescin after knocking in The fusion for the fusion protein being connected in series；S3, the suspension of mescenchymal stem cell and the suspension of the RNP compound are mixed Merge and carry out electricity turn, obtains the culture after electricity turns；S4, object after electricity turns in 1-30 minutes, after turning to the electricity Culture of the suspension of AAV virion to be transfected to carry out transfection in 4-30 hours, after being transfected is added in material；S5, Monoclonal culture will be carried out after culture Method of Limited Dilution after the transfection, and is filtered out by PCR and sequencing and carried out base The monoclonal cell strain knocked in by orientation.

SgRNA and Cas9 albumen is transferred in cell in such a way that electricity turns by the present invention RNP compound, and is turned in electricity The homologous recombination vector inserted with fluorescent protein report gene is transfected into cell by selection AAV virus in the suitable time afterwards In, come sgRNA, Cas9 albumen and the carrier inserted with template DNA commonly through CRISPR gene editing so that big The foreign gene of segment is able to orientation and knocks in target position.

Wherein, the bone differentiation gene is defined with Gene Symbol in ncbi database, and specifying information is such as Shown in table 1, corresponding representativeness sgRNA sequence and left and right homology arm sequence are also shown in Table 1 below.Preferably, the sgRNA As shown in SEQ ID NO.1,4,7,10,13,16 or 19；Correspondingly, left homology arm sequence such as SEQ ID NO.2,5,8, 11, shown in 14,17 or 20；Correspondingly, right homology arm sequence as shown in SEQ ID NO.3,6,9,12,15,18 or 21

Table 1

Wherein, optionally, the sgRNA has chemical modification group；The chemical modification group is preferably methyl chemistry Modification group or phosphorothioate chemical modification group；For sgRNA the and Cas9 albumen of knocking in site of bone differentiation associated gene Dosage molar ratio is 1:1 to 1:5.Wherein it is possible to use online sgRNA design tool (http://crispr.mit.edu/) The sequence for knocking in site design sgRNA of foundation bone differentiation associated gene is simultaneously synthesized.Wherein, sgRNA sequence 5 ' end and 3 ' ends end can be changed added with methyl (- O-Me) chemical modification group or phosphorothioate (- phosphorothioate) respectively Learn modification group.

Wherein, optionally, will for bone differentiation associated gene knock in site sgRNA and Cas9 albumen mix when Between be 5-20 minute, temperature be 10-40 DEG C.

Wherein, optionally, in step S3, when the suspension of the mescenchymal stem cell is mixed with the RNP compound, phase For every 10⁶A mescenchymal stem cell, with the meter of sgRNA, the dosage of the RNP compound is 1-50 μm of ol；It is described In the suspension of mescenchymal stem cell, cell concentration is (1-5) × 10⁷A/mL；With the meter of sgRNA, the RNP compound Final concentration of 0.1-1.5 μm of ol/ μ L.

Wherein, optionally, in step S3, the condition that electricity turns includes: that electric field strength is 50-250V/cm, when single pulse Between be 2-15ms, the time interval between adjacent two subpulse is 10-60s, and total pulses are 2-10 times.

Wherein, optionally, it in step S4, after electricity turns in 5-20 minutes, is added in the material after turning to the electricity Culture of the suspension of AAV virion to be transfected to carry out transfection in 8-24 hours, after being transfected.

Wherein, optionally, in step S4, the additional amount of the suspension of AAV virion to be transfected makes to be transfected The MOI value of AAV virion is 10⁴-10⁶.The ratio of virus and cell quantity when MOI value is infection.

Wherein it is preferred to which the mescenchymal stem cell is mesenchymal stem cell, fat mesenchymal stem cell, umbilical cord Mescenchymal stem cell, palace blood mescenchymal stem cell and dental pulp mescenchymal stem cell.The serotype of the AAV virus is AAV-6 disease Poison, AAV-1 virus or AAV9 virus, the serotype of the preferably described AAV virus are AAV9 virus, can under the preferable case Further increase the efficiency of large fragment gene knock-in stem cell.

Wherein, the self cleavage 2A peptide is for cutting the albumen of bone differentiation associated gene and fluorescin open, can be with For at least one of T2A peptide, F2A peptide and P2A peptide；The selection of the fluorescent protein report gene can be wider, such as can be with For at least one of EGFP, ECFP, EYFP, GFP, RFP, mCherry, tdTomato and Venus.

Wherein, optionally, the sequence of the fluorescent protein report gene is as shown in SEQ ID NO.24；The carrier Frame sequence is as shown in SEQ ID NO.25.The frame sequence of the carrier refers to the sequence for being not inserted into the carrier of template DNA.

Present invention be described in more detail by the following examples:

Embodiment 1

EGFP reporter gene is inserted into building in fat mesenchymal stem cell (ADSC cell) osteopontin gene (SPP1) Cell model.Using SPP1 gene original position gene promoter, T2A-EGFP is inserted into before terminator codon.

1, sgRNA design and synthesis

(1) aobvious for 8 extra of SPP1 gene by online sgRNA design tool (http://crispr.mit.edu/) Son designs the sgRNA of targets identification in the sequence within terminator codon (TAA) upstream 100bp, and preferred result is as follows: SPP1sgRNA:5’- gguuguagaccccaaaaguaguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccg uuaucaa cuugaaaaaguggcaccgagucggugcuuuuuuu-3'(SEQ ID NO.1).Wherein 1-20 sequences To identify motif, remaining sequence is tracrRNA.

(2) sgRNA is synthesized and by Integrated Dna Technologies.USA company in the sgRNA sequence Repairing for O-Me, phosphorothioate is added respectively on No. two positions of three bases at 5 ' ends and 3 ' end ends and third place Decorations.

2, the activity of in vitro method detection sgRNA

(1) genome amplification identification target sequence segment (1144bp), primer are limited by giving birth to work bioengineering (Shanghai) share Company's synthesis.

SPP1-FW:5 '-gtaacatgctagtattatttcagc-3 ' (SEQ ID NO.22),

SPP1-REV:5’-aacaaaacatcacaccgtacc-3’(SEQ ID NO.23)。

(2) pcr amplification product 200ng, sgRNA 100ng, SpCas9 200ng (are purchased from Sigma-Aldrich, goods Number: TGEN-CP-500UG), 10 × buffer, 2 μ L is configured to 20 μ L reaction systems.Reaction system keeps the temperature one hour at 37 degree, One hour is kept the temperature at 70 degree.

(3) using TAE configuration 1% BioWest agarose gel, the electrophoresis 30min under the voltage of 90V, using gel at As instrument observes result.

3, the selection of AAV packaging system and plasmid construction

(1) cell to be edited is human adipose mesenchymal stem cells (ADSC cell), according to the AAV tissue affinity table of comparisons, It is preferred that serotype is the packaging system of AAV-9.

(2) the overall package capacity of AAV-9 is 4.7Kb.The segment being inserted into the carrier loaded of AAV packaging system is answered Comprising left homology arm (500bp or so), Insert Fragment and right homology arm (500bp or so).

Left homology arm sequence is SEQ ID NO.2, wherein 433-435 bit base is the site PAM by mutation.

Right homology arm sequence is SEQ ID NO.3.

Insert Fragment is T2A and EGFP, and total 777bp, sequence is as shown in SEQ ID NO.24.Using it is seamless clone (High-fidelity DNA assemble kit, be purchased from NEB (Beijing) Co., Ltd, article No.: E2621S) method will Cassette is inserted on pAAV carrier, and carrier sequence is SEQ ID NO.25.In order to avoid SpCas9/sgRNA RNP is compound Object influences the efficiency of gene editing on the secondary cut of recombination site, passes through PrimerStar high-fidelity DNA polymerase (being purchased from precious bioengineering (Dalian) Co., Ltd, article No.: R044A) is introduced a little using the method that PCR carves ring in the site P AM It is mutated (TGG sports TCG), the cutting so as to avoid SpCas9/sgRNA RNP compound to recognition site.Point mutation is drawn Object is synthesized by Sangon Biotech (Shanghai) Co., Ltd..

SPP1-PAM-mut-FW:5’-gtagaccccaaaagtaaagaagaagataaacacct-3’(SEQ I D NO.26)。

SPP1-PAM-mut-REV:5’-aggtgtttatcttctttacttttggggtctac-3’(SEQ ID NO. 27)。

4, AAV virus packaging and purifying

(1) virus packaging on the day before by HEK293T cell according to every ware 5 × 10⁶Quantity plant to diameter 10cm's Containing 10mL complete medium (DMEM+10%FBS+1%P/S is dual anti-), (DMEM culture medium, is purchased from ThermoFisher Scientific, Inc., article No.: C11995500BT；FBS, is purchased from ThermoFisher Scientific, Inc., article No.: sv30087.02；P/S is dual anti-, is purchased from ThermoFisher Scientific, Inc., article No.: SV30010) CORNING training It supports in ware, plants 30 wares altogether.In 37 degree, 5%CO₂Cell incubator in cultivate 24 hours.

(2) the virus packaging same day checks whether HEK293T cell confluency degree reaches 80%.Every ware is single according to the following steps Solely configure rotaring redyeing system: by the pAAV-Cassette of 10 μ g, use is without blood after the pAAV9 mixing of the pHelper of 10 μ g, 10 μ g It is mixed after clear DMEM adjustment volume to 910 μ L through vortex oscillator, the PEI that 90 μ L are added (is purchased from Polysciences Asia Pacific, Inc., article No.: 23966-2) after reuse vortex oscillator mixing, stand 15 minutes.By CORNING Complete medium in culture dish is substituted for 9mL serum free medium, then will be equal by the DNA-PEI compound stood before It is even to be added drop-wise in culture dish, it softly shakes and even is placed on 37 degree, 5%CO₂Cell incubator in cultivate 6 hours.It will after transfection 6h Serum free medium in CORNING culture dish is substituted for complete medium, in 37 degree, 5%CO₂Cell incubator relaying Continuous culture.

(3) after transfection 60 hours, supernatant cell is harvested respectively.

Obtained supernatant will be collected and discard impurity after ten minutes through 4 degree of centrifugations of 4000rpm.It will go on deimpurity to reset and add Enter Amicon Ultra-15 and surpass and (be purchased from Merck Chemical Engineering Technology (Shanghai) Co., Ltd., article No.: UFC 905096) from column, passes through Volume concentration to 10 was arrived into 15mL in centrifugation 30 minutes after 4000rpm several times, 4 degree.The HEK293T that will be scraped with cell scraper Cell blows even and is transferred in 50mL centrifuge tube with appropriate culture medium, abandons supernatant after 1500rpm, 4 degree of centrifugation 10min, owns Precipitating is in total plus 3mL cell lysis buffer solution (150mM NaCl, 20mM tris pH8.0) makes its resuspension.Cell will be resuspended Multigelation is three times in -80 DEG C of alcohol baths and 37 DEG C of water-baths.The cell suspension of the supernatant freeze thawing of concentration is mixed, addition 1M MgCl₂To final concentration of 1mM.Addition Benzonase (it is purchased from Merck Chemical Engineering Technology (Shanghai) Co., Ltd., article No.: 70746-1kU) to final concentration of 25U/mL, 37 DEG C of reaction 40min after mixing.Take out 50mL centrifuge tube, 4 DEG C, 4000rpm from Heart 20min, takes supernatant.

(4) Sigma-Aldrich (is purchased from, article No.: D1556- using Iodixanol density-gradient centrifugation method purified virus 250mL).Configure Iodixanol gradient 17%:5mL 10 × PBS, 0.05mL 1M MgCl₂,0.125mL 1M KCl,10mL 5M NaCl, 12.5mL Optiprep, adds water to supply 50mL.25%:5mL 10 × PBS, 0.05mL 1M MgCl₂, 0.125mL 1M KCl, 20mL Optiprep, 0.1mL 0.5%phenol red, adds water to supply 50mL.40%:5mL 10 ×PBS, 0.05mL 1M MgCl₂, 0.125mL 1M KCl, 33.3mL Optiprep adds water to supply 50mL.60%: 0.05mL 1M MgCl₂, 0.5% phenol red of 0.125mL 1M KCl, 50mL Optiprep, 0.025mL.To hypervelocity The iodine gram sand of 3.5mL 60%, 3.5mL 40%, 4mL 25%, 4mL 17% are successively slowly added in centrifuge tube from the bottom to top Alcohol.The supernatant cell pyrolysis liquid of concentration is slowly added in centrifuge tube top layer, fills centrifuge tube with cell lysis buffer solution. Angle rotor is determined using Beckman L-80XP landing ultracentrifuge, 70Ti, accelerates 6, and 4 degree of 9,60000rpm centrifugations 2 of slowing down are small When.40% concentration layer Iodixanol is drawn with tack syringe, Amicon Ultra-15 is transferred to and surpasses from column, be added 4 DEG C of 10mL PBS 4000rpm are centrifuged 20 minutes, are repeated 3 times.By viral centrifugal concentrating to 1mL.

(5) titre detection is carried out to AAV9 using qPCR.According to EGFP primers, make the length of qPCR product About 200bp.QPCR primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd..

AAVGFPF:5’-tcagcttcaggcaccaccac-3’(SEQ ID NO.28)。

AAVGFPR:5’-tgaacttgtggccgtttacgtcg-3’(SEQ ID NO.29)。

7 AAV9 recombinant plasmid standard items are prepared, gradient dilution is carried out with the ratio of 1:10.It is below dense from 10ng/ μ L Degree start to dilute, respectively 10ng/ μ L, 1ng/ μ L, 0.1ng/ μ L, 0.01ng/ μ L, 0.001ng/ μ L, 0.0001ng/ μ L and 0.00001ng/μL。

Diluted DNA copy number is calculated according to the following formula:

Virus Sample is pre-processed using DNase (it is purchased from precious bioengineering (Dalian) Co., Ltd, article No.: 2270A).Matched using 2 × SYBR PCR mix (be purchased from Japan and spin (Shanghai) Biotechnology Co., Ltd, article No.: QPS-201) Set qPCR reaction system.Use Roche480II real-time fluorescence quantitative PCR system carries out quantitative PCR. According to Ct value, standard curve is drawn, and calculates the titre of AAV9.

5, the assembling of RNP compound and the pretreatment of cell to be edited

(1) by SpCas9 (final concentration 300ug/ml) and SPP1sgRNA (final concentration 175ug/ml) according to mole of 1:3 Than carrying out being blended in incubation at room temperature 10min, to form SpCas9/sgRNA RNP compound.

(2) observation fat mesenchymal stem cell, which converges rate and reaches 80%, moves back except the DMEM/F12 culture medium containing 10%FBS (it is purchased from ThermoFisher Scientific, article No.: 11320082) Inc., is rinsed primary with PBS.0.05% pancreas is added Enzyme (being purchased from ThermoFisher Scientific, Inc., article No.: 25200-072) is allowed to that ware bottom is completely covered.37 DEG C of incubations Stop digestion after 3-5 minutes, sucks pancreatin.At once fresh DMEM/F12 complete medium is added, is blown and beaten with 1mL rifle sector Culture dish bottom, the stem cell colonies for attaching ware/bottom of bottle fall off, and soft slowly pressure-vaccum mixes, and stem cell suspension is made.It uses Blood counting chamber counts cell density.It (is purchased from using Opti-MEM (magnesium chloride of ATP, 23.6mM of 14.5mM) Article No.: 11058021) ThermoFisher Scientific, Inc. adjust cell density to 5 × 10⁷/mL。

(3) by 10 μ L by incubation at room temperature SpCas9/sgRNA SNP compound (with the meter of sgRNA, the RNP The content of compound is 7.5 μm of ol) and 10 μ L by counting and using the fat mesenchymal stem cell suspension of Opti-MEM resuspension (wherein cell quantity is 5 × 10⁵It is a) it mixes, 20 μ L mixed liquors are transferred in 16 hole electricity rotating plate items.Use Lonza 4D Nuclear transfection Systematic selection CB150 mode (electric field strength 150V/cm, the single pulse time be 10ms, adjacent two subpulse it Between time interval be 20s, total pulses be 5 times) carry out electricity turn.Cell is transferred to containing DMEM/ by electricity at once after the completion of turning In 37 degree, 5%CO in 24 orifice plates of F12 complete medium₂Cell incubator in continue to cultivate.

(4) electricity has turned to start in the 5 to 20th minute according to 1 × 10⁵MOI value be gently added dropwise AAV9, and turned in electricity It is added dropwise in 20 minutes.

(5) electricity removes old culture medium after having turned 24 hours, is changed to DMEM/F12 complete medium.

6, the culture of monoclonal cell strain:

(1) electricity has turned to rinse a culture dish using PBS on the 48th hour.Pancreatin is added to be allowed to that ware bottom is completely covered.37℃ Stop digestion after being incubated for 3-5 minutes, sucks pancreatin.At once fresh DMEM/F12 complete medium is added, it is fan-shaped with 1mL rifle Culture dish/bottom of bottle is blown and beaten, the stem cell colonies for attaching ware bottom fall off, and soft slowly pressure-vaccum mixes, and guarantee that iuntercellular does not glue Even, stem cell suspension is made.Cell density is counted using blood counting chamber.It is thin by 15000, each 10cm culture dish The ratio of born of the same parents in the 10cm CORNING culture dish of cell seeding to the complete medium containing DMEM/F12 in 37 degree, 5%CO₂ Cell incubator in continue to cultivate.

(2) it is observed and is removed old culture medium within every 24 hours, be changed to new DMEM/F12 complete medium.72 It can be in microscopic observation to the formation of clone after hour.

(3) 12 to 14 days sizes that can see clone under ten times of object lens have been equivalent to a coin after electricity turns. Clone cannot be allowed to continue to become larger or intersect.120 μ L DMEM/F12 complete mediums are added in each hole on 96 orifice plates, Marking plate O.It is observed in super-clean bench by microscope, P200 pipettor is adjusted to 45 μ L and uses the rifle with filter core Head scrapes broken clone, collects cell with pipettor and is transferred in the aperture of 96 orifice plates.

(4) old culture medium is removed after every 24 hours after clone's picking, is changed to new DMEM/F12 and cultivates completely Base, cell confluency rate reaches 80% after four days.

(5) 133 μ L DMEM/F12 complete mediums are added in each hole on two piece of 96 orifice plate, are respectively labeled as plate A, plate B.Every hole of plate O is rinsed using the PBS of 150 μ L.The pancreatin of 35 μ L, digestion 5 to every hole after ten minutes are added in every hole The DMEM/F12 complete medium of 165 μ L of middle addition.The cell suspension for pipetting 66 μ L respectively from hole is transferred to plate A's and plate B In respective apertures.Plate A is extracted for genome, and plate B is spare.The cell cryopreservation of 165 μ L is directly added in each hole of plate O It is stored after liquid as profound hypothermia refrigerator.

Embodiment 2

Building insertion EGFP report in fat mesenchymal stem cell (ADSC cell) I-type collagen gene (COL1A1) Accuse the cell model of gene.Using COL1A1 gene original position gene promoter, 2A-EGFP is inserted into before terminator codon.

By online sgRNA design tool (http://crispr.mit.edu/) in 51 exon of COL1A1 gene The sgRNA of targets identification is designed in the sequence within terminator codon (TAA) upstream 100bp.

COL1A1sgRNA:5 '-uggggcaccaacguccaaggguuuuagagcuagaaauagcaag uuaaaauaa ggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu-3’。(S EQ ID NO.4)。

Wherein 1-20 sequences are identification motif, remaining sequence is tracrRNA.

The sgRNA is synthesized by Integrated DNA Technologies.USA company and at the 5 ' end and 3 ' ends of sequence The modification of addition -2-O-Me, -3-ph osphorothioate respectively on No. two positions of three bases at end and third place.

2, the activity of in vitro method detection sgRNA

(1) target sequence segment (1084bp) is identified from genome amplification, primer is had by giving birth to work bioengineering (Shanghai) share The synthesis of limit company.

COL1A1-FW:5 '-ccctgcagttcgagtatgg-3 ', (SEQ ID NO.30),

COL1A1-REV:5 '-gcagtctgagaaccccagg-3 ', (SEQ ID NO.31).

3, the selection of AAV packaging system and plasmid construction

(1) cell to be edited is fat mesenchymal (ADSC) stem cell strain, according to the AAV tissue affinity table of comparisons, preferably Serotype is the packaging system of AAV9.

(2) the overall package capacity of AAV9 is 4.7Kb.The segment being inserted into the carrier loaded of AAV packaging system should wrap Containing left homology arm (500bp or so), Insert Fragment and right homology arm (500b p or so).Left homology arm sequence is SEQ ID NO.5, wherein 436-438 bit base is by the site PAM of mutation, right homology arm sequence is SEQ ID NO.6.It is inserted into piece Section is T2A and E GFP, and total 777bp, sequence is as shown in SEQ ID NO.24.Using it is seamless clone ( Gao Bao True DNA assembles kit, is purchased from NEB (Beijing) Co., Ltd, article No.: E2621S) method Cassette is inserted into pAAV On carrier, carrier sequence is SEQ ID NO.25.In order to avoid SpCas9/sgRNA RNP compound is to the secondary of recombination site Cutting (it is (big to be purchased from precious bioengineering to influence the efficiency of gene editing, by PrimerStar high-fidelity DNA polymerase Even) Co., Ltd, article No.: R044A) using the method that PCR carves ring in the site PAM introducing point mutation, (T GG is sported TCG), the cutting so as to avoid SpCas9/sgRNA RNP compound to recognition site.Point mutation primer is by giving birth to work biology work The synthesis of journey (Shanghai) limited liability company.

COL1A1-PAM-mut-FW:5’-cccatcatcgatgtggcacccttggacgttggtgc-3’(SEQ ID NO.32)。

COL1A1-PAM-mut-REV:5’-gcaccaacgtccaagggtgccacatcgatgatggg-3’ (SEQ ID NO.33)。

4, AAV virus packaging and purifying

With embodiment 1

5, the assembling of RNP compound and the pretreatment of cell to be edited

With embodiment 1

6, Lonza 4D system electricity turns and AAV infects

With embodiment 1

7, the culture of monoclonal cell strain

With embodiment 1

Comparative example 1

It carries out according to the method for embodiment 1, the difference is that electricity has turned 35min and started according to 1 × 10⁵MOI gently AAV9 is added dropwise, and has turned to be added dropwise in 50 minutes in electricity.

Testing example 1

1, fluorescence detection allele is inserted into Efficiency testing

Test sample: embodiment 1,2 and comparative example 1 by electricity turn and AAV infection after the 4th day after pancreatin digests Fresh DMEM/F12 complete medium, which is added, makes it that manufactured stem cell suspension be resuspended.

Detection method: because the T2A-EGFP sequence expressing green fluorescent protein being inserted on target gene seat, uses stream Formula cell instrument detects and counts the cell quantity that can issue green fluorescence and cell total amount.The thin of green fluorescence will be issued Born of the same parents' quantity is divided by the available total editorial efficiency of cell total amount.

Experimental result: 1 editorial efficiency of embodiment is 79.4%, and 2 editorial efficiency of embodiment is 75.3%, and comparative example 1 is edited Efficiency is 9.5%.

2, PCR detects allele and is inserted into efficiency

Test sample: the monoclonal cell strain (A plate and B plate) of 96 orifice plate cultures

Detection method: the design primer outside homology arm.Primer is closed by Sangon Biotech (Shanghai) Co., Ltd. At.

Embodiment 1, comparative example 1 use SPP1-FW, SPP1-REV.Embodiment 2 uses COL1A1-FW, COL1A1-REV.

Clone's genome obtained in 96 orifice plates is subjected to PCR amplification.PCR product is subjected to electrophoresis and is analyzed.It is real Applying example 1, comparative example 1 only 1144bp or so band is non-editor's cell, and only 1921bp is that diallele editor is thin Born of the same parents, it is monoallelic editor's cell that existing 1144bp or so band, which also has 1921bp,.It marks respectively and counts these three types of volumes Collect the ratio of type.There was only 1084bp or so band in embodiment 2 is non-editor's cell, and only 1861bp is double equipotentials Gene editing cell, it is monoallelic editor's cell that existing 1084bp or so band, which also has 1861bp,.

Experimental result: 1 editorial efficiency of embodiment: allele double editors 62.3%, allele list editor 18.1%, 1 editorial efficiency of comparative example: allele double editors 0.5%, allele list editor 0.8%；2 editorial efficiency of embodiment: equipotential Gene Double editor 68.5%, allele list editor 15.5%；It can be seen that electricity turns the time interval with virus transfection to gene knock-in Efficiency be affected, preferably electricity turn after 5-20 minute in, to it is described electricity turn after material in be added it is to be transfected In the case that the suspension of AAV virion is to carry out transfection in 8-24 hours, the efficiency highest of gene knock-in.

3, constructed cell model induces lower caused cell bone differentiation detection in vitro

By the fat mesenchymal stem cell cover plant that EGFP is knocked in of having carried out of obtaining of embodiment 1 in 6 orifice plates, replace within the 2nd day For osteogenic induction liquid (10mmol/L β-phosphoglycerol (being purchased from Sigma-Aldrich, article No.: G9422), 1 × 10^-7Mol/L Sai meter Song (being purchased from Sigma-Aldrich, article No.: D4902), 50 μ g/mL ascorbic acid (be purchased from Sigma-Aldrich, article No.: PHR1008), every hole total volume is 2mL.The 1 osteogenic induction liquid of replacement in every 3 days.Induction the 0th day, 9 days, 12 days, 15 days, Successively collect treated cell within 18 days, 27 days.Will collection cell it is fixed after carry out immunocytochemical stain (primary antibody be Anti-Osteopontin is purchased from Ai Bokang (Shanghai) trade Co., Ltd, article No.: ab69498, corresponding fluorescence secondary antibody are Goat anti-Mouse IgG(H+L)Highly Cross-Adsorbed Secondary Antibody,Alexa Fluor Plus 555 is purchased from ThermoFisher Scientific, Inc., article No.: A-21424).Cell after dyeing is made respectively With confocal laser scanning microscope green fluorescence channel and red fluorescence channel, finally figure layer merge (coincidence) is carried out afterwards Compare.The results are shown in Table 2.

The external evoked lower cell bone differentiation state detection of table 2

Above-mentioned table 2 the results show that the model established in embodiment 1 can will not cell death in the case where, in real time examine Survey the cell bone differentiation under induction.The expression of SPP1 gene is one of the mark of bone cell differentiation maturation.Routine immunochemistry Method detection SPP1 gene expression, the fat mesenchymal stem cell that the EGFP constructed in embodiment 1 is knocked in is in Osteoblast Differentiation The result of real-time green fluorescence detection is consistent with the result that immunocytochemistry detects in the process.

Embodiment 2 is operated with embodiment 1, only needs to replace primary antibody accordingly are as follows: Anti-Collagen I is purchased from Ai Bo Anti- (Shanghai) trade Co., Ltd, article No.: ab90395.The results are shown in Table 3.

The external evoked lower cell bone differentiation state detection of table 3

Above-mentioned table 3 the results show that the model established in embodiment 2 can will not cell death in the case where, in real time examine Survey the cell bone differentiation under induction.The expression of COL1A1 gene is one of the mark of bone cell differentiation maturation, routinely uses immunization Method detects the expression of COL1A1 gene, and the fat mesenchymal stem cell that the EGFP constructed in embodiment 1 is knocked in is in skeletonization The result of real-time green fluorescence detection is consistent with the result that immunocytochemistry detects in atomization.

The preferred embodiment of the disclosure is described in detail above, still, during the disclosure is not limited to the above embodiment Detail a variety of simple variants can be carried out to the technical solution of the disclosure in the range of the technology design of the disclosure, These simple variants belong to the protection scope of the disclosure.

It is further to note that specific technical features described in the above specific embodiments, in not lance It in the case where shield, can be combined in any appropriate way, in order to avoid unnecessary repetition, the disclosure is to various No further explanation will be given for possible combination.

In addition, any combination can also be carried out between a variety of different embodiments of the disclosure, as long as it is without prejudice to originally Disclosed thought equally should be considered as disclosure disclosure of that.

Sequence table

<110>Hangzhou Guan Zi health Science and Technology Ltd.

<120>it is a kind of prepare can real-time detection mescenchymal stem cell bone differentiation cell model method

<130> 10970-K-HZGZ

<160> 33

<170> SIPOSequenceListing 1.0

<210> 1

<211> 103

<212> RNA

<213>artificial sequence (Artificial Sequence)

<400> 1

gguuguagac cccaaaagua guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu uuu 103

<210> 2

<211> 500

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

agtataagat gacctaaaag ctagagagtg gaaaaggatt accatattcc catccctagc 60

cgttcatata attattcttc atttgtgccg tgattcagta ccctgatgct acagacgagg 120

acatcacctc acacatggaa agcgaggagt tgaatggtgc atacaaggcc atccccgttg 180

cccaggacct gaacgcgcct tctgattggg acagccgtgg gaaggacagt tatgaaacga 240

gtcagctgga tgaccagagt gctgaaaccc acagccacaa gcagtccaga ttatataagc 300

ggaaagccaa tgatgagagc aatgagcatt ccgatgtgat tgatagtcag gaactttcca 360

aagtcagccg tgaattccac agccatgaat ttcacagcca tgaagatatg ctggttgtag 420

accccaaaag taaagaagaa gataaacacc tgaaatttcg tatttctcat gaattagata 480

gtgcatcttc tgaggtcaat 500

<210> 3

<211> 500

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

aaggagaaaa aatacaattt ctcactttgc atttagtcaa aagaaaaaat gctttatagc 60

aaaatgaaag agaacatgaa atgcttcttt ctcagtttat tggttgaatg tgtatctatt 120

tgagtctgga aataactaat gtgtttgata attagtttag tttgtggctt catggaaact 180

ccctgtaaac taaaagcttc agggttatgt ctatgttcat tctatagaag aaatgcaaac 240

tatcactgta ttttaatatt tgttattctc tcatgaatag aaatttatgt agaagcaaac 300

aaaatacttt tacccactta aaaagagaat ataacatttt atgtcactat aatcttttgt 360

tttttaagtt agtgtatatt ttgttgtgat tatctttttg tggtgtgaat aaatctttta 420

tcttgaatgt aataagaatt tggtggtgtc aattgcttat ttgttttccc acggttgtcc 480

agcaattaat aaaacataac 500

<210> 4

<211> 103

<212> RNA

<213>artificial sequence (Artificial Sequence)

<400> 4

uggggcacca acguccaagg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu uuu 103

<210> 5

<211> 500

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

agggctccga ccctgccgat gtggccatcc agctgacctt cctgcgcctg atgtccaccg 60

aggcctccca gaacatcacc taccactgca agaacagcgt ggcctacatg gaccagcaga 120

ctggcaacct caagaaggcc ctgctcctcc agggctccaa cgagatcgag atccgcgccg 180

agggcaacag ccgcttcacc tacagcgtca ctgtcgatgg ctgcacggtg agtgcccaga 240

atccccaggc agggccccac ctctccggcc ttgggctttt tggccaggcc atagtgccct 300

ctctccatca ctcccacgtg gtaatgcccc ctcccgttgt ctccgcccca ccccagagtc 360

acaccggagc ctggggcaag acagtgattg aatacaaaac caccaagacc tcccgcctgc 420

ccatcatcga tgtggcaccc ttggacgttg gtgccccaga ccaggaattc ggcttcgacg 480

ttggccctgt ctgcttcctg 500

<210> 6

<211> 500

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

actccctcca tcccaacctg gctccctccc acccaaccaa ctttcccccc aacccggaaa 60

cagacaagca acccaaactg aaccccctca aaagccaaaa aatgggagac aatttcacat 120

ggactttgga aaatattttt ttcctttgca ttcatctctc aaacttagtt tttatctttg 180

accaaccgaa catgaccaaa aaccaaaagt gcattcaacc ttaccaaaaa aaaaaaaaaa 240

aaaagaataa ataaataact ttttaaaaaa ggaagcttgg tccacttgct tgaagaccca 300

tgcgggggta agtccctttc tgcccgttgg gcttatgaaa ccccaatgct gccctttctg 360

ctcctttctc cacacccccc ttggggcctc ccctccactc cttcccaaat ctgtctcccc 420

agaagacaca ggaaacaatg tattgtctgc ccagcaatca aaggcaatgc tcaaacaccc 480

aagtggcccc caccctcagc 500

<210> 7

<211> 103

<212> RNA

<213>artificial sequence (Artificial Sequence)

<400> 7

gagauagcac ugaguucugu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu uuu 103

<210> 8

<211> 500

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

tggcccactt ggaggagaaa caaggtgtct ccaagagaca tgttaggata agcaggtctt 60

tgcaccaaga tgaacacagc tggtcacaga taaggccatt gctagtaact tttggccatg 120

atggaaaagg gcatcctctc cacaaaagag aaaaacgtca agccaaacac aaacagcgga 180

aacgccttaa gtccagctgt aagagacacc ctttgtacgt ggacttcagt gacgtggggt 240

ggaatgactg gattgtggct cccccggggt atcacgcctt ttactgccac ggagaatgcc 300

cttttcctct ggctgatcat ctgaactcca ctaatcatgc cattgttcag acgttggtca 360

actctgttaa ctctaagatt cctaaggcat gctgtgtccc gacagaactc agtgctatct 420

cgatgctgta ccttgacgag aatgaaaagg ttgtattaaa gaactatcag gacatggttg 480

tggagggttg tgggtgtcgc 500

<210> 9

<211> 500

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

tagtacagca aaattaaata cataaatata tatatatata tatattttag aaaaaagaaa 60

aaaacaaaca aacaaaaaaa ccccacccca gttgacactt taatatttcc caatgaagac 120

tttatttatg gaatggaatg gaaaaaaaaa cagctatttt gaaaatatat ttatatctac 180

gaaaagaagt tgggaaaaca aatattttaa tcagagaatt attccttaaa gatttaaaat 240

gtatttagtt gtacatttta tatgggttca accccagcac atgaagtata atggtcagat 300

ttattttgta tttatttact attataacca ctttttagga aaaaaatagc taatttgtat 360

ttatatgtaa tcaaaagaag tatcgggttt gtacataatt ttccaaaaat tgtagttgtt 420

ttcagttgtg tgtatttaag atgaaaagtc tacatggaag gttactctgg caaagtgctt 480

agcacgtttg cttttttgca 500

<210> 10

<211> 103

<212> RNA

<213>artificial sequence (Artificial Sequence)

<400> 10

cacuagaauu caaaacaguu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu uuu 103

<210> 11

<211> 500

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 11

tccatcttct gttataattt ttaggtgctt cagaactggg ccctttttca gaccccaggc 60

agttcccaag catttcatcc ctcactgaga gccgcttctc caacccacga atgcactatc 120

cagccacctt tacttacacc ccgccagtca cctcaggcat gtccctcggt atgtccgcca 180

ccactcacta ccacacctac ctgccaccac cctaccccgg ctcttcccaa agccagagtg 240

gacccttcca gaccagcagc actccatatc tctactatgg cacttcgtca ggatcctatc 300

agtttcccat ggtgccgggg ggagaccggt ctccttccag aatgcttccg ccatgcacca 360

ccacctcgaa tggcagcacg ctattaaatc caaatttgcc taaccagaat gatggtgttg 420

acgctgatgg aagccacagc agttccccaa ctgttttgaa ttctagtggc agaatggatg 480

aatctgtttg gcgaccatat 500

<210> 12

<211> 500

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 12

tgaaattcct cagcagtggc ccagtggtat ctgggggcca catcccacac gtatcaatat 60

atacatatat agagagagtg catatatatg tatatcgatt agctatctac aaagtgccta 120

ttttttagaa gatttttcat tcactcactc agtcatgatc ttgcagccat aagagggtag 180

atattgagaa gcagaaggct caagagagac aattgcaatc gagcttcaga ttgtttacta 240

tttaagatgt acttttacaa aggaacaaag aagggaaaag gtatttttgt ttttgttgtt 300

tggtctgtta tcatcaataa cctgttcata tgccaattca gagaggtgga ctccaggttc 360

aggagggaga agagcaaagc cgcttcctct ctgtgctttg aaacttcaca ccctcacggt 420

ggcagctgtg tatggaccag tgccctccgc agacagctca caaaaccagt tgaggtgcac 480

taaagggaca tgaggtagaa 500

<210> 13

<211> 103

<212> RNA

<213>artificial sequence (Artificial Sequence)

<400> 13

gcuugauucc ugccauaugg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu uuu 103

<210> 14

<211> 500

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 14

actcctgaac cctactccaa gcacagcctc tgtctgactc ccttgtcctt caagagaact 60

gttctccagg tctcagggcc aggatttcca taggatcgcc tgtggctttg attctattct 120

agtgtctctg ggtgggggtc ctgggcaagt gtctttctga gtctcagttt ctttatcggt 180

aaaatgtaca taatgagatt gaaagtgctc tgcaaagcac tatgtgcact aagaatttat 240

tattcaggtt gtttccatca tgttttctga ggtgaaatca caaaggatca gtggagtttg 300

aggattatct agttcaatgc tttgagttta gagttttacg gtgaaaatga gacttgtctc 360

ctgacactaa gtctctctca actatagcgc tatcttgcta ttttctctat ctcagaagga 420

tccttgggca ggaggaagga tgtggatatg atttggctgg tttctatgct gaagctctta 480

tctgattttc tctcacagct 500

<210> 15

<211> 500

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 15

tgattcctgc catatggagg aggctctgga gtcctgctct gtgtggtcca ggtcctttcc 60

accctgagac ttggctccac cactgatatc ctcctttggg gaaaggcttg gcacacagca 120

ggctttcaag aagtgccagt tgatcaatga ataaataaac gagcctattt ctctttgcac 180

atcctgcttc tgtgattcgt tgggggtatg agtggggtgg gaagctgtga gggaagatct 240

agatatgagg cctccttcct atgaatacgt agtgggagga agaggcttag ggactggggg 300

aacttgaatt tatatcatga gtgtgaaagt gctgactctg tgatttggga caagtgattt 360

tatctcctaa atttcaatgg gattagggat gtacaataac atgaagaatc agaaacctca 420

attttactgc ctctggcagg attgtcaact gcaggtgaaa aactttcctg agacgagttt 480

atgcataaga gatcctgcca 500

<210> 16

<211> 103

<212> RNA

<213>artificial sequence (Artificial Sequence)

<400> 16

uuuaaaggac aaggcuacga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu uuu 103

<210> 17

<211> 500

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 17

aagaagaaga ggaggaagag gaaggaaatg aaaacgaaga aagcgaagca gaagtggatg 60

aaaacgaaca aggcataaac ggcaccagta ccaacagcac agaggcagaa aacggcaacg 120

gcagcagcgg aggagacaat ggagaagaag gggaagaaga aagtgtcact ggagccaatg 180

cagaagacac cacagagacc ggaaggcagg gcaagggcac ctcgaagaca acaacctctc 240

caaatggtgg gtttgaacct acaaccccac cacaagtcta tagaaccact tccccacctt 300

ttgggaaaac caccaccgtt gaatacgagg gggagtacga atacacgggc gccaatgaat 360

acgacaatgg atatgaaatc tatgaaagtg agaacgggga acctcgtggg gacaattacc 420

gagcctatga agatgagtac agctacttta aaggacaagg ctacgatggc tatgatggtc 480

agaattacta ccaccaccag 500

<210> 18

<211> 500

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 18

tgaagctcca gcctgggatg aattcatcca ttctggcttt gcatccggct accattttcg 60

aagttcaact caggaaggtg caatataaca aatgtgcata ttataatgag gaatggtact 120

accgttccag attttctgta attgcttctg caaagtaata ggcttcttgt cccttttttt 180

tctggcatgt tatggaatga tcattgtaaa tcaggaccat ttatcaagca gtacaccaac 240

tcataagatc aaatttcatt gaatggtttg aggttgtagc tctataaata gtagttttta 300

acatgcctgt agtattgcta actgcaaaaa catactcttt gtacaagaag tgcttctaag 360

aatttcattg acattaatga cactgtatac aataaatgtg tagtttctta atcgcactac 420

ctatgcaaca ctgtgtatta ggtttatcat cctcatgtat ttttatgtga cctgtatgta 480

tattctaatc tacgagtttt 500

<210> 19

<211> 103

<212> RNA

<213>artificial sequence (Artificial Sequence)

<400> 19

cgggccguag aagcgccgau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu uuu 103

<210> 20

<211> 500

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 20

cactcctgcc acctcctgtc tggccatcag gaaggccagc ctgctcccca cctgatcctc 60

ccaaacccag agccacctga tgcctgcccc tctgctccac agcctttgtg tccaagcagg 120

agggcagcga ggtagtgaag agacccaggc gctacctgta tcaatggctg gggtgagaga 180

aaaggcagag ctgggccaag gccctgcctc tccgggatgg tctgtggggg agctgcagca 240

gggagtggcc tctctgggtt gtggtggggg tacaggcagc ctgccctggt gggcaccctg 300

gagccccatg tgtagggaga ggagggatgg gcattttgca cgggggctga tgccaccacg 360

tcgggtgtct cagagcccca gtcccctacc cggatcccct ggagcccagg agggaggtgt 420

gtgagctcaa tccggactgt gacgagttgg ctgaccacat cggctttcag gaggcctatc 480

ggcgcttcta cggcccggtc 500

<210> 21

<211> 500

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 21

ggtgtcgctc tgctggcctg gccggcaacc ccagttctgc tcctctccag gcacccttct 60

ttcctcttcc ccttgccctt gccctgacct cccagcccta tggatgtggg gtccccatca 120

tcccagctgc tcccaaataa actccagaag aggaatctgt gggcctgtga gtctgtccag 180

tttatggagt gtgggaggga ggtgtcagga ggatgggggt gaggaggttt taccttcttc 240

agttctagaa agtgctttcc aaagttttat ttttttattt gtacctgcct tgttccagaa 300

aacgttgaag gtggcttccc aaagtctaac tagggatacc ccctctagcc taggaccctc 360

ctccccacac ctcaatccac caaaccatcc ataatgcacc cagataggcc cacccccaaa 420

agcctggaca ccttgagcac acagttatga ccaggacaga ctcatctcta taggcaaata 480

gctgctggca aactggcatt 500

<210> 22

<211> 24

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 22

gtaacatgct agtattattt cagc 24

<210> 23

<211> 21

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 23

aacaaaacat cacaccgtac c 21

<210> 24

<211> 777

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 24

gagggcagag gaagtctgct aacatgcggt gacgtcgagg agaatcctgg cccagtgagc 60

aagggcgagg agctgttcac cggggtggtg cccatcctgg tcgagctgga cggcgacgta 120

aacggccaca agttcagcgt gtccggcgag ggcgagggcg atgccaccta cggcaagctg 180

accctgaagt tcatctgcac caccggcaag ctgcccgtgc cctggcccac cctcgtgacc 240

accctgacct acggcgtgca gtgcttcagc cgctaccccg accacatgaa gcagcacgac 300

ttcttcaagt ccgccatgcc cgaaggctac gtccaggagc gcaccatctt cttcaaggac 360

gacggcaact acaagacccg cgccgaggtg aagttcgagg gcgacaccct ggtgaaccgc 420

atcgagctga agggcatcga cttcaaggag gacggcaaca tcctggggca caagctggag 480

tacaactaca acagccacaa cgtctatatc atggccgaca agcagaagaa cggcatcaag 540

gtgaacttca agatccgcca caacatcgag gacggcagcg tgcagctcgc cgaccactac 600

cagcagaaca cccccatcgg cgacggcccc gtgctgctgc ccgacaacca ctacctgagc 660

acccagtccg ccctgagcaa agaccccaac gagaagcgcg atcacatggt cctgctggag 720

ttcgtgaccg ccgccgggat cactctcggc atggacgagc tgtacaagga attctaa 777

<210> 25

<211> 2949

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 25

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60

gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120

actccatcac taggggttcc tgcggccgcg aatgctgcgg cgcgcggcta gcctgatttt 180

gtaggtaacc acgtgcggac cgagcggccg caggaacccc tagtgatgga gttggccact 240

ccctctctgc gcgctcgctc gctcactgag gccgggcgac caaaggtcgc ccgacgcccg 300

ggctttgccc gggcggcctc agtgagcgag cgagcgcgca gctgcctgca ggggcgcctg 360

atgcggtatt ttctccttac gcatctgtgc ggtatttcac accgcatacg tcaaagcaac 420

catagtacgc gccctgtagc ggcgcattaa gcgcggcggg tgtggtggtt acgcgcagcg 480

tgaccgctac acttgccagc gccctagcgc ccgctccttt cgctttcttc ccttcctttc 540

tcgccacgtt cgccggcttt ccccgtcaag ctctaaatcg ggggctccct ttagggttcc 600

gatttagtgc tttacggcac ctcgacccca aaaaacttga tttgggtgat ggttcacgta 660

gtgggccatc gccctgatag acggtttttc gccctttgac gttggagtcc acgttcttta 720

atagtggact cttgttccaa actggaacaa cactcaaccc tatctcgggc tattcttttg 780

atttataagg gattttgccg atttcggcct attggttaaa aaatgagctg atttaacaaa 840

aatttaacgc gaattttaac aaaatattaa cgtttacaat tttatggtgc actctcagta 900

caatctgctc tgatgccgca tagttaagcc agccccgaca cccgccaaca cccgctgacg 960

cgccctgacg ggcttgtctg ctcccggcat ccgcttacag acaagctgtg accgtctccg 1020

ggagctgcat gtgtcagagg ttttcaccgt catcaccgaa acgcgcgaga cgaaagggcc 1080

tcgtgatacg cctattttta taggttaatg tcatgataat aatggtttct tagacgtcag 1140

gtggcacttt tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt 1200

caaatatgta tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa 1260

ggaagagtat gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt 1320

gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt 1380

tgggtgcacg agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt 1440

ttcgccccga agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg 1500

tattatcccg tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga 1560

atgacttggt tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa 1620

gagaattatg cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga 1680

caacgatcgg aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa 1740

ctcgccttga tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca 1800

ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta 1860

ctctagcttc ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac 1920

ttctgcgctc ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc 1980

gtgggtctcg cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag 2040

ttatctacac gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga 2100

taggtgcctc actgattaag cattggtaac tgtcagacca agtttactca tatatacttt 2160

agattgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata 2220

atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag 2280

aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa 2340

caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt 2400

ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc 2460

cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa 2520

tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa 2580

gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc 2640

ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa 2700

gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa 2760

caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg 2820

ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc 2880

tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg 2940

ctcacatgt 2949

<210> 26

<211> 35

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 26

gtagacccca aaagtaaaga agaagataaa cacct 35

<210> 27

<211> 32

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 27

aggtgtttat cttctttact tttggggtct ac 32

<210> 28

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 28

tcagcttcag gcaccaccac 20

<210> 29

<211> 23

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 29

tgaacttgtg gccgtttacg tcg 23

<210> 30

<211> 19

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 30

ccctgcagtt cgagtatgg 19

<210> 31

<211> 19

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 31

gcagtctgag aaccccagg 19

<210> 32

<211> 35

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 32

cccatcatcg atgtggcacc cttggacgtt ggtgc 35

<210> 33

<211> 35

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 33

gcaccaacgt ccaagggtgc cacatcgatg atggg 35

Claims

1. it is a kind of prepare can real-time detection mescenchymal stem cell bone differentiation capability cell model method, which is characterized in that should Method includes the following steps:

S1, RNP compound will be mixed to form for sgRNA the and Cas9 albumen for knocking in site of bone differentiation associated gene；Institute Stating bone differentiation associated gene isSPP1 or COL1A1；The site of knocking in of the bone differentiation associated gene is that the bone breaks up dependency basis Between the last sense codon and terminator codon of cause；

S2, it will be packaged into inserted with template DNA homologous recombination vector in AAV virus, and form AAV virion to be transfected；It is described Template DNA includes the left homology arm sequence and right homology arm sequence for knocking in site for the bone differentiation associated gene, described Inserted with self cleavage 2A peptide-coding sequence and fluorescent protein report gene between left homology arm sequence and the right homology arm sequence, So that orientation forms melting for the fusion protein that coding is connected in series by bone differentiation associated gene, 2A peptide and fluorescin after knocking in Close gene；

The sgRNA is as shown in SEQ ID NO. 1, and for the left homology arm sequence as shown in SEQ ID NO. 2, the right side is homologous Arm sequence is as shown in SEQ ID NO. 3；Alternatively, the sgRNA, as shown in SEQ ID NO. 4, the left homology arm sequence is such as Shown in SEQ ID NO. 5, the right homology arm sequence is as shown in SEQ ID NO. 6；

S3, the suspension of mescenchymal stem cell is mixed to the suspension of the RNP compound and is carried out electricity turn, obtain the training after electricity turns Support object；

S4, in 1-30 minutes, the outstanding of AAV virion to be transfected is added in the material after turning to the electricity after electricity turns Culture of the liquid to carry out transfection in 4-30 hours, after being transfected；

S5, will after the culture Method of Limited Dilution after the transfection carry out monoclonal culture, and by PCR and sequencing filter out into Gene of having gone orients the monoclonal cell strain knocked in.

2. according to the method described in claim 1, wherein, the sgRNA has chemical modification group；The chemical modification group For methyl chemistry modification group or phosphorothioate chemical modification group；For bone differentiation associated gene the sgRNA for knocking in site and The dosage molar ratio of Cas9 albumen is 1:1 to 1:5.

3. method according to claim 1 or 2, wherein by for bone differentiation associated gene the sgRNA for knocking in site and The time of Cas9 albumen mixing is 5-20 minutes, and temperature is 10-40 DEG C.

4. according to the method described in claim 1, wherein, in step S3, the suspension of the mescenchymal stem cell and the RNP are multiple When closing object mixing, relative to every 10⁶A mescenchymal stem cell, with the meter of sgRNA, the dosage of the RNP compound is 10-50 μm of ol, in the suspension of the mescenchymal stem cell, cell concentration is (1-5) × 10⁷A/mL；With the meter of sgRNA, The final concentration of 0.1-1.5 μm of ol/ μ L of the RNP compound.

5. method according to claim 1 or 4, wherein in step S3, the condition that electricity turns includes: that electric field strength is 50- 250V/cm, single pulse time are 2-15ms, and the time interval between adjacent two subpulse is 10-60s, and total pulses are 2-10 times.

6. according to the method described in claim 1, wherein, in step S4, after electricity turns in 5-20 minutes, turning to the electricity Culture of the suspension of AAV virion to be transfected to carry out transfection in 8-24 hours, after being transfected is added in material afterwards Object.

7. method according to claim 1 or 6, wherein in step S4, the suspension of AAV virion to be transfected adds Entering amount makes the MOI value of AAV virion to be transfected be 10⁴-10⁶。

8. according to the method described in claim 1, wherein, the mescenchymal stem cell is between mesenchymal stem cell, fat Mesenchymal stem cells, umbilical cord mesenchymal stem cells, palace blood mescenchymal stem cell and dental pulp mescenchymal stem cell, the AAV virus Serotype is AAV-6 virus, AAV-1 virus or AAV9 virus.

9. according to the method described in claim 1, wherein, the self cleavage 2A peptide be in T2A peptide, F2A peptide and P2A peptide at least It is a kind of；The fluorescent protein report gene is in EGFP, ECFP, EYFP, GFP, RFP, mCherry, tdTomato and Venus It is at least one.