CN106636000A

CN106636000A - hESCs-TK cell line and building method and application thereof

Info

Publication number: CN106636000A
Application number: CN201611207427.4A
Authority: CN
Inventors: 徐洋
Original assignee: Guangdong Saint Bio Technology Co Ltd; Southern Medical University
Current assignee: Guangdong Saint Bio Technology Co Ltd; Southern Medical University
Priority date: 2016-12-23
Filing date: 2016-12-23
Publication date: 2017-05-10

Abstract

The invention discloses a CPTK-hESCs cell line and a preparation method thereof. The CPTK-hESCs cell line is a hESCs cell line obtained by knocking a TK gene into a housekeeping gene HPRT1 locus of CP hESCs. An eliminating technology based on TK gene/GCV in hESCs is built, an application of the CPTK-hESCs cell line to preparation of a biological preparation for eliminating stem cell derived cell cancerization risk monitored by escape immunity is provided, and more safety guarantee is provided for clinical treatment application of embryonic stem cells.

Description

hESCs-TK cell line and construction method and application thereof

Technical Field

The invention relates to biotechnology, in particular to an hESCs-TK cell line and a construction method and application thereof.

Background

Human embryonic stem cells (hESCs) have unlimited self-renewal capacity while maintaining their totipotency to differentiate into all types of human somatic cells. Therefore, hESCs have a broad development prospect in the treatment of human diseases and the application of model establishment. Since Thomson successfully established the first strain of hESCs in 1998, human stem cell therapy has achieved a significant breakthrough in development. In this context, stem cell therapy for spinal cord injury, macular degeneration, and type I diabetes has entered clinical trials. Current clinical studies at stage 1/2 show that hESC-derived retinal pigment epithelial cells are effective in improving vision in age-induced macular degeneration as well as Stargardt macular dystrophy patients.

While stem cell therapy has shown a promising application, several serious bottlenecks have hindered the development of its clinical applications. One of the key bottlenecks is that hESC differentiated allografts encounter immune rejection by the body. To address this problem, the medical community has developed various immunosuppressive or immunotolerance treatment strategies. By using a humanized mouse animal model with a human immune system to overexpress two immunosuppressive proteins CTLA4-Ig and PD-L1 on the surfaces of hESCs and their differentiated cells, we developed a novel method for inhibiting allogeneic immune rejection. Subsequent studies showed that blocking the CD28 and CD40 co-activation pathways using antibodies could achieve immune tolerance of hESC differentiated pancreatic endoderm cells in another humanized mouse model. However, these immunosuppressive or tolerizing strategies significantly increase the risk of canceration of the transplanted hESC differentiated cells, which can escape the body's immune surveillance even if immunosuppression is reversible. In addition, the transplanted cells may cause serious problems such as uncontrolled migration of the cells to other sites. Therefore, it is important to develop a method for improving the safety of cells after transplantation under immunosuppressive conditions.

The herpes simplex virus thymidine kinase (HSVTK, abbreviated as TK hereinafter) gene encodes a gene that converts non-toxic Ganciclovir (GCV) to toxic ganciclovir triphosphate, which can be incorporated into DNA of cells in the mitotic phase to inhibit DNA synthesis, leading to cell death. Early studies showed that this gene can be effectively and safely applied to mouse models and tumor gene therapy. Therefore, the development of a strategy to eliminate the risk of canceration of the immune-tolerant hESC differentiated cells after transplantation by using the properties of TK is of great significance for the safety of embryonic stem cell therapy.

Disclosure of Invention

Based on the above, one of the purposes of the invention is to construct a CPTK-hESCs cell line, and the surface of the constructed embryonic stem cell can express TK at a high level.

The technical scheme for realizing the purpose is as follows:

a construction method of CPTK-hESCs comprises the following steps:

culturing hESCs;

B. constructing a homologous recombination repair template pBACe3.6RP11-671P4-452CNP-CPTK bacterial artificial chromosome: bacterial artificial chromosome pBACe3.6RP11-671P4 was purchased from Invitrogen. The repair template DNA vector comprises an HPRT1 gene upstream homology arm with about 124kb, a LoxP site, a CAG promoter, a resistance screening gene Puro/IRES/Neo, a LoxP site, a CAG promoter, a target gene CTLA4-Ig/IRES/PD-L1/IRES/TK, polyA polyadenylic acid and an HPRT1 gene downstream homology arm with about 71kb from the 5 'end to the 3' end in sequence;

C. and (2) performing electrotransfection on the linearized repair template to enter hESCs cells, adding a culture solution after the electrotransfection to restore the growth of the cells, then adding a culture medium containing puromycin to culture, screening and separating out monoclone, then adding a culture medium containing 6-thioguanine to culture and screen, selecting a positive monoclonal cell strain, transfecting pCAG/Cre/polyA plasmid expressing Cre enzyme into the cells again, and screening the monoclone cells without puromycin resistance to obtain the CPTK-hESCs cell line.

In one embodiment, the specific parameters of electrotransfection are: 0.4cm electric cup, 320volt, 200 muF, 10x10⁶-40x10⁶The mass of DNA is 20-40 mug.

In one embodiment, the puromycin concentration is 1.5-2.0 μ g/ml.

In one embodiment, the concentration of 6-thioguanine in the culture medium is 0.5-1.5 mM.

It is another object of the present invention to provide a CPTK-hESCs cell line which can be used to improve the safety of embryonic stem cell therapy.

In one embodiment, the LoxP site has the base sequence: a sequence shown as SEQ ID NO.1 or a sequence shown as SEQ ID NO.1, wherein one or more basic groups are substituted but the activity is not changed; and/or the CAG promoter base sequence is: a sequence shown as SEQ ID NO.2 or a sequence shown as SEQ ID NO.2 in which one or more bases are substituted but the activity is not changed.

In one embodiment, the base sequence of the resistance selection gene Puro/IRES/Neo is shown as SEQ ID NO. 3; or a sequence as shown in SEQ ID NO.3 in which one or more bases are substituted but the activity is not changed; and/or polyA polyadenylation base sequence: a sequence shown as SEQ ID NO.5, or a sequence shown as SEQ ID NO.5 in which one or more bases are substituted but the activity is not changed.

In one embodiment, the base sequence of the target gene CTLA4-Ig/IRES/PD-L1/IRES/TK is as follows: a sequence shown as SEQ ID NO. 4; or a sequence as shown in SEQ ID NO.4 in which one or more bases are substituted but the activity is not changed.

In one embodiment, the sequence of the upstream homology arm of the HPRT1 gene is: a base sequence from 134376991 to134500246 in the sequence number NC-000023.11 of NCBI, or a sequence from 134376991 to134500246 in the sequence number NC-000023.11 of NCBI in which one or more bases are substituted but the activity is not changed; and/or

The base sequence of the downstream homology arm of the HPRT1 gene is as follows: the sequence number of NCBI is the sequence from 134500874 to134571880 in NC-000023.11, or the sequence from 134500874 to134571880 in NC-000023.11, wherein one or more bases are substituted, but the activity is not changed.

The CPTK-hESCs cell line obtained according to the construction method.

Another object of the present invention is to provide the use of the above CPTK-hESCs cell line.

The specific technical scheme is as follows.

The CPTK-hESCs cell line is applied to the preparation of biological agents for eliminating the canceration risk of stem cell derived cells escaping immune monitoring.

Through the design of gene knock-in, the TK gene is knocked into a housekeeping gene HPRT1 locus of hESCs, whether the gene is knocked into the hESCs is identified through PCR, and whether a CPTK-hESCs cell line cultured in vitro is sensitive to GCV is identified through crystal violet staining experiments and several cells. Then CPTK-hESCs are respectively injected to NSG mice or humanized mice subcutaneously, and GCV is injected into the abdominal cavity after teratoma formation so as to determine whether GCV can effectively remove hESCs in vivo. CPTK differentiation into cardiomyocytes was injected intramuscularly into the NSG mouse or humanized mouse hind leg muscle, frozen sections were taken 1 to 2 weeks later and stained to identify whether GCV could eliminate post-differentiation hESCs. The invention establishes a TK gene/GCV-based elimination technology in hESCs by taking CPTK-hESCs as a system, provides the application of the CPTK-hESCs cell line in preparing a biological preparation for eliminating the canceration risk of stem cell derived cells escaping immune monitoring, and provides safer guarantee for the clinical treatment application of embryonic stem cells.

Drawings

FIG. 1 shows the knockdown of the pCAG/CTLA4-lg/IRES/PD-L1/IRES/TK/polyA gene expression cassette into the HPRT1 gene site of hESCs cells by homologous recombination using bacterial artificial chromosome technology, wherein:

A. configuration of the human HPRT1 gene site. Black boxes represent the exon coding region of HPRT1, white boxes represent the 3' untranslated region of HPRT 1; black triangle arrows represent primer positions for PCR identification;

B. configuration of the alleles after homologous recombination, where the black boxes represent the exon coding region of HPRT1 and the white boxes represent the 3' untranslated region of HPRT 1; the black triangle arrows represent the positions of the primers identified by PCR. The dotted arrows indicate that the range is respectively the upstream and downstream homology arms, wherein the upstream homology arm is 124kb, and the downstream homology arm is 71 kb;

C. performing PCR identification after homologous recombination; the primers used in the upper half of the picture are p1, p2 and p5, wherein as shown in A and B, the primers p1 and p2 amplify a wild-type fragment with the length of 404bp, the primers p1 and p5 amplify an allele fragment without the resistance screening gene after Cre recombination with the length of 503bp, and the primers p1 and p5 amplify an allele fragment with the resistance screening gene before Cre recombination with the length of 311 bp; the primers used in the lower half of the picture are p3, p4 and p5, wherein as shown in A and B, the primers p3 and p4 amplify a wild-type fragment with the length of 406bp, and the primers p3 and p5 amplify an allele fragment with the length of 277bp and before/after Cre recombination;

D. drug toxicity experiments verify homologous recombination of alleles;

e, verifying the expression of CTLA4-Ig gene in CPTK-hESCs by Western Blotting;

F. flow cytometry verifies that the PD-L1 gene is highly expressed on the cell surface of CPTK-hESCs.

FIG. 2 is an ES cell characterization of CPTK-hESCs and functional identification of TK gene, wherein:

A. flow cytometry compared the expression of pluripotency markers for wild-type hESCs and CPTK-hESCs. The totipotency of CPTK-hESCs is verified;

qpcr compares the expression of pluripotency genes for wild type hESCs and CPTK-hESCs. The totipotency of CPTK-hESCs is verified again;

C. the teratoma formation experiment of the immunodeficiency NSG mice verifies the totipotency that the CPTK-hESCs can effectively form the teratoma;

D. the sensitivity of CPTK-hESCs to GCV is verified by an in-vitro GCV gradient drug toxicity experiment;

E. in vitro GCV time drug toxicity experiments verified that GCV can completely eliminate CPTK-hESCs in 4 days.

FIG. 3 demonstrates that the TK gene does not affect the function of CTLA4-Ig and PD-L1 genes, where:

A. both wild-type hESCs and CPTK-hESCs were able to form teratomas efficiently in immunodeficient NSG mice, whereas wild-type hESCs were unable to form normal teratomas in humanized mice with the human immune system, indicating that CPTK-hESCs have an immune-tolerizing function.

B. Flow cytometry confirmed that wild-type hESCs had a large infiltration of human CD3T cells, whereas CPTK-hESCs had only a small number of CD3T cells.

C. Immunofluorescence experiments confirmed that wild-type hESCs had a large infiltration of human CD3T cells, whereas CPTK-hESCs had only a small number of CD3T cells.

D. Statistics of rejection of wild type hESCs and CPTK-hESCs in NSG mice or humanized mice.

E.H & E staining confirmed that wild-type hESCs were unable to form normal teratomas in humanized mice, whereas CPTK-hESCs were able to form intact teratomas.

FIG. 4 demonstrates that GCV is effective in eliminating CPTK-hESCs in mice, wherein,

A. in NSG mice and humanized mice, after intraperitoneal injection of GCV, the teratomas formed by CPTK-hESCs shrink with time. Finally, only a tiny block of organization remains;

B. immunofluorescence staining experiments show that the residual tissues are not human tissues, and prove that CPTK-hESCs are completely eliminated by GCV;

C. statistics of clearance of wild type hESCs and CPTK-hESCs by GCV in NSG mice or humanized mice.

FIG. 5 verifies that CPTK-hESCs can still be cleared by GCV in mice after differentiation into cardiomyocytes; wherein,

qPCR verifies that the differentiated cardiomyocytes of the wild type hESCs and the CPTK-hESCs have similar expression quantity of the cardiomyocyte related gene expression;

B. flow cytometry verifies that related markers are expressed on the surfaces of differentiated cardiomyocytes of wild type hESCs and CPTK-hESCs;

C. immunofluorescent staining experiments showed that GCV was able to clear CPTK-hESCs differentiated cardiomyocytes injected in the hind leg muscle of humanized mice.

Detailed Description

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

To facilitate an understanding of the invention, the invention will now be described more fully with reference to the accompanying drawings. Preferred embodiments of the present invention are shown in the drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Experimental procedures without specific conditions noted in the following examples, generally following conventional conditions, such as molecular cloning by Sambrook et al: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. The various chemicals used in the examples are commercially available.

Example 1: establishment of CPTK-hESCs cell strain

1.1 cell culture

hESCs cells (Hues3, NIHhESC-09-0016) cultures were maintained on feeder cells prepared from CF1 mouse embryo fibroblasts, supplemented with 10% Knockout serum replantate, 10% plasma, 0.1mM non-essential amino acids, 2mM Glutamax, 100units/ml penicillin, 100. mu.g/ml streptomycin, 10ng/ml basic fiber growth factor (bFGF) and 55. mu.M beta-Mercapthanol in basal medium Knockout Dulbecco's modified Eagle's medium.

hESCs were digested with TrypLE for passage.

1.2 construction of BAC vector

HPRT1 Bac vector (bacterial Artificial chromosome) RP11-671P4 was purchased from Invitrogen and targeted Bac vectors as currently available⁽[1]Song H,Chung SK,Xu Y.Modeling disease in human ESCs using an efficientBAC-based homologous recombination system.Cell stem cell.2010；6:80-89；

[2] Rong Z, Wang M, Hu Z et al.Anfective approach to present immunological rejection of human ESC-derived allographs.cell stem cell.2014; 14:121-130) by homologous recombination of E.coli strain SW102 competent cells.

The expression cassette of pCAG/CTLA4-Ig/IRES/PD-L1/IRES/TK/polyA gene is knocked into the HPRT1 gene about 600bp downstream of the terminator. Resistance selection gene expression box with Loxp locus at two ends.

The repair template DNA vector comprises an upstream homology arm of HPRT1 gene with about 124kb, a LoxP site, a CAG promoter, resistance screening genes Puro/IRES/Neo, a LoxP site, a CAG promoter, a target gene CTLA4-Ig/IRES/PD-L1/IRES/TK, polyA polyadenylic acid and a downstream homology arm of HPRT1 gene with about 69kb from the 5 'end to the 3' end in sequence.

The sequence of the upstream homology arm of the HPRT1 gene is as follows: the NCBI has a base Sequence with Sequence number NC-000023.11 from 134376991 to134500246 (Homo sapiens chromosome X, GRCh38.p7 PrimaryAssembly. NCBI Reference Sequence: NC-000023.11 from base 134376991 to 134500246).

The base sequence of LoxP site is ATAACTTCGTATAATGTATGCTATACGAAGTTAT (SEQ ID NO.1)

The CAG promoter base sequence component is:

TCGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGACTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGTTGCCTTCGCCCCGTGCCCCGCTCCGCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTTGGTTTAATGACGGCTCGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTAAAGGGCTCCGGGAGGGCCCTTTGTGCGGGGGGGAGCGGCTCGGGGGGTGCGTGCGTGTGTGTGTGCGTGGGGAGCGCCGCGTGCGGCCCGCGCTGCCCGGCGGCTGTGAGCGCTGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCGTGTGCGCGAGGGGAGCGCGGCCGGGGGCGGTGCCCCGCGGTGCGGGGGGGCTGCGAGGGGAACAAAGGCTGCGTGCGGGGTGTGTGCGTGGGGGGGTGAGCAGGGGGTGTGGGCGCGGCGGTCGGGCTGTAACCCCCCCCTGCACCCCCCTCCCCGAGTTGCTGAGCACGGCCCGGCTTCGGGTGCGGGGCTCCGTGCGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGCGGCAGGTGGGGGTGCCGGGCGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCTCGGGGGAGGGGCGCGGCGGCCCCGGAGCGCCGGCGGCTGTCGAGGCGCGGCGAGCCGCAGCCATTGCCTTTTATGGTAATCGTGCGAGAGGGCGCAGGGACTTCCTTTGTCCCAAATCTGGCGGAGCCGAAATCTGGGAGGCGCCGCCGCACCCCCTCTAGCGGGCGCGGGCGAAGCGGTGCGGCGCCGGCAGGAAGGAAATGGGCGGGGAGGGCCTTCGTGCGTCGCCGCGCCGCCGTCCCCTTCTCCATCTCCAGCCTCGGGGCTGCCGCAGGGGGACGGCTGCCTTCGGGGGGGACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTGACCGGCGGCTCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTGGCAAAGAATT(SEQ ID NO.2)。

the base sequence of the resistance screening gene Puro/IRES/Neo is as follows:

ATGGGATCGGCCATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGATGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGGGGATCAATTCAATTCCGCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGGCCACAACCATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA(SEQ ID NO.3)

the base sequence of the target gene CTLA4-Ig/IRES/PD-L1/IRES/TK comprises:

ATGGGGGTACTGCTCACACAGAGGACGCTGCTCAGTCTGGTCCTTGCACTCCTGTTTCCAAGCATGGCGAGCATGGCAATGCACGTGGCCCAGCCTGCTGTGGTACTGGCCAGCAGCCGAGGCATCGCCAGCTTTGTGTGTGAGTATGCATCTCCAGGCAAAGCCACTGAGGTCCGGGTGACAGTGCTTCGGCAGGCTGACAGCCAGGTGACTGAAGTCTGTGCGGCAACCTACATGATGGGGAATGAGTTGACCTTCCTAGATGATTCCATCTGCACGGGCACCTCCAGTGGAAATCAAGTGAACCTCACTATCCAAGGACTGAGGGCCATGGACACGGGACTCTACATCTGCAAGGTGGAGCTCATGTACCCACCGCCATACTACCTGGGCATAGGCAACGGAACCCAGATTTATGTAATTGATCCAGAACCGTGCCCAGATTCTGATCAGGAGCCCAAATCTTCTGACAAAACTCACACATCCCCACCGTCCCCAGCACCTGAACTCCTGGGGGGATCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAATGAGAATTGAATTCCGCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGGCCACAACCGGATCTTCCAGAAAGATGAGGATATTTGCTGTCTTTATATTCATGACCTACTGGCATTTGCTGAACGCATTTACTGTCACGGTTCCCAAGGACCTATATGTGGTAGAGTATGGTAGCAATATGACAATTGAATGCAAATTCCCAGTAGAAAAACAATTAGACCTGGCTGCACTAATTGTCTATTGGGAAATGGAGGATAAGAACATTATTCAATTTGTGCATGGAGAGGAAGACCTGAAGGTTCAGCATAGTAGCTACAGACAGAGGGCCCGGCTGTTGAAGGACCAGCTCTCCCTGGGAAATGCTGCACTTCAGATCACAGATGTGAAATTGCAGGATGCAGGGGTGTACCGCTGCATGATCAGCTATGGTGGTGCCGACTACAAGCGAATTACTGTGAAAGTCAATGCCCCATACAACAAAATCAACCAAAGAATTTTGGTTGTGGATCCAGTCACCTCTGAACATGAACTGACATGTCAGGCTGAGGGCTACCCCAAGGCCGAAGTCATCTGGACAAGCAGTGACCATCAAGTCCTGAGTGGTAAGACCACCACCACCAATTCCAAGAGAGAGGAGAAGCTTTTCAATGTGACCAGCACACTGAGAATCAACACAACAACTAATGAGATTTTCTACTGCACTTTTAGGAGATTAGATCCTGAGGAAAACCATACAGCTGAATTGGTCATCCCAGAACTACCTCTGGCACATCCTCCAAATGAAAGGACTCACTTGGTAATTCTGGGAGCCATCTTATTATGCCTTGGTGTAGCACTGACATTCATCTTCCGTTTAAGAAAAGGGAGAATGATGGATGTGAAAAAATGTGGCATCCAAGATACAAACTCAAAGAAGCAAAGTGATACACATTTGGAGGAGACGTAATCCGAATTCCGCTAGCAATTCCGCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGGCCACAACCAAACTAGTATGGCTTCGTACCCCGGCCATCAACACGCGTCTGCGTTCGACCAGGCTGCGCGTTCTCGCGGCCATAGCAACCGACGTACGGCGTTGCGCCCTCGCCGGCAGCAAGAAGCCACGGAAGTCCGCCCGGAGCAGAAAATGCCCACGCTACTGCGGGTTTATATAGACGGTCCCCACGGGATGGGGAAAACCACCACCACGCAACTGCTGGTGGCCCTGGGTTCGCGCGACGATATCGTCTACGTACCCGAGCCGATGACTTACTGGCGGGTGCTGGGGGCTTCCGAGACAATCGCGAACATCTACACCACACAACACCGCCTCGACCAGGGTGAGATATCGGCCGGGGACGCGGCGGTGGTAATGACAAGCGCCCAGATAACAATGGGCATGCCTTATGCCGTGACCGACGCCGTTCTGGCTCCTCATATCGGGGGGGAGGCTGGGAGCTCACATGCCCCGCCCCCGGCCCTCACCCTCATCTTCGACCGCCATCCCATCGCCGCCCTCCTGTGCTACCCGGCCGCGCGGTACCTTATGGGCAGCATGACCCCCCAGGCCGTGCTGGCGTTCGTGGCCCTCATCCCGCCGACCTTGCCCGGCACCAACATCGTGCTTGGGGCCCTTCCGGAGGACAGACACATCGACCGCCTGGCCAAACGCCAGCGCCCCGGCGAGCGGCTGGACCTGGCTATGCTGGCTGCGATTCGCCGCGTTTACGGGCTACTTGCCAATACGGTGCGGTATCTGCAGTGCGGCGGGTCGTGGCGGGAGGACTGGGGACAGCTTTCGGGGACGGCCGTGCCGCCCCAGGGTGCCGAGCCCCAGAGCAACGCGGGCCCACGACCCCATATCGGGGACACGTTATTTACCCTGTTTCGGGCCCCCGAGTTGCTGGCCCCCAACGGCGACCTGTATAACGTGTTTGCCTGGGCCTTGGACGTCTTGGCCAAACGCCTCCGTTCCATGCACGTCTTTATCCTGGATTACGACCAATCGCCCGCCGGCTGCCGGGACGCCCTGCTGCAACTTACCTCCGGGATGGTCCAGACCCACGTCACCACCCCCGGCTCCATACCGACGATATGCGACCTGGCGCGCACGTTTGCCCGGGAGATGGGGGAGGCTAACTGA(SEQ ID NO.4)

the polyA polyadenylation base motif component is:

CTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCGACTAGAGCTTGCGGAACCCTTC(SEQID NO.5)

and the base sequence of the downstream homology arm of the HPRT1 gene is: sequence 134500874 to134571880 in NCBI Reference Sequence NC-000023.11 (Homo sapiens chromosome X, GRCh38.p7Primary Assembly. NCBI Reference Sequence NC-000023.11 from base 134500874 to 134571880).

On the basis of the above-mentioned sequences, one or more bases may be substituted, but the activity is not changed, and such sequences are also suitable for the construction of the hESC-TK cell line of the invention.

See fig. 1b. configuration of alleles after homologous recombination, where black boxes represent the exon coding region of HPRT1 and white boxes represent the 3' untranslated region of HPRT 1. The black triangle arrows represent the positions of the primers identified by PCR. The dotted arrows identify the upstream and downstream homology arms, respectively, where the upstream homology arm is 124kb and the downstream homology arm is 71 kb.

pCAG/Neo/IRES/Puro/polyA knock into the beginning of the 3' untranslated region of the HPRT1 gene, the gene expression cassette disrupts the function of the HPRT1 gene, and the cell is thus sensitive to thioguanine. Therefore, we can use puromycin and thioguanine (6-TG) to perform double selection on positive clones of the correct knock-in gene, and after transfection of pCAG/Cre/polyA, Cre enzyme-mediated Loxp homologous recombination can delete the expression cassette of the resistance selection gene, thereby restoring normal HPRT1 function to the cells.

1.3hESCs cell transfection and selection

A linearized targeting Bac vector is transfected into hESCs cells by using a type II gene pulse cell electroporator. The specific parameters of electrotransfection are: 0.4cm electric cup, 320volt, 200 μ F, cell number 2X10⁷The Bac vector, 30. mu.g in mass, was resuspended in 750. mu.l of PBS for electrotransfection. After transfection, the cells were allowed to resume growth for 48 hours by adding to a culture dish containing a DR4 mouse embryo fibroblast feeder layer and culture medium, followed by 3 days of culture by adding a culture medium containing puromycin at a concentration of 0.5. mu.g/ml. And when the cells grow until the monoclonals are visible under a microscope, adding a culture solution containing 1mM thioguanine to perform secondary screening for three days, separating out the surviving monoclonals, and inoculating the monoclonals to a 96-well plate to obtain the CPTK-hESCs cells.

Example 2: identification of CPTK-hESCs cells

2.1PCR detection

And (3) identifying the gene knock-in cell line CPTK-hESCs after homologous recombination by using a PCR technology. As shown in FIGS. 1A and C, forward primer p1 (5'-AATGTCAGTTGCTGCATTCC-3') and reverse primers p2 (5'-CTGCTGACAAAGATTCACTGG-3'), p5 (5'-GAAAGTCCCTATTGGCGTTAC-3'), wild-type allele is amplified from p1 and p2 to obtain a wild-type band with a length of 404 bp; after Bac homologous recombination and before Loxp-Cre homologous recombination, a band with the length of 311bp is obtained by amplifying p1 and p 5; after Bac homologous recombination and Loxp-Cre homologous recombination, a band with the length of 503 is obtained by amplifying p1 and p 5. A forward primer p3 and reverse primers p4 and p5, wherein the wild type allele is amplified from p3 (5'-CTGTTGGTTCCATTTTCCTTG-3') and p4 (5'-GGCTCCTAAGTTTGATAGTTC-3') to obtain a band with the length of 406 bp; after Bac homologous recombination, a band with the length of 277bp is obtained by amplifying p3 and p 5. See fig. 1C.

2.2 drug sensitivity test

Corresponding hESCs were seeded in 12-well cell culture plates and 24 hours later, the culture broth was replaced with: 1. normal hESCs cell culture; 2. hESCs medium containing 100. mu.M hypoxanthin/0.4. mu.M amitriptein/6. mu.M thymine (HAT); 3. hESCs culture containing 1mM 6-TG. After 3 days of culture, the Alkaline phosphatase assay was performed according to the manufacturer's instructions.

The function of the HPRT gene of the wild cell is normal, after Bac homologous recombination, the HPRT gene loses the function due to the insertion of the screening resistance gene frame, and after Loxp-Cre homologous recombination, the screening resistance gene frame is deleted, and the cell obtains the function of the HPRT again. Loss of HPRT function results in insensitivity of cells to 6-TG, whereas cells with normal HPRT function are sensitive to HAT. FIG. 1D demonstrates the functional presence or absence of cellular HPRT. Wild Type (WT) hESCs cells were sensitive to 6TG and insensitive to HAT indicating that the HPRT gene was functioning properly; Loxp-Cre homologous recombination pre- (Cre-) cells are insensitive to 6TG, sensitive to HAT represent HPRT functional deletion; after Loxp-Cre homologous recombination (Cre +) cells are sensitive to 6TG and insensitive to HAT, which indicates that the cells regain HPRT function.

2.3Western Blotting experiment

The corresponding hESCs culture density was over 90%, and the culture solution was replaced with the basal DMEM culture solution. After 24 hours, two aliquots of approximately 1ml of each culture were removed, boiled in 1 Xloading buffer, one of which was added to beta-merictoethanol, electrophoresed according to conventional Western blotting to separate proteins and transfer them to membranes, incubated with HRP-conjugated coat anti-human immunoglobulin G-Fc antibody and developed. As shown in FIG. 1E, CPTK-hESCs expressed CLTA4-Ig at the protein level, while wild-type hECCs did not express CLTA 4-Ig.

2.4 flow cytometry detection of PD-L1 and hESCs surface markers

Expression analysis of surface human PD-L, SSEA-3, SSEA-4, TRA1-60 and TRA1-81 proteins was performed on CPTK-hESCs cells using a BD LSR-II flow cytometer. The data were further analyzed by FACS Diva (Becton Dickinson) and FlowJo software. 1x10⁶Cells were washed with PBS and stained with DAPI, PE anti-PD-L1, PEanti-SSEA-3, PE anti-SSEA-4, PE anti-TRA1-60, PE anti-TRA1-81 for 45 minutes at room temperature. After staining, cells were washed twice with PBS, resuspended in FACS buffer and then machine analyzed. The results in FIG. 1F and FIG. 2A show that the surface of CPTK-hESCs highly expresses PD-L1 protein and the indicated marker proteins of the human embryonic stem cells such as SSEA-3, SSEA-4, TRA1-60 and TRA 1-81.

2.5 teratoma test

Culturing CPTK-hESCs to the density of more than 90%, digesting cells with TrypLE, resuspending and washing with PBS, counting cells, and selecting 2X10⁶Cells/injection. In one injection, 50ul Matrigel (BD) was added after resuspending the cells with 100ul PBS and injected subcutaneously into NSG mice. Waiting for about 4-6 weeks, collecting teratoma when it grows to 1-2cm diameter, and performing conventional H treatment&E, staining analysis. Fig. 2C shows that teratomas have three germ layer cell types.

2.6qPCR detection of totipotency of CPTK-hESCs

The culture density of CPTK-hESCs and wild type hESCs is more than 90%, cells are harvested, RNA is extracted according to the instruction of a reagent manufacturer, cDNA reverse transcription is carried out, qPCR is carried out to detect the totipotent gene expression quantity of related human embryonic stem cells, and the result is shown in figure 2B. CPTK-hESCs have totipotent gene expression.

2.7TK expression detection

CPTK-hESCs and wild type hESCs were grown to a density of about 60% by adding GCV (0nM, 10nM, 20nM, 40nM, 80nM and 160nM) at different concentrations for three days, followed by fixation of the cells in 4% paraformaldehyde PBS according to the instructions of the manufacturer and subsequent staining with crystal violet, as shown in FIG. 2D, the sensitivity of CPTK-hESCs to GCV was concentration gradient dependent.

CPTK-hESCs and wild type hESCs were passaged to 24-well plates, and GCV was added to a final concentration of 160nM starting after day 3 for 4 days, and cell counting was performed daily for the first 7 days and again on additional days 14 and 21. As a result, CPTK-hESCs could be completely eliminated by GCV as shown in FIG. 2E.

Example 3: in vivo functional assays for CPTK-hESCs

3.1 immunotolerance experiments of CPTK-hESCs in humanized mice

Culturing CPTK-hESCs and wild type hESCs to the density of more than 90%, digesting cells with TrypLE, resuspending and washing with PBS, counting cells, selecting a certain number of cells for subcutaneous injection, wherein the number of the cells injected by each NSG mouse is 2X10⁶The number of cells per injection of the humanized mouse was 4X10⁶. In one injection, 50ul Matrigel (BD) was added after resuspending the cells with 100ul PBS followed by subcutaneous injection. After waiting for about 4-6 weeks, collecting teratoma when the teratoma grows to 1-2cm diameter, taking picture, analyzing by flow cytometry, analyzing by immunofluorescence staining, and analyzing by H&E staining analysis and statistics of teratogenicityThe proportion of the aneurysm rejected. The results are shown in FIG. 3 (including FIG. 3A, B, C, D, E). It can be seen that CPTK-hESCs and wild type hESCs can form undifferentiated teratomas in non-immunized NSG mice, while wild type hESCs teratomas are significantly rejected in humanized mice with human immune system, and thus the existence of a large number of CD3 positive cells is seen, and the T lymphocyte infiltration characteristic is achieved; there was no evidence of rejection of CPTK-hESCs teratomas. H&E staining also further validated the conclusion.

3.2 functional validation of the in vivo Elimination of CPTK-hESCs teratomas by GCV

Culturing CPTK-hESCs and wild type hESCs to the density of more than 90%, digesting cells with TrypLE, resuspending and washing with PBS, counting cells, selecting a certain number of cells for subcutaneous injection, wherein the number of the cells injected by each NSG mouse is 2X10⁶The number of cells per injection of the humanized mouse was 4X10⁶. In one injection, 50ul Matrigel (BD) was added after resuspending the cells with 100ul PBS followed by subcutaneous injection. After 3 weeks, half of the mice were injected intraperitoneally with GCV at a dose of 30mg/kg 1 time per day for 3 weeks, and teratoma size was recorded by taking pictures each day. Subsequently, teratomas were harvested for immunofluorescent staining analysis. Fig. 4A shows that CPTK teratomas shrink with time compared to wild-type teratomas, and that CPTK-hESCs teratomas have minimal volume at final dissection, and in order to verify whether the residual sites are derived from CPTK-hESCs, we performed immunofluorescent staining assays using human specific antibody anti-human nuclear antigen, see fig. 4B, which shows that the residual tissue is not derived from CPTK-hESCs, and that the assays may be formed by the migration of fibroblasts in the mouse during teratoma formation. Fig. 4C makes statistics of the repeat test.

3.3 functional validation of the in vivo depletion of CPTK-hESCs differentiated cardiomyocytes by GCV

According to literature reports [ Lian X, Hsiao C, Wilson G et al, robust cardiac muscular differentiation from human cervical cells via temporal modulation of metabolic Wnt signaling. proceedings of the National Academy of Sciences' National states of America.2012; 109: E1848-1857] differentiation of cardiomyocytes was performed CPTK-hESCs and wild type hESCs were cultured in 6-well plates covered with Matrigel to a density of about 100%, after which differentiation was initiated, RPMI1640/B27 (without insulin) containing 12. mu.M CHIR99021 was added on day 1 and cultured for 24 hours, followed by removal of CHIR 99021. On day 3, RPMI1640/B27 (without insulin) containing 5. mu.M IWP4 was added and cultured for 48 hours, after which IWP4 was removed. On day 7, the culture medium was changed to RPMI1640/B27 (containing insulin). Culturing until the cells start to jump, and changing the liquid every other day.

And (3) carrying out qPCR (quantitative polymerase chain reaction) detection on the gene expression quantity of the differentiated cardiac muscle cells, and detecting the expression of cardiac muscle cell markers by flow cytometry. The results are shown in FIG. 5A, B, where the differentiated cells have the characteristics of cardiomyocytes. Subsequently, the cells were harvested and 6X10 was taken⁶Cells were injected intramuscularly, 50. mu.l of PBS was used to resuspend the cells, 50. mu.l of Matrigel was added thereto and mixed well, and injected into the hind leg muscle of mice. The first half of the following day mice were injected intraperitoneally with GCV at a dose of 30mg/kg 1 time a day for 2 weeks, and then muscle tissue was harvested for immunofluorescent staining analysis. As shown in FIG. 5C, GCV was able to effectively eliminate cardiomyocytes derived from CPTK-hESCs, while cardiomyocytes derived from CPTK-hESCs were able to withstand immune system challenge in humanized mice.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

SEQUENCE LISTING

<110> Guangdong Shengsai Biotech Co., Ltd

SOUTHERN MEDICAL University

<120> hESCs-TK cell line, and construction method and application thereof

<160>5

<170>PatentIn version 3.3

<210>1

<211>34

<212>DNA

<213> Artificial sequence

<400>1

ataacttcgt ataatgtatg ctatacgaag ttat 34

<210>2

<211>1722

<212>DNA

<213> Artificial sequence

<400>2

tcgacattga ttattgacta gttattaata gtaatcaatt acggggtcat tagttcatag 60

cccatatatg gagttccgcg ttacataact tacggtaaat ggcccgcctg gctgaccgcc 120

caacgacccc cgcccattga cgtcaataat gacgtatgtt cccatagtaa cgccaatagg 180

gactttccat tgacgtcaat gggtggacta tttacggtaa actgcccact tggcagtaca 240

tcaagtgtat catatgccaa gtacgccccc tattgacgtc aatgacggta aatggcccgc 300

ctggcattat gcccagtaca tgaccttatg ggactttcct acttggcagt acatctacgt 360

attagtcatc gctattacca tgggtcgagg tgagccccac gttctgcttc actctcccca 420

tctccccccc ctccccaccc ccaattttgt atttatttat tttttaatta ttttgtgcag 480

cgatgggggc gggggggggg ggggcgcgcg ccaggcgggg cggggcgggg cgaggggcgg 540

ggcggggcga ggcggagagg tgcggcggca gccaatcaga gcggcgcgct ccgaaagttt 600

ccttttatgg cgaggcggcg gcggcggcgg ccctataaaa agcgaagcgc gcggcgggcg 660

ggagtcgctg cgttgccttc gccccgtgcc ccgctccgcg ccgcctcgcg ccgcccgccc 720

cggctctgac tgaccgcgtt actcccacag gtgagcgggc gggacggccc ttctcctccg 780

ggctgtaatt agcgcttggt ttaatgacgg ctcgtttctt ttctgtggct gcgtgaaagc 840

cttaaagggc tccgggaggg ccctttgtgc gggggggagc ggctcggggg gtgcgtgcgt 900

gtgtgtgtgc gtggggagcg ccgcgtgcgg cccgcgctgc ccggcggctg tgagcgctgc 960

gggcgcggcg cggggctttg tgcgctccgc gtgtgcgcga ggggagcgcg gccgggggcg 1020

gtgccccgcg gtgcgggggg gctgcgaggg gaacaaaggc tgcgtgcggg gtgtgtgcgt 1080

gggggggtga gcagggggtg tgggcgcggc ggtcgggctg taaccccccc ctgcaccccc 1140

ctccccgagt tgctgagcac ggcccggctt cgggtgcggg gctccgtgcg gggcgtggcg 1200

cggggctcgc cgtgccgggc ggggggtggc ggcaggtggg ggtgccgggc ggggcggggc 1260

cgcctcgggc cggggagggc tcgggggagg ggcgcggcgg ccccggagcg ccggcggctg 1320

tcgaggcgcg gcgagccgca gccattgcct tttatggtaa tcgtgcgaga gggcgcaggg 1380

acttcctttg tcccaaatct ggcggagccg aaatctggga ggcgccgccg caccccctct 1440

agcgggcgcg ggcgaagcgg tgcggcgccg gcaggaagga aatgggcggg gagggccttc 1500

gtgcgtcgcc gcgccgccgt ccccttctcc atctccagcc tcggggctgc cgcaggggga 1560

cggctgcctt cgggggggac ggggcagggc ggggttcggc ttctggcgtg tgaccggcgg 1620

ctctagagcc tctgctaacc atgttcatgc cttcttcttt ttcctacagc tcctgggcaa 1680

cgtgctggtt attgtgctgt ctcatcattt tggcaaagaa tt 1722

<210>3

<211>2009

<212>DNA

<213> Artificial sequence

<400>3

atgggatcgg ccattgaaca agatggattg cacgcaggtt ctccggccgc ttgggtggag 60

aggctattcg gctatgactg ggcacaacag acaatcggct gctctgatgc cgccgtgttc 120

cggctgtcag cgcaggggcg cccggttctt tttgtcaaga ccgacctgtc cggtgccctg 180

aatgaactgc aggacgaggc agcgcggcta tcgtggctgg ccacgacggg cgttccttgc 240

gcagctgtgc tcgacgttgt cactgaagcg ggaagggact ggctgctatt gggcgaagtg 300

ccggggcagg atctcctgtc atctcacctt gctcctgccg agaaagtatc catcatggct 360

gatgcaatgc ggcggctgca tacgcttgat ccggctacct gcccattcga ccaccaagcg 420

aaacatcgca tcgagcgagc acgtactcgg atggaagccg gtcttgtcga tcaggatgat 480

ctggacgaag agcatcaggg gctcgcgcca gccgaactgt tcgccaggct caaggcgcgc 540

atgcccgacg gcgatgatct cgtcgtgacc catggcgatg cctgcttgcc gaatatcatg 600

gtggaaaatg gccgcttttc tggattcatc gactgtggcc ggctgggtgt ggcggaccgc 660

tatcaggaca tagcgttggc tacccgtgat attgctgaag agcttggcgg cgaatgggct 720

gaccgcttcc tcgtgcttta cggtatcgcc gctcccgatt cgcagcgcat cgccttctat 780

cgccttcttg acgagttctt ctgaggggat caattcaatt ccgcccctct ccctcccccc 840

cccctaacgt tactggccga agccgcttgg aataaggccg gtgtgcgttt gtctatatgt 900

tattttccac catattgccg tcttttggca atgtgagggc ccggaaacct ggccctgtct 960

tcttgacgag cattcctagg ggtctttccc ctctcgccaa aggaatgcaa ggtctgttga 1020

atgtcgtgaa ggaagcagtt cctctggaag cttcttgaag acaaacaacg tctgtagcga 1080

ccctttgcag gcagcggaac cccccacctg gcgacaggtg cctctgcggc caaaagccac 1140

gtgtataaga tacacctgca aaggcggcac aaccccagtg ccacgttgtg agttggatag 1200

ttgtggaaag agtcaaatgg ctctcctcaa gcgtattcaa caaggggctg aaggatgccc 1260

agaaggtacc ccattgtatg ggatctgatc tggggcctcg gtgcacatgc tttacatgtg 1320

tttagtcgag gttaaaaaac gtctaggccc cccgaaccac ggggacgtgg ttttcctttg 1380

aaaaacacga tgataatatg gccacaacca tgaccgagta caagcccacg gtgcgcctcg 1440

ccacccgcga cgacgtcccc agggccgtac gcaccctcgc cgccgcgttc gccgactacc 1500

ccgccacgcg ccacaccgtc gatccggacc gccacatcga gcgggtcacc gagctgcaag 1560

aactcttcct cacgcgcgtc gggctcgaca tcggcaaggt gtgggtcgcg gacgacggcg 1620

ccgcggtggc ggtctggacc acgccggaga gcgtcgaagc gggggcggtg ttcgccgaga 1680

tcggcccgcg catggccgag ttgagcggtt cccggctggc cgcgcagcaa cagatggaag 1740

gcctcctggc gccgcaccgg cccaaggagc ccgcgtggtt cctggccacc gtcggcgtct 1800

cgcccgacca ccagggcaag ggtctgggca gcgccgtcgt gctccccgga gtggaggcgg 1860

ccgagcgcgc cggggtgccc gccttcctgg agacctccgc gccccgcaac ctccccttct 1920

acgagcggct cggcttcacc gtcaccgccg acgtcgaggt gcccgaagga ccgcgcacct 1980

ggtgcatgac ccgcaagccc ggtgcctga 2009

<210>4

<211>4387

<212>DNA

<213> Artificial sequence

<400>4

atgggggtac tgctcacaca gaggacgctg ctcagtctgg tccttgcact cctgtttcca 60

agcatggcga gcatggcaat gcacgtggcc cagcctgctg tggtactggc cagcagccga 120

ggcatcgcca gctttgtgtg tgagtatgca tctccaggca aagccactga ggtccgggtg 180

acagtgcttc ggcaggctga cagccaggtg actgaagtct gtgcggcaac ctacatgatg 240

gggaatgagt tgaccttcct agatgattcc atctgcacgg gcacctccag tggaaatcaa 300

gtgaacctca ctatccaagg actgagggcc atggacacgg gactctacat ctgcaaggtg 360

gagctcatgt acccaccgcc atactacctg ggcataggca acggaaccca gatttatgta 420

attgatccag aaccgtgccc agattctgat caggagccca aatcttctga caaaactcac 480

acatccccac cgtccccagc acctgaactc ctggggggat cgtcagtctt cctcttcccc 540

ccaaaaccca aggacaccct catgatctcc cggacccctg aggtcacatg cgtggtggtg 600

gacgtgagcc acgaagaccc tgaggtcaag ttcaactggt acgtggacgg cgtggaggtg 660

cataatgcca agacaaagcc gcgggaggag cagtacaaca gcacgtaccg tgtggtcagc 720

gtcctcaccg tcctgcacca ggactggctg aatggcaagg agtacaagtg caaggtctcc 780

aacaaagccc tcccagcccc catcgagaaa accatctcca aagccaaagg gcagccccga 840

gaaccacagg tgtacaccct gcccccatcc cgggatgagc tgaccaagaa ccaggtcagc 900

ctgacctgcc tggtcaaagg cttctatccc agcgacatcg ccgtggagtg ggagagcaat 960

gggcagccgg agaacaacta caagaccacg cctcccgtgc tggactccga cggctccttc 1020

ttcctctaca gcaagctcac cgtggacaag agcaggtggc agcaggggaa cgtcttctca 1080

tgctccgtga tgcatgaggc tctgcacaac cactacacgc agaagagcct ctccctgtct 1140

ccgggtaaat gagaattgaa ttccgcccct ctccctcccc cccccctaac gttactggcc 1200

gaagccgctt ggaataaggc cggtgtgcgt ttgtctatat gttattttcc accatattgc 1260

cgtcttttgg caatgtgagg gcccggaaac ctggccctgt cttcttgacg agcattccta 1320

ggggtctttc ccctctcgcc aaaggaatgc aaggtctgtt gaatgtcgtg aaggaagcag 1380

ttcctctgga agcttcttga agacaaacaa cgtctgtagc gaccctttgc aggcagcgga 1440

accccccacc tggcgacagg tgcctctgcg gccaaaagcc acgtgtataa gatacacctg 1500

caaaggcggc acaaccccag tgccacgttg tgagttggat agttgtggaa agagtcaaat 1560

ggctctcctc aagcgtattc aacaaggggc tgaaggatgc ccagaaggta ccccattgta 1620

tgggatctga tctggggcct cggtgcacat gctttacatg tgtttagtcg aggttaaaaa 1680

acgtctaggc cccccgaacc acggggacgt ggttttcctt tgaaaaacac gatgataata 1740

tggccacaac cggatcttcc agaaagatga ggatatttgc tgtctttata ttcatgacct 1800

actggcattt gctgaacgca tttactgtca cggttcccaa ggacctatat gtggtagagt 1860

atggtagcaa tatgacaatt gaatgcaaat tcccagtaga aaaacaatta gacctggctg 1920

cactaattgt ctattgggaa atggaggata agaacattat tcaatttgtg catggagagg 1980

aagacctgaa ggttcagcat agtagctaca gacagagggc ccggctgttg aaggaccagc 2040

tctccctggg aaatgctgca cttcagatca cagatgtgaa attgcaggat gcaggggtgt 2100

accgctgcat gatcagctat ggtggtgccg actacaagcg aattactgtg aaagtcaatg 2160

ccccatacaa caaaatcaac caaagaattt tggttgtgga tccagtcacc tctgaacatg 2220

aactgacatg tcaggctgag ggctacccca aggccgaagt catctggaca agcagtgacc 2280

atcaagtcct gagtggtaag accaccacca ccaattccaa gagagaggag aagcttttca 2340

atgtgaccag cacactgaga atcaacacaa caactaatga gattttctac tgcactttta 2400

ggagattaga tcctgaggaa aaccatacag ctgaattggt catcccagaa ctacctctgg 2460

cacatcctcc aaatgaaagg actcacttgg taattctggg agccatctta ttatgccttg 2520

gtgtagcact gacattcatc ttccgtttaa gaaaagggag aatgatggat gtgaaaaaat 2580

gtggcatcca agatacaaac tcaaagaagc aaagtgatac acatttggag gagacgtaat 2640

ccgaattccg ctagcaattc cgcccctctc cctccccccc ccctaacgtt actggccgaa 2700

gccgcttgga ataaggccgg tgtgcgtttg tctatatgtt attttccacc atattgccgt 2760

cttttggcaa tgtgagggcc cggaaacctg gccctgtctt cttgacgagc attcctaggg 2820

gtctttcccc tctcgccaaa ggaatgcaag gtctgttgaa tgtcgtgaag gaagcagttc 2880

ctctggaagc ttcttgaaga caaacaacgt ctgtagcgac cctttgcagg cagcggaacc 2940

ccccacctgg cgacaggtgc ctctgcggcc aaaagccacg tgtataagat acacctgcaa 3000

aggcggcaca accccagtgc cacgttgtga gttggatagt tgtggaaaga gtcaaatggc 3060

tctcctcaag cgtattcaac aaggggctga aggatgccca gaaggtaccc cattgtatgg 3120

gatctgatct ggggcctcgg tgcacatgct ttacatgtgt ttagtcgagg ttaaaaaacg 3180

tctaggcccc ccgaaccacg gggacgtggt tttcctttga aaaacacgat gataatatgg 3240

ccacaaccaa actagtatgg cttcgtaccc cggccatcaa cacgcgtctg cgttcgacca 3300

ggctgcgcgt tctcgcggcc atagcaaccg acgtacggcg ttgcgccctc gccggcagca 3360

agaagccacg gaagtccgcc cggagcagaa aatgcccacg ctactgcggg tttatataga 3420

cggtccccac gggatgggga aaaccaccac cacgcaactg ctggtggccc tgggttcgcg 3480

cgacgatatc gtctacgtac ccgagccgat gacttactgg cgggtgctgg gggcttccga 3540

gacaatcgcg aacatctaca ccacacaaca ccgcctcgac cagggtgaga tatcggccgg 3600

ggacgcggcg gtggtaatga caagcgccca gataacaatg ggcatgcctt atgccgtgac 3660

cgacgccgtt ctggctcctc atatcggggg ggaggctggg agctcacatg ccccgccccc 3720

ggccctcacc ctcatcttcg accgccatcc catcgccgcc ctcctgtgct acccggccgc 3780

gcggtacctt atgggcagca tgacccccca ggccgtgctg gcgttcgtgg ccctcatccc 3840

gccgaccttg cccggcacca acatcgtgct tggggccctt ccggaggaca gacacatcga 3900

ccgcctggcc aaacgccagc gccccggcga gcggctggac ctggctatgc tggctgcgat 3960

tcgccgcgtt tacgggctac ttgccaatac ggtgcggtat ctgcagtgcg gcgggtcgtg 4020

gcgggaggac tggggacagc tttcggggac ggccgtgccg ccccagggtg ccgagcccca 4080

gagcaacgcg ggcccacgac cccatatcgg ggacacgtta tttaccctgt ttcgggcccc 4140

cgagttgctg gcccccaacg gcgacctgta taacgtgttt gcctgggcct tggacgtctt 4200

ggccaaacgc ctccgttcca tgcacgtctt tatcctggat tacgaccaat cgcccgccgg 4260

ctgccgggac gccctgctgc aacttacctc cgggatggtc cagacccacg tcaccacccc 4320

cggctccata ccgacgatat gcgacctggc gcgcacgttt gcccgggaga tgggggaggc 4380

taactga 4387

<210>5

<211>303

<212>DNA

<213> Artificial sequence

<400>5

ctagagctcg ctgatcagcc tcgactgtgc cttctagttg ccagccatct gttgtttgcc 60

cctcccccgt gccttccttg accctggaag gtgccactcc cactgtcctt tcctaataaa 120

atgaggaaattgcatcgcat tgtctgagta ggtgtcattc tattctgggg ggtggggtgg 180

ggcaggacag caagggggag gattgggaag acaatagcag gcatgctggg gatgcggtgg 240

gctctatggc ttctgaggcg gaaagaacca gctggggctc gactagagct tgcggaaccc 300

ttc 303

Claims

1. A CPTK-hESCs cell line, which is obtained by knocking-in the TK gene into the hESCs at the site of the housekeeping gene HPRT 1.

2. A construction method of a CPTK-hESCs cell line is characterized by comprising the following steps:

culturing hESCs;

B. constructing a homologous recombination repair template, wherein the repair template DNA vector sequentially comprises an HPRT1 gene upstream homologous arm, a LoxP site, a CAG promoter, a resistance screening gene Puro/IRES/Neo, a LoxP site, a CAG promoter, a target gene CTLA4-Ig/IRES/PD-L1/IRES/TK, polyA polyadenylic acid and an HPRT1 gene downstream homologous arm from the 5 'end to the 3' end;

3. The process according to claim 2, wherein the puromycin concentration in the medium is 1.5 to 2.0. mu.g/ml.

4. The method according to claim 2, wherein the concentration of 6-thioguanine in the medium is 0.5 to 1.5 mM.

5. The method according to any one of claims 2 to 4, wherein the specific parameters of the electrotransfection in step C are: 0.4cm electric cup, 320volt, 200 μ F, cell number 10 × 10⁶-40x10⁶The mass of the Bac carrier is 20-40 mu g.

6. The method according to any one of claims 2 to 4, wherein the base sequence of the LoxP site is: a sequence shown as SEQ ID NO.1 or a sequence shown as SEQ ID NO.1, wherein one or more basic groups are substituted but the activity is not changed; and/or the CAG promoter base sequence is: a sequence shown as SEQ ID NO.2 or a sequence shown as SEQ ID NO.2 in which one or more bases are substituted but the activity is not changed.

7. The method according to any one of claims 2 to 4, wherein the base sequence of the resistance selection gene Puro/IRES/Neo is the sequence shown in SEQ ID NO. 3; or a sequence as shown in SEQ ID NO.3 in which one or more bases are substituted but the activity is not changed; and/or polyA polyadenylation base sequence: a sequence shown as SEQ ID NO.5, or a sequence shown as SEQ ID NO.5 in which one or more bases are substituted but the activity is not changed.

8. The preparation method of any one of claims 2 to 4, wherein the base sequence of the target gene CTLA4-Ig/IRES/PD-L1/IRES/TK is: a sequence shown as SEQ ID NO. 4; or a sequence as shown in SEQ ID NO.4 in which one or more bases are substituted but the activity is not changed.

9. The method according to any one of claims 2 to 4, wherein the sequence of the upstream homology arm of the HPRT1 gene is: a base sequence from 134376991 to134500246 in the sequence number NC-000023.11 of NCBI, or a sequence from 134376991 to134500246 in the sequence number NC-000023.11 of NCBI in which one or more bases are substituted but the activity is not changed; and/or the base sequence component of the downstream homology arm of the HPRT1 gene is: the sequence number of NCBI is the sequence from 134500874 to134571880 in NC-000023.11, or the sequence from 134500874 to134571880 in NC-000023.11, wherein one or more bases are substituted, but the activity is not changed.

10. Use of the CPTK-hESCs cell line of claim 1 in the preparation of a biological agent to eliminate the risk of stem cell derived cell canceration escaping immune surveillance.