WO2016060537A2 - Probes and primers for the rapid and reliable quantification of the genes specific to prostate cancer, using suitable reference genes - Google Patents

Probes and primers for the rapid and reliable quantification of the genes specific to prostate cancer, using suitable reference genes Download PDF

Info

Publication number
WO2016060537A2
WO2016060537A2 PCT/MA2015/000022 MA2015000022W WO2016060537A2 WO 2016060537 A2 WO2016060537 A2 WO 2016060537A2 MA 2015000022 W MA2015000022 W MA 2015000022W WO 2016060537 A2 WO2016060537 A2 WO 2016060537A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
genes
gene
erg
tmprss2
Prior art date
Application number
PCT/MA2015/000022
Other languages
French (fr)
Other versions
WO2016060537A3 (en
Inventor
Abdeladim MOUMEN
Imane ABDELLAOUI-MAANE
El Hassane SEFRIOUI
Original Assignee
Moroccan Foundation For Advanced Science, Innovation & Research (Mascir)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Moroccan Foundation For Advanced Science, Innovation & Research (Mascir) filed Critical Moroccan Foundation For Advanced Science, Innovation & Research (Mascir)
Publication of WO2016060537A2 publication Critical patent/WO2016060537A2/en
Publication of WO2016060537A3 publication Critical patent/WO2016060537A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2545/00—Reactions characterised by their quantitative nature
    • C12Q2545/10—Reactions characterised by their quantitative nature the purpose being quantitative analysis
    • C12Q2545/101—Reactions characterised by their quantitative nature the purpose being quantitative analysis with an internal standard/control
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes

Definitions

  • the present invention relates to novel sets of primers and probes and their use for the detection of prostate-specific genes namely the PCA3, TMPRSS2-ERG and AMACR genes and control genes chosen from the RPL5, HPRT1, and HNRNPA1 genes. for the standardization of target gene expression analysis data from patient samples whether tissue samples or biological fluids.
  • the sets of primers and probes of the target genes and reference genes are more sensitive than those mentioned in literature and will be used in real-time PCR (qPCR) in simplex or multiplex format for a reliable, fast and less expensive quantification.
  • the present invention will eventually be the basis of a kit for the molecular diagnosis of prostate cancer from a biological sample taken from a patient according to which the expression of at least one of the target genes (PCA3, TMPRSS2-ERG, AMACR) in simplex or multiplex reaction.
  • PCA Prostate cancer
  • PSA Prostate
  • CaP mortality rates are less affected by diagnostic practices, but reflect differences in the management of prostate cancer around the world and the underlying risks.
  • PSA is a serine protease encoded by the PSA gene located on chromosome 19.
  • This glycoprotein is produced under the control of androgens by the glandular epithelial cells of the prostate and secreted in the seminal plasma to liquefy it.
  • This protein is normally confined to the prostate, but disruption of the anatomical integrity of this gland can compromise the cellular barriers that normally limit PSA within the prostate duct system, causing leakage into the bloodstream. or urine. Physical manipulation of the prostate can also increase serum PSA levels, which is not normally the case for a mild stimulus such as digital rectal examination (DRE).
  • DRE digital rectal examination
  • PSA leaks outside the prostate gland can occur in many cases, including urinary retention, inflammation or infection of the prostate, benign prostatic hyperplasia (BPH) and finally prostate cancer.
  • BPH benign prostatic hyperplasia
  • PSA circulates in two main forms, either in free form (fPSA which accounts for 10 to 40% of total PSA, a predominant form in BPH); is complexed with protease inhibitors, essentially alphal-antichyotrypsin (PSA-ACT) (60 to 90% of total PSA, predominant form in CaP) and ralpha2-macroglobulin (PSA-AMG).
  • protease inhibitors essentially alphal-antichyotrypsin (PSA-ACT) (60 to 90% of total PSA, predominant form in CaP) and ralpha2-macroglobulin (PSA-AMG).
  • the tPSA standard of 4 ng / ml corresponds to a mean decision threshold aimed at detecting the greatest number of cancers while trying to limit the number of unnecessary biopsies. It is true that the concept of measuring the ratio of free PSA / total PSA has made it possible to increase the specificity of screening for prostate cancer in men with tPSA between 4 and 10 ng / ml [Letran JL, Blasé AB, Loberiza FR et al. Ultrasound guided prostate needle biopsy: use of free to total PSA ratio in predicting prostatic carcnoma. 7. J. Urol. 1998: 60: 426-9]. However, there is no target value for which sensitivity and specificity are simultaneously high.
  • prostate biopsy is a key element to confirm CaP.
  • it is not 100% reliable.
  • the tissue sample collection is guided by transrectal ultrasound is six samples are required, but often these samples do not reveal cancer so a second set of biopsies where more than six samples is required.
  • the gene PCA3, or differential display code 3 (DD3) is located on chromosome 9q21-22 and consists of four exons (E1-E4) and three introns (11-13). It encodes at least four different transcripts, which are generated by alternative splicing and polyadenylation.
  • E1-E4 exons
  • U1-13 introns
  • PCA3 differential display code 3
  • PCA3 differential display code 3
  • Urology 2003; 62: 34-43. RT-PCR analysis revealed that PCA3 expression is limited to the prostate and absent in other tissues, in the same sense the Nothern blot analysis showed a low expression of PCA3 in normal prostate tissue compared to strong expression in the vast majority of prostate cancer 95%.
  • PCA3 in the diagnosis of CaP seems to stem from its expression specificity which is 66 to 140 times higher in prostate cancers than in normal or hyperplastic tissues.
  • PLoS One 2013; 8: e66278 On the basis of this very promising differential expression a diagnostic test from urine has been developed.
  • PCA3 RNA After verifying that PCA3 RNA can be detected in the urine [Hessels D, Klein Gunnewiek JM, van Oort I, Karthaus HF, Van Leenders GJ, van Balken B, et al. DD3 (PCA3) - Based Molecular Urine Analysis for the Diagnosis of Prostate Cancer. EurUrol 2003; 44: 8-15], the development of a quantitative quantitative assay technique was carried out. Currently it is the subject of a protocol clearly defined and well accepted by practitioners, systematized in a commercial kit (ProgensaTM PCA3 Assay, Gen-Probe ® ).
  • the PCA3 test is carried out in three steps: the selection of the RNA of interest, its amplification and its quantification. Selection is by the use of magnetic beads coated with oligonucleotides complementary to the RNA of interest. The amplification of this preselected RNA is based on transcription (Transcription-Mediated Amplification [TMA]). For quantitation, the amplified RNA is labeled with a luminescent complementary probe according to the Hybridization Protection Assay (HPA) technique. The number of copies is then evaluated by measuring the chemiluminescence, on the basis of a calibration curve.
  • TMA Transcription-Mediated Amplification
  • HPA Hybridization Protection Assay
  • a quantification of the PSA copy number makes it possible both to verify the informative nature of the urine sample (it contains prostate prostate epithelial cells) and to standardize the PCA3 RNA copy number [Groskopf J, Aubin SM, Deras IL, Blase A, Bodrug S, Clark C, et al. APTIMA PCA3 Molecular Urine Test: Development of a method to help in the diagnosis of prostate cancer. Clin Chem 2006; 52: 1089-95.].
  • the PSA mRNA copy number is less than 10,000, the sample is considered uninformative. It seems that the realization of the rectal examination or not would be likely to influence the quality of the sample, it is for this reason that the method of collection of the urine was standardized.
  • the collection consists of the collection of the first urinary stream that follows a rectal leaning (three pressures per prostate lobe, sufficient to depress the prostate surface by 1 cm, from the base to the apex), which aims to mobilize prostatic secretions enriched in prostatic epithelial cells, making it possible to increase the informative part of the sample.
  • a rectal leaning three pressures per prostate lobe, sufficient to depress the prostate surface by 1 cm, from the base to the apex
  • PCA3 score is established: it is defined by the ratio between PCA3 copy number and PSA copy number, which reflects the prostate cell richness of the sample and serves as a normalizer. .
  • the threshold value of the PCA3 score that has been set to consider a patient as positive is 35.
  • PCA3 appears to be recognized as the best marker of prostate cancer ever identified, some studies have. challenged this specificity, and found it exclusive to exon 4 of the PCA3 gene. [Gandini, O., Luci, L, Stigliano, A., Lucera, R., Di Silverio, F., Toscano, V., and Cardillo, M. R. Is DD3 a new prostate-specific gene? AnticancerRes., 23 (1A): 305-308, 2003.]. Thus, it remains necessary to clarify the question of the specificity of the PCA3 marker and provide tools that specifically identify PCA3 sequences associated with CaP.
  • Alpha-methylacyl-CoAracemase is a gene located on chromosome 5, it encodes a 382 amino acid enzyme involved in the beta-oxidation of branched chains of acids and derivatives.
  • AMACR is constantly overexpressed in the cancerous epithelium of the prostate; therefore, it becomes an ideal specific biomarker for cancer cells within the prostate gland
  • AMACR is considered an immunohistochemical marker useful for the diagnosis of prostate cancer.
  • PCA3 Another combination of PCA3 and the TMPRSS2-ERG fusion gene also appears to increase the sensitivity and specificity of detection of prostate cancer.
  • TMPRSS2-ETS fusion genes were considered rare events in epithelial tumors that are typically characterized by complex, nonspecific chromosomal alterations.
  • the recent demonstration of TMPRSS2-ETS fusion genes in a majority of prostate cancers represents a real revolution in the biological knowledge of these tumors, the most common variant (90% of cases) involves two genes TMPRSS2 (Transmembraneprotease, serine 2) and ERG (Ets Related Gene) located on chromosome 21 (TMPRSS2 at level 21q22.3 and ERG at level 21q22.2). In the physiological case, these two genes are expressed separately. [SalagierskiMaciej and Jack A. Schalken.PCA3 and TMPRSS2-ERG: Promising Biomarkers in Prostate Cancer Diagnosis. Cancers 2010; 2: 1432-1440].
  • the TMPRSS2 gene is a member of the transmembrane serine protease family 2 strongly expressed in both normal and cancerous prostatic cells consisting of 14 exons, with androgen-dependent sequences in its promoters, its expression is regulated by androgens.
  • the ERG gene belongs to the ETS family (The E26 Transformation Specifies) (ERG, ETV1, ETV4) encoding nuclear transcription factors, the ERG gene is formed of 11 exons characterized by ETS-binding DNA domains and various domains of protein interaction [Beuzeboc P, Soulie M, Richaud P, Solomon L et al. Fusion genes and prostate cancer.From discovery to prognosis and therapeutic perspectives. Progress in Urology 2009; 19: 819-824].
  • TMPRSS2 and ERG are due to intron deletions on the 21q, 22.2-3 chromosomes, these fusion genes involve the 5 'non-coding end of TMPRSS2 (21q22.3) and the 5' end of the members. of the family of ETS transcription factors that are either ERG (21q22.2), ETV1 (7p21.2) or ETV4 (17q21). They lead to overexpression of chimeric or abnormal proteins that could affect tumor progression.
  • the current standard method for the diagnosis of prostate cancer is based mainly on the PSA assay and the achievement of a rectal examination, when one of the two examinations and positive the patient is directed to a prostate biopsy directed by a transrectal ultrasound .
  • a first biopsy is negative and the PSA measurement remains high the use of the PCA3 urinary test becomes unavoidable.
  • the PCA3 urinary test is a diagnostic tool that seems to provide the serum PSA assay with a gain in specificity time and negative predictive value. His interest lies in the choice of the approach to prostate cancer diagnosis to adopt and better guide patients justifying prostate biopsies. However for the reasons mentioned above it is preferable to opt for another PCA3 transcript quantification method which can be used in combination with other molecular markers of prostate cancer which seems to lead to better performance than the use of the PCA3 score alone. So the use of another quantitative and qualitative technique at the same time will on the one hand to obtain a better sensitivity and reliability with a lower cost.
  • the present invention generally relates to the diagnosis of prostate cancer. More specifically, the present invention refers to a method of detecting prostate cancer in a patient sample using a set of novel probes and primers for the detection and quantitation of PCA3, AMACR and the TMPRSS2-ERG fusion gene.
  • the method of the present invention is an improvement of the other prior methods mentioned above and allows a) to gain in specificity by using three highly specific genes for prostate cancer b) to gain in sensitivity using new probes and primers more specific and more sensitive c) to detect, in contrast to other methods of the prior art, all the PCA3 splice variants, since the PCA3 probes and primers of the present invention are designated in such a way as to detect all the transcripts described so far, which will allow additional gain in specificity d) in reliability and reproducibility using more stable normalizing control genes than those of the prior art e) a reduction in the cost of consumables and time that the amplification of the transcripts of at least one of the PCA3, AMACR and TMPRSS2-ERG genes and the gene or genes Checks are done simultaneously in the same qPCR well.
  • the detection and quantification of transcripts of the target genes is done by the qPCR method in different steps a) to design and synthesize novel nucleotide sequences of probes and primers that hybridize specifically to the transcripts of the target genes or the control gene b) the control gene is selected from the group RPL5, HPRT1 and HNRNPA1 c)
  • the more sensitive and more specific quantification of the transcripts of the genesPCA3, AMACR and TMPRSS2-ERG is either by the H3CT method using a sample of cells expressing these genes in a normal way as a calibrator or by extrapolating the copy number of the transcripts of the target genes from a standard curve.
  • the latter is generated by a range of calibrant dilution constituted by a bacterial plasmid which contains both a target gene and reference gene sequence comprising the amplicons recognized on their corresponding cDNAs (d) the evolution of this ratio between a group of control patients with or without benign prostatic pathology and prostate cancer patients with positive or negative prostate biopsies, can determine a minimum threshold of detection and identification of patients candidates for management.
  • the primers allowing for example the detection of the PCA3 gene transcript in a biological sample have the oligonucleotide sequences: SEQ ID NO: 1, SEQ ID NO: 2, b) the primers for detect the transcript of the control gene for example RPL5 in a biological sample have oligonucleotide sequences selected from a group of: SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20.
  • the probe for detecting the PCA3 gene transcript in a sample test has a sequence SEQ ID: 3
  • the probe for detecting the transcript of the RPL5 control gene in a biological sample has a sequence SEQ ID: 21.
  • all the primers which amplify, for example, the transcripts of the PCA3 and RPL5 gene in an included biological sample a) for PCA3 for example, a "forward" primer having a sequence: SEQ ID NO: 1, and a "reverse” primer having a sequence SEQ ID NO: 2, b) for RPL5 for example, a "forward” primer having a sequence from the group: SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 and a "reverse” primer having a sequence selected from SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20.
  • the present invention also relates to a method for the detection of PCA3 and RPL5 gene transcripts in the same biological sample.
  • This method takes place in several steps, a) For PCA3, put a biological sample in contact with a "forward" primer having a sequence SEQ ID NO: 1, and a "reverse” primer selected SEQ ID NO: 2 under specific amplification conditions to generate a target sequence; b) For RPL5, bringing a biological sample into contact with a "forward" primer having a sequence selected from SEQ ID NO: 15, SEQ ID NO: 16, and a reverse primer selected from SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, under the conditions of specific amplification to generate a target sequence, c) Detect the amplification of the two target sequences, PCA3 and RPL5, in the same biological sample with two different probes.
  • the probe has a sequence SEQ ID NO: 3 and for RPL5, the probe has a sequence SEQ ID NO: 21.
  • the method of amplification of a gene consists in putting the biological sample in a amplification reaction in the presence of amplification reagents.
  • the amplification reaction may be PCR, RT-PCR or qPCR.
  • a probe contains a fluorescent unit (reporter) attached to the 5 'region of DNA, in addition to a quencher portion to the 3' region of DNA.
  • the quantification of the fluorescence unit allows the quantification of target genes and control genes (PCA3 or RPL5).
  • the amplification of the transcripts of the target genes: PCA3, AMACR or TMPRSS2-ERG and one of the reference genes: RPL5, HPRT1 or HNRNPA1 by the qPCR of the present invention can be in simplex format or multiplex.
  • Figure la Graph showing PCR cycles versus Delta Rn for PCA3 gene transcripts.
  • the PCA3 positive prostate cancer cell line (LNCaP) is used as the source of the genetic material undergoing qPCR of the present invention.
  • Five concentrations of cDNA DNA resulting from reverse transcription of all LNCaP mRNAs (1.25pg - 12.5 ng) were used.
  • Figure 1b Graph showing PCR cycles versus Delta Rn for AMACR gene transcripts.
  • the AMACR positive prostate cancer cell line (LNCaP) is used as the source of the genetic material undergoing a qPCR of the present invention.
  • 5 cDNA concentrations DNA resulting from reverse transcription of all LNCaP mRNAs (1.25 ⁇ g - 12.5 ng) were used.
  • Figure 1C Graph showing PCR cycles versus Delta Rn for transcripts of the TMPRSS2-ERG gene.
  • the prostate cancer cell line positive for TMPRSS2-ERG (VCaP) is used as the source of the genetic material undergoing qPCR of the present invention.
  • CDNA concentrations DNA resulting from reverse transcription of all VCaP mRNAs (1.25 ⁇ g - 12.5 ng) were used.
  • Figure 2a Standard curve (Cycle threshold (Ct) -versus-log amount cDNA) reconstituted by the results obtained in Figure la.
  • Figure 2b Standard curve (Cycle threshold (Ct) -versus-log amount cDNA) reconstituted by the results obtained in Figure lb.
  • Figure 2c Standard curve (Cycle threshold (Ct) -versus-log amount cDNA) reconstituted by the results obtained in Figure 1c.
  • Figure 3a Graph showing PCR cycles versus Delta Rn for transcripts of the RPL5 gene.
  • the positive prostate cancer cell line (LNCaP) is used as the source of the genetic material undergoing qPCR of the present invention.
  • 5 cDNA concentrations DNA resulting from reverse transcription of all LNCaP mRNAs (1.25 ⁇ g - 12.5 ng) were used.
  • Figure 3b Graph showing PCR cycles versus Delta Rn for transcripts of the HNRNPA1 gene.
  • the positive prostate cancer cell line (LNCaP) is used as the source of the genetic material undergoing qPCR of the present invention.
  • 5 cDNA concentrations DNA resulting from reverse transcription of all LNCaP mRNAs (1.25 ⁇ g - 12.5 ng) were used.
  • Figure 3c Graph showing PCR cycles versus Delta Rn for transcripts of the HNRNPA1 gene.
  • the positive prostate cancer cell line (LNCaP) is used as the source of the genetic material undergoing qPCR of the present invention.
  • 5 cDNA concentrations DNA resulting from reverse transcription of all LNCaP mRNAs (1.25 ⁇ g - 12.5 ng) were used.
  • Figure 4a Standard curve (Cycle threshold (Ct) -versus-log amount cDNA) reconstituted by the results obtained in Figure 4a.
  • Figure 4b Standard curve (Cycle threshold (Ct) -versus-log amount cDNA) reconstituted by the results obtained in Figure 4b.
  • Figure 4c Standard curve (Cycle threshold (Ct) -versus-log amount cDNA) reconstituted by the results obtained in Figure 4c.
  • Figure 5 Curves of the most stable and less stable control genes in prostate biopsies of cancer patients and non-cancer patients. The expression of several control genes was quantified by the qPCR of the present invention.
  • the present invention advocates novel probes, primers, primer sets, probe sets, and primers that can be used to amplify, detect, and more reliably quantify the genes specifically expressed in prostate cancer.
  • the invention also provides a method for detecting transcripts of the PCA3 and / or AMACR and / or TMPRSS2-ERG target genes and RPL5 and / or HPRT1 and / or HNRNPA1 control genes in a biological sample using the primers and probes mentioned above.
  • the set of primers and probes of the present invention allow a better sensitivity and specificity for detecting transcripts of target genes and control genes.
  • the amplification of the transcripts of the PCA3 and / or AMACR and / or TMPRSS2-ERG genes and of the RPL5 and / or HPRT1 and / or HNRNPA1 control genes is at least in qPCR in simplex or multiplexed format. thus making it possible to establish an assured diagnosis of prostate cancer and a gain in time and cost.
  • the more sensitive and specific detection and quantification will make it possible to select the candidate patients for appropriate management.
  • the word 'PCA3' described in the present invention represents the 'Prostate cancer antigen 3' gene which produces noncoding mRNAs, this gene is expressed only in the prostate tissue and overexpressed in the case of prostate cancer.
  • the word 'AMACR' described in the present invention represents the 'alpha-methylacyl-CoAracemase' gene which encodes an isomerase involved in the beta-oxidation of branched chains of fatty acids and derivatives, a high level of the AMACR protein and its activity is associated with prostate cancer.
  • the word "TMPRSS2-ERG” described in the present invention represents the fusion gene resulting from a translocation of the androgen-regulated gene TMPRSSS2 (transmembraneprotease serine 2) strongly expressed by normal and cancerous prostate cells, to the ERG gene which encodes factors. of transcription intervening in regulatory signaling pathways of cell growth, differentiation and carcinogenesis.
  • the detection and quantification of gene transcripts mentioned above makes it possible to establish a reliable diagnosis and to carry out appropriate treatment.
  • the word 'gene' used in the present invention refers to a nucleic acid sequence of the DNA molecule occupying a specific region in a chromosome and permits the encoding of instructions for RNA synthesis.
  • target gene' used in the present invention refers to genes whose detection and quantification is targeted in a biological sample for the diagnosis of prostate cancer.
  • Oligonucleotide is a sequence composed of DNA or RNA or their combination with a length that ranges from 10 to 70 nucleotides.
  • the oligonucleotides are generally obtained by chemical synthesis, in the form of a single strand.
  • Amplification as used herein refers to one or more methods capable of copying a nucleic acid thereby allowing an increase in the number of copies of a target nucleic acid sequence.
  • the amplified sequence may be a ribonucleotide acid (RNA) or a deoxyribonucleotide acid (DNA)
  • RNA ribonucleotide acid
  • DNA deoxyribonucleotide acid
  • 'reverse transcription' represents a method for the synthesis of complementary DNA (cDNA) from an RNA molecule.
  • the cDNA will be used in the PCR, RT-PCR or qPCR method.
  • primer refers to a sequence of oligonucleotides synthesized chemically or naturally.
  • the primer is the point of initiation of DNA synthesis under optimal temperature conditions and in the presence of specific enzyme, buffers, nucleotides and complementary nucleotide sequences.
  • the word 'probe' referred to herein refers to a nucleotide sequence that forms a hybrid structure with a target sequence in a molecule of a biological sample.
  • the word 'PCR' (polymerasechainreaction) as used in the present invention refers to a method of which a cDNA or DNA sample is added in a solution in the presence of unattached nucleotides (eg dNTPs), 2 oligonucleotide primers (forward and reverse); and DNA polymerase enzyme (preferably heat-resistant Taq polymerase) which catalyzes the formation of DNA from both primers and dNTPs.
  • dNTPs unattached nucleotides
  • 2 oligonucleotide primers forward and reverse
  • DNA polymerase enzyme preferably heat-resistant Taq polymerase
  • the mixed solution is heated to 94-96 ° C to denature the DNA molecule and form 2 single strands of DNA.
  • the primers will then bind specifically to the single-stranded DNA thereby allowing the DNA polymerase to catalyze the attachment of the dNTPs to the primers.
  • 'RT-PCR' reverse transcriptase-PCR
  • 'RT-PCR' reverse transcriptase-PCR
  • qPCR quantitative PCR or real time RT-PCR
  • the word "qPCR” represents a PCR method for studying the products of the PCR reaction during the first DNA amplification steps.
  • the PCR products are detected by probes labeled at the 5 'end by a transmitter fluorochrome (reporter), and at their 3' end by a fluorescent or non-fluorescent quencher, which inhibits the emission of the reporter when they are nearby.
  • the signal intensity of the fluorescence measured during the amplification reaction is proportional to the number of newly formed products (amplicons).
  • the measurement in DNA or cDNA is done in logarithm.
  • the detection and quantification of the number of copies of a target gene initially present in a biological sample by qPCR is generally derived from its C T (cycle threshold).
  • the CT depends on the amount of matrix initially present in the amplified biological sample and corresponds to the number of amplification cycles where the amplification curve crosses the threshold line. This line is placed at the exponential phase, so as to be clearly distinguishable from background noise.
  • the qPCR of the present invention uses TaqMan probes and the amplification analysis is made by ABI PRISM 7900HT 'sequenced detection system' which is a screening system that can detect and quantify nucleic acids.
  • ABI PRISM 7900HT 'sequenced detection system' which is a screening system that can detect and quantify nucleic acids.
  • the amount of the PCA3, AMACR and TMPRSS2-ERG genes and control genes is calculated by the software integrated into the ABI PRISM 7900HT system using either the relative quantization method or the standard curve.
  • the reporter of the probe can be FAM, JOE, YAKYE (YY) and the BBQ quencher, BHOJL, or TAMRA.
  • the simplex word of the present invention represents an assay which does not proceed simultaneously with other assays in the same reaction tube.
  • simplex qPCR reflects the detection and quantification of the copy number of a single gene in a reaction tube.
  • control gene represents a gene whose expression is ubiquitous, stable between different tissues, between individuals and whatever the experimental conditions.
  • the use of this endogenous control theoretically controls all steps of the experimental protocol, its expression reflecting not only the quantity and quality of the MRIA used, but also the efficiencies of RT and PCR.
  • ACTB ⁇ -actin
  • B2M ⁇ -2-microglobulin
  • GAPDH glycosyl dehydrogenase
  • HPRT hyperxanthineribosyltransferase
  • the multiplex word cited in the present invention refers to an assay that runs concurrently with at least one other assay in the same reaction tube.
  • the multiplexed qPCR recommends detection and quantification of the number of copies of at least 2 genes in the same reaction tube.
  • the 2 genes in question are either target genes, control genes or a target gene and a control gene, which can be simultaneously detected by qPCR.
  • the word 'biological sample' as described in the present invention refers to a body fluid, which fluid may be a serum, plasma, saliva, ejaculate or urine or a prostate tissue sample derived from a fresh or waxed biopsy tumor or not, not expressing, expressing or overexpressing the target genes.
  • the biological sample may be of human or animal origin that does not express, expressing or overexpressing the target genes that can be amplified using the primers and probes of the present invention.
  • Example 1 represents a description of the protocol used in the qPCR method of the present invention. The steps of RNA extraction, cDNA synthesis and qPCR are described in this protocol.
  • Example 2 Figure 1 and Figure 2 describe the high sensitivity and specificity of the qPCR of the present invention for detecting PCA3 and AMACR gene transcripts at human prostate cancer cell lines, LNCaP overexpressing PCA3 and AMACR.
  • the results of the qPCR of the present invention are shown in Figure 1 (amplification curve: cycle-vs-Delta Rn), Figure 2 (standard curve: amount of LNCaP cDNA vs. Ct values).
  • the quality values obtained are according to international IVD standards (R2> 0.95, slope between -3.0 and 3.9 and efficiency of 90-112)) with a standard curve at: a slope of -3.215, a R2 0.986 and an efficiency of 104.66 for the PCA3 gene ( Figure 2a); a slope of -3,393, an R2 of 0.998 and an efficiency of 97.101 for the AMACR gene ( Figure 2b)).
  • the amplification curves ( Figure 1) also show perfect paces.
  • Example 3: Figure 3 and Figure 4 describe the high sensitivity and specificity of the qPCR of the present invention for detecting transcripts of the control genes at the human prostate cancer cell line.
  • the results of the qPCR of the present invention are shown in Figure 3 (amplification curve: cycle-vs-Delta Rn), Figure 4 (standard curve: amount of LNCaP cDNA vs Ct-values).
  • the quality values obtained are according to international IVD standards (R2> 0.95, slope between -3.0 and 3.9 and efficiency of 90-112)) with a standard curve at a slope of -3.49, a R2 of 0.999 and an efficiency of 101, 884 for the RPL5 gene (Figure 4a); a slope of -3.278, an R2 of 0.996 and an efficiency of 101.884 for the HNRNPA1 gene (FIG. 4b) and a slope of -3.465, an R2 of 0.993 and an efficiency of 94.365 for the 1 HPRT1 gene (FIG. 4c).
  • the amplification curves ( Figure 3) also show perfect paces.
  • FIG. 5 shows the curve of the most stable control genes.
  • the measurement of the stability of the expression of several control genes by qPCR on biological samples was validated using the GeNorm software.
  • the control genes RPL5, HPRT1 and HNRNPA1 are all to the right of this curve in the part of the most stable genes ( Figure 5).
  • the same control genes were also identified as the most stable in prostate cell lines (LNCaP, VCaP, NPrEC) using the same Genorm software (results are not shown).
  • Example 1 qPCR protocol of the present invention for the detection and quantification of PCA3, AMACR and TMPRSS2-ERG gene transcripts in prostate positive cell lines or paraffinic biopsies of prostate cancer RNeasy mini kit from Qiagen was used to extract cellular RNA from LNCaP, VCaP and NPrEC according to the supplier's recommendations (Qjagenlnc). While RNA extraction from prostate biopsies was done by the PureLinkTM FFP Total RNA Isolation Kit following the recommendations of the suppliers.
  • RNA was measured by the NanoDrop 2000 Spectrophotometer (Thermo SCIENTIFIC), while the quality and purity of the RNA obtained is tested by agarose gel electrophoresis, or by the Bioanalyzer (Agilant).
  • the complementary DNA (cDNA) is obtained from total RNA extracted from the test sample.
  • the cDNA synthesis is performed using the Thermocycler (AppliedBiosystems) using the RNA kit to cDNA Reverse Transcription according to the supplier's recommendations (AppliedBiosystems).
  • the primers and the probe of the target genes and 5 ⁇ of cDNA are added to the mastermix of the qPCR reaction (TaqManFastUniversal PCR Master mix: AppliedBiosystems) for a final volume of 25 ⁇ .
  • step 1 at 95 ° C for 20 seconds
  • step 2 cycle 50
  • step 3 at 60 ° C for 30 seconds.
  • Examples 2, 3 The performance of qPCR of the present invention for the detection and quantification of target gene transcripts and control genes in prostate cell lines (amplification curve, standard curve)
  • Reverse primer 5'AATGTCCTTCCCTCACAAGC 3 '(SEQ ID No. 2)
  • Reverse primer 5'CCACTCAG CCTG G C ATAA 3 '(SEQ ID No. 6)
  • Reverse primer 5 'CG CG GTC ATCTCTG TOT A 3' (SEQ ID NO: 12)
  • Example 4 The selection of the reference genes was carried out according to the following procedure: a dozen genes were selected based on the state of the art and on databases. The stability analysis of these genes was done using qPCR according to the same protocols for the extraction and synthesis of cDNA as the examplel. The experimental design was done in such a way that the control genes were tested in different biological samples, namely cell lines and tissue samples, under two different conditions (healthy and diseased). Three replicates were used for each condition (replicates correspond to samples from RNA extraction and different RT reaction), each of these replicates was tested in duplicate in the same experiment.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to new sets of primers and probes and to the use thereof for detecting prostate-specific genes, i.e. the PCA3, TMPRSS2- ERG and AMACR genes, and reference genes selected from the RPL5, HPRT1 and HNRNPA1 genes for normalising the target gene expression analysis data from patient samples, whether these are tissue samples or biological fluids. The sets of primers and probes of the target genes and reference genes are more sensitive than those cited in the literature, and will be used in real-time PCR (qPCR) in simplex or multiplex format for a reliable, rapid and less costly quantification.

Description

Sondes et amorces pour la quantification rapide et fiable des gènes spécifiques au cancer de la prostate en utilisant des gènes contrôles adéquats  Probes and primers for rapid and reliable quantification of prostate cancer-specific genes using adequate control genes
DOMAINE TECHNIQUE TECHNICAL AREA
La présente invention concerne de nouveaux sets d'amorces et sondes et leur utilisation pour la détection des gènes spécifiques de la prostate à savoir les gènes PCA3, TMPRSS2- ERG et AMACR et des gènes de contrôles choisis parmi les gènes RPL5, HPRT1, et HNRNPA1 pour la normalisation des données d'analyse d'expression des gènes cibles à partir d'échantillons de patients que ce soit des échantillons tissulaires ou des fluides biologiques. The present invention relates to novel sets of primers and probes and their use for the detection of prostate-specific genes namely the PCA3, TMPRSS2-ERG and AMACR genes and control genes chosen from the RPL5, HPRT1, and HNRNPA1 genes. for the standardization of target gene expression analysis data from patient samples whether tissue samples or biological fluids.
Les sets d'amorces et sondes des gènes cibles et gènes de références sont plus sensibles que ceux citées en littérature et seront utilisées en PCR en temps réel (qPCR) en format simplex ou multiplex pour une quantification fiable, rapide et moins coûteuse. La présente invention sera éventuellement à la base d'un kit pour le diagnostic moléculaire du cancer de la prostate à partir d'un échantillon biologique prélevé chez un patient selon lequel on détermine l'expression d'au moins un des gènes cibles (PCA3, TMPRSS2-ERG, AMACR)en réaction simplex ou multiplex. The sets of primers and probes of the target genes and reference genes are more sensitive than those mentioned in literature and will be used in real-time PCR (qPCR) in simplex or multiplex format for a reliable, fast and less expensive quantification. The present invention will eventually be the basis of a kit for the molecular diagnosis of prostate cancer from a biological sample taken from a patient according to which the expression of at least one of the target genes (PCA3, TMPRSS2-ERG, AMACR) in simplex or multiplex reaction.
ART ANTERIEUR : Le Cancer de la prostate (CaP) est le deuxième cancer le plus fréquent et la sixième cause de décès par cancer chez les hommes dans le monde avec environ 899 000 nouveaux cas et 258 000 nouveaux décès en 2008. L'incidence du CaP dans le monde devrait augmenter à 1,7 millions de nouveaux cas et 499 000 nouveaux décès en 2030 en raison de l'allongement de l'espérance de vie et le vieillissement de la population mondiale. [ Ferlay J, Shin HR, Bray F, et al. GLOBOCAN 2008, Cancer incidence and mortality Worldwide: IARC CancerBase No. 10. Lyon, France: International Agency for Research on Cancer; 2010] BACKGROUND: Prostate cancer (PCA) is the second most common cancer and sixth leading cause of cancer death in men worldwide with approximately 899,000 new cases and 258,000 new deaths in 2008. The incidence of CaP in the world is expected to increase to 1.7 million new cases and 499,000 new deaths in 2030 due to longer life expectancy and the aging of the world's population. [Ferlay J, Shin HR, Bray F, et al. GLOBOCAN 2008, Cancer incidence and mortality Worldwide: IARC CancerBase No. 10. Lyon, France: International Agency for Research on Cancer; 2010]
La grande variation des taux d'incidence du CaP à l'international est due en partie à une différence à travers le monde de l'activité de diagnostic par l'antigène spécifique de la prostate (PSA) qui détecte d'iniquement des tumeurs importantes ainsi que d'autres à croissance lente et asymptomatiques. Les taux de mortalité par CaP sont compte à eux moins touchés par les pratiques de diagnostic, mais reflètent les différences de prise en charge du cancer de la prostate dans le monde ainsi que des risques sous-jacents. [Platz EA, Giovannucci E. Prostate cancer. In: Schottenfeld D, Fraumeni JF, editors. Cancer epidemiology and prévention. New York, NY: Oxford University Press; 2006. p. 1128-50] Le PSA est une protéase serine codée par le gène PSA situé sur le chromosome 19. Cette glycoprotéine est produite sous le contrôle d'androgènes par les cellules épithéliales glandulaires de la prostate et sécrétée dans le plasma séminal pour le liquéfier. Cette protéine est normalement confinée à la prostate, mais une perturbation de l'intégrité anatomique de cette glande peut compromettre les barrières cellulaires qui limitent normalement le PSA à l'intérieur du système de conduit de la prostate, ce qui provoque des fuites dans le sang ou les urines. Une manipulation physique de la prostate peut également augmenter les niveaux du PSA sérique, ce qui n'est pas le cas en temps normal pour un stimulus doux comme le toucher rectal (DRE). The large variation in international CaP incidence rates is due in part to a worldwide difference in diagnostic activity by the antigen specific to CaP. Prostate (PSA) which detects ini - tially important tumors as well as slow - growing and asymptomatic tumors. CaP mortality rates are less affected by diagnostic practices, but reflect differences in the management of prostate cancer around the world and the underlying risks. [Platz EA, Giovannucci E. Prostate cancer. In: Schottenfeld D, Fraumeni JF, editors. Cancer epidemiology and prevention. New York, NY: Oxford University Press; 2006. p. 1128-50] PSA is a serine protease encoded by the PSA gene located on chromosome 19. This glycoprotein is produced under the control of androgens by the glandular epithelial cells of the prostate and secreted in the seminal plasma to liquefy it. This protein is normally confined to the prostate, but disruption of the anatomical integrity of this gland can compromise the cellular barriers that normally limit PSA within the prostate duct system, causing leakage into the bloodstream. or urine. Physical manipulation of the prostate can also increase serum PSA levels, which is not normally the case for a mild stimulus such as digital rectal examination (DRE).
Les fuites de PSA en dehors de la glande prostatique peuvent se produire dans de nombreux cas à savoir: une rétention urinaire, une inflammation ou une infection de la prostate, une hyperplasie prostatique bénigne (HBP) et enfin un cancer de la prostate. PSA leaks outside the prostate gland can occur in many cases, including urinary retention, inflammation or infection of the prostate, benign prostatic hyperplasia (BPH) and finally prostate cancer.
Dans le sang le PSA circule sous deux formes principales soit sous forme libre (fPSA qui représente 10 à 40% du PSA total, forme prépondérante dans l'HBP) ; soit complexé à des inhibiteurs de protéases, essentiellement l'alphal-antichmotrypsine (PSA-ACT) (60 à 90% du PSA total, forme prépondérante dans le CaP) et ralpha2-macroglobuline (PSA-AMG). In blood, PSA circulates in two main forms, either in free form (fPSA which accounts for 10 to 40% of total PSA, a predominant form in BPH); is complexed with protease inhibitors, essentially alphal-antichyotrypsin (PSA-ACT) (60 to 90% of total PSA, predominant form in CaP) and ralpha2-macroglobulin (PSA-AMG).
[Tumour markers-assays: PSA-total and free.BC Cancer Agency.(2004, January). Cancer Management Guidelines.(Reviewed Édition). Vancouver, BC: BC Cancer Agency]. Le dosage du tPSA total est la somme du fPSA et du PSA conjugué. [Tumor markers-assays: PSA-total and free.BC Cancer Agency. (2004, January). Cancer Management Guidelines (Reviewed Edition). Vancouver, BC: BC Cancer Agency]. The total tPSA assay is the sum of fPSA and conjugated PSA.
Depuis 1991 le dosage du PSA total (tPSA) a été introduit comme un test diagnostic pour prédire le cancer de la prostate, ce dosage se fait par le biais de tests biochimiques. Les études à ce jour ont suggéré que le dépistage par PSA, en conjonction avec le toucher rectal et l'échographie transrectale, augmente la détection précoce des cancers de la prostate souvent localisé à la glande elle-même. [Brawer M K, Chetner M P, Beatie J et al. Screening for prostaticcarcinomawith PSA. J Urol 1992; 147: 841-845] Since 1991 the assay of total PSA (tPSA) has been introduced as a diagnostic test to predict prostate cancer, this assay is done through biochemical tests. Studies to date have suggested that PSA screening, in conjunction with digital rectal examination and transrectal ultrasound, increases early detection of prostate cancer often localized to the gland itself. [MK Brawer, Chetner MP, Beatie J et al. Screening for prostaticcarcinomawith PSA. J Urol 1992; 147: 841-845]
La norme du tPSA fixée à 4 ng/ml correspond à un seuil décisionnel moyen visant à détecter le plus grand nombre de cancers tout en essayant de limiter le nombre de biopsies inutiles. Il est vrais que le concept de mesure du ratio la PSA libre / PSA total a permis d'augmenter la spécificité du dépistage du cancer de la prostate chez les hommes avec tPSA entre 4 et 10 ng / ml[Letran JL, Blasé AB, Loberiza FR et al. Repeat ultrasound guided prostate needle biopsy : use of free to total PSA ratio in predicting prostatic carcnoma. 7. J. Urol .1998 : 60:426-9 ]. Cependantll n'y a pas de valeur cible pour laquelle la sensibilité et la spécificité soit simultanément élevées. Pour des valeurs seuil de PSA de 1,1, 2,1, 3,1, et 4,1 ng / mL la sensibilité est de 83,4%, 52,6%, 32,2% et 20,5% respectivement , et la spécificité de 38,9%, 72,5%, 86,7% et 93,8%. En effet, des cancers peuvent exister sans augmentation du PSA et le taux de PSA augmente avec l'âge et diverses pathologies de la prostate. Diminuer ce seuil de 4ng/ml conduirait à une augmentation du nombre de biopsies. [Thompson IM, Ankerst DP, Chi C, et al. Operating characteristics of prostate-specific antigen in men with an initial PSA level of 3.0 ng/mL or lower.JAMA. 2005; 294(l):66-70] The tPSA standard of 4 ng / ml corresponds to a mean decision threshold aimed at detecting the greatest number of cancers while trying to limit the number of unnecessary biopsies. It is true that the concept of measuring the ratio of free PSA / total PSA has made it possible to increase the specificity of screening for prostate cancer in men with tPSA between 4 and 10 ng / ml [Letran JL, Blasé AB, Loberiza FR et al. Ultrasound guided prostate needle biopsy: use of free to total PSA ratio in predicting prostatic carcnoma. 7. J. Urol. 1998: 60: 426-9]. However, there is no target value for which sensitivity and specificity are simultaneously high. For PSA cut-off values of 1.1, 2.1, 3.1, and 4.1 ng / mL the sensitivity is 83.4%, 52.6%, 32.2% and 20.5% respectively , and the specificity of 38.9%, 72.5%, 86.7% and 93.8%. Indeed, cancers can exist without PSA increase and the PSA level increases with age and various pathologies of the prostate. Decreasing this threshold of 4ng / ml would lead to an increase in the number of biopsies. [Thompson IM, Ankerst DP, Chi C, et al. PSA level of 3.0 ng / mL or lower.JAMA. 2005; 294 (l): 66-70]
De toute évidence, la biopsie prostatique est un élément clé pour confirmer un CaP. Cependant, elle n'est pas à 100% fiable. Selon les recommandations la collecte d'échantillon de tissu est guidée par échographie transrectale est six échantillons sont requis, mais souvent ces échantillons ne révèlent pas de cancer ainsi une deuxième série de biopsies où plus de six échantillons est requise. Obviously, prostate biopsy is a key element to confirm CaP. However, it is not 100% reliable. According to the recommendations the tissue sample collection is guided by transrectal ultrasound is six samples are required, but often these samples do not reveal cancer so a second set of biopsies where more than six samples is required.
De ce fait, une augmentation modérée du taux de PSA jusqu'à 10 ng/ml, accompagnée d'un toucher rectal normal et des résultats négatifs de biopsies, constitue une difficulté supplémentaire pour les cliniciens dans le suivi des patients chez qui subsiste un risque de CaP.  As a result, a moderate increase in PSA up to 10 ng / ml, accompanied by a normal digital rectal examination and negative biopsy results, is an additional challenge for clinicians in the follow-up of patients who remain at risk. of CaP.
Tenant compte de ce fait et de la grande incidence de ce cancer, il s'avère indispensable d'identifier de nouveaux biomarqueurs plus spécifique du CaP et hautement surexprimés qui pourraient remplacer, ou au moins compléter le dosage sérique du PSA pour diminuer le recours aux biopsies prostatiques. Les approches les plus récentes pour le diagnostic du CaP impliquent l'utilisation de technologies moléculaires, centré autour des marqueurs préférentiellement exprimés dans les cellules cancéreuses. Ces marqueurs sont souvent des protéines ou des acides nucléiques codant pour une protéine, ou peuvent également êtres des molécules d'acides nucléiques non codants. À ce titre, les biomarqueurs urinaires semblent particulièrement attractifs car peu invasifs, disponibles et adaptés à un dépistage à grande échelle. Dans ce sens plusieurs biomarqueurs ont été décrits comme étant spécifiquement exprimés au niveau de la prostate, et ont déjà surpassé certains aspects des performances du PSA sérique. Taking into account this fact and the high incidence of this cancer, it is essential to identify new biomarkers more specific to CaP and highly over-expressed that could replace, or at least supplement the serum PSA to reduce the use of Prostatic biopsies. The most recent approaches to the diagnosis of CaP involve the use of molecular technologies, centered around markers preferentially expressed in cancer cells. These markers are often proteins or nucleic acids encoding a protein, or may also be non-coding nucleic acid molecules. As such, urinary biomarkers seem particularly attractive because they are not invasive, available and adapted to large scale screening. In this sense, several biomarkers have been described as specifically expressed at the level of the prostate, and have already surpassed some aspects of the performance of serum PSA.
Un nouveau marqueur du cancer de la prostate PCA3, a été découvert il y'a quelques années par la technique d'affichage différentielle (differential display RT-PCR (Liang, Averboukh et Pardee 1993; Liang et Pardee 1992)) utilisée pour observer le niveau d'expression des gènes. A new PCA3 prostate cancer marker was discovered a few years ago by the differential display RT-PCR technique (Liang, Averboukh and Pardee 1993, Liang and Pardee 1992) used to observe the level of gene expression.
Le gène PCA3, ou differential display code 3 (DD3), est situé sur le chromosome 9q21-22 et composé de quatre exons (E1-E4) et de trois introns (11-13). Il code pour au moins quatre transcrits différents, qui sont générés par épissage alternatif et par polyadénylation. [Hessels D, Schalken JA. The use of PCA3 in the diagnosis of prostate cancer.Nat RevUrol 2009;6:255-61.] Aucun des transcrits produits par le gène ne semble pouvoir être traduit en protéine, ce qui fait du PCA3 un gène à ARN non codants. De ce fait aucune technique basée sur le dosage de la protéine ne peut être utilisée. [Schalken JA, Hessels D, Verhaegh G. New targets for therapy in prostate cancer: differential display code 3 (DD3(PCA3)), a highly prostate cancer-specific gene. Urology 2003;62:34-43.]. Par contrel'analyse par RT- PCR a révélé que l'expression du PCA3 est limitée à la prostate et absente dans les autres tissus, dans le même sens l'analyse Nothern blot a montré une faible expression du PCA3 dans les tissus prostatiques normaux comparé à la forte expression dans la grande majorité des cancers de la prostate 95%. [Bussemakers MJ, van Bokhoven A, Verhaegh GW, Smit FP, Karthaus HF, Schalken JA, et al. DD3: a new prostate-specific The gene PCA3, or differential display code 3 (DD3), is located on chromosome 9q21-22 and consists of four exons (E1-E4) and three introns (11-13). It encodes at least four different transcripts, which are generated by alternative splicing and polyadenylation. [Hessels D, Schalken JA. The use of PCA3 in the diagnosis of prostate cancer.Nat RevUrol 2009; 6: 255-61.] None of the transcripts produced by the gene seem to be translatable into protein, making PCA3 a non-coding RNA gene. As a result, no technique based on the assay of the protein can be used. [Schalken JA, Hessels D, Verhaegh G. New targets for therapy in prostate cancer: differential display code 3 (DD3 (PCA3)), a highly prostate cancer-specific gene. Urology 2003; 62: 34-43.]. By contrast, RT-PCR analysis revealed that PCA3 expression is limited to the prostate and absent in other tissues, in the same sense the Nothern blot analysis showed a low expression of PCA3 in normal prostate tissue compared to strong expression in the vast majority of prostate cancer 95%. [Bussemakers MJ, van Bokhoven A, Verhaegh GW, Smit FP, Karthaus HF, Schalken JA, et al. DD3: a new prostate-specific
gene, highly overexpressed in prostate cancer. Cancer Res 1999;59:5975-9.] gene, highly overexpressed in prostate cancer. Cancer Res 1999; 59: 5975-9.]
La pertinence du PCA3 dans le diagnostic du CaP semble découler de sa spécificité d'expression qui est 66 à 140 fois supérieure dans les cancers de la prostate plutôt que dans les tissus normaux ou hyperplasique. [Altintas DM, Allioli N, Decaussin M, de Bernard S, Ruffion A, Samarut J, et al. Differentially expressed androgen-regulated gènes in androgensensitive tissues reveal potential biomarkers of early prostate cancer. PLoS One 2013;8:e66278.]. Sur la base de cette expression différentielle très prometteuse un test diagnostique à partir des urines a été élaboré. The relevance of PCA3 in the diagnosis of CaP seems to stem from its expression specificity which is 66 to 140 times higher in prostate cancers than in normal or hyperplastic tissues. [Altintas DM, Allioli N, Decaussin M, Bernard S, Ruffion A, Samarut J, et al. Differentially expressed androgen-regulated genes in androgensensitive tissues reveal potential biomarkers of early prostate cancer. PLoS One 2013; 8: e66278].. On the basis of this very promising differential expression a diagnostic test from urine has been developed.
Après avoir vérifié que l'on pouvait déceler l'ARN du PCA3 dans les urines [Hessels D, Klein Gunnewiek JM, van Oort I, Karthaus H F, van Leenders GJ, van Balken B, et al. DD3(PCA3)- based molecular urine analysis for the diagnosis of prostate cancer. EurUrol 2003;44:8- 15.], la mise au point d'une technique de dosage d'emblée quantitative, a été réalisé. Actuellement elle fait l'objet d'un protocole clairement défini et bien accepté par les praticiens, systématisé dans un kit commercial (ProgensaTM PCA3 Assay, Gen-Probe®). After verifying that PCA3 RNA can be detected in the urine [Hessels D, Klein Gunnewiek JM, van Oort I, Karthaus HF, Van Leenders GJ, van Balken B, et al. DD3 (PCA3) - Based Molecular Urine Analysis for the Diagnosis of Prostate Cancer. EurUrol 2003; 44: 8-15], the development of a quantitative quantitative assay technique was carried out. Currently it is the subject of a protocol clearly defined and well accepted by practitioners, systematized in a commercial kit (ProgensaTM PCA3 Assay, Gen-Probe ® ).
Le test PCA3 se déroule en trois étapes : la sélection de l'ARN d'intérêt, son amplification et sa quantification. La sélection se fait par l'utilisation de billes magnétiques recouvertes d'oligonucléotides complémentaires à l'ARN d'intérêt. L'amplification de cet ARN présélectionné repose sur la transcription (Transcription-Mediated Amplification [TMA]). Pour la quantification, l'ARN amplifié est marqué par une sonde complémentaire luminescente selon la technique d'hybridation protectrice (Hybridization Protection Assay[HPA]). Le nombre de copies est alors évalué par la mesure de la chimiluminescence, sur la base d'une courbe de calibration. En parallèle une quantification du nombre de copies du PSA permet à la fois de vérifier le caractère informatif de l'échantillon urinaire (il contient bien des cellules épithéliales prostatiques) et de normaliser le nombre de copies d'ARN de PCA3 [Groskopf J, Aubin SM, Deras IL, Blase A, Bodrug S, Clark C, et al. APTIMA PCA3 molecular urine test: development of a method to aid in the diagnosis of prostate cancer. Clin Chem 2006;52:1089-95.]. Lorsque le nombre de copies d'ARNm du PSA est inférieur à 10 000, l'échantillon est considéré comme non informatif. Il semblerait que la réalisation du toucher rectal ou non serait susceptible d'influencer la qualité de l'échantillon, c'est pour cette raison que la méthode de recueil des urines a été standardisée. Le recueil consiste en la collecte du premier jet urinaire qui suit un toucher rectal appuyé (trois pressions par lobe prostatique, suffisantes pour déprimer de 1 cm la surface de la prostate, de la base vers l'apex), qui a pour but de mobiliser les sécrétions prostatiques enrichies en cellules épithéliales prostatiques, permettant d'augmenter la part informative de l'échantillon. [SokollU,Ellis W, Lange P, Noteboom J, Elliott DJ, Deras IL, et al. A multicenter évaluation of the PCA3 molecular urine test: pre-analytical effects, analytical performance, and diagnostic accuracy. Clin Chim Acta 2008;389:1-6.] Si l'échantillon est informatif, un score PCA3 est établi : il est défini par le rapport entre le nombre de copies du PCA3 et le nombre de copies du PSA, ce dernier reflétant la richesse en cellules prostatiques de l'échantillon et servant de normalisateur. La valeur seuil du score PCA3 qui a été fixé pour considérer un patient comme positif est de 35. The PCA3 test is carried out in three steps: the selection of the RNA of interest, its amplification and its quantification. Selection is by the use of magnetic beads coated with oligonucleotides complementary to the RNA of interest. The amplification of this preselected RNA is based on transcription (Transcription-Mediated Amplification [TMA]). For quantitation, the amplified RNA is labeled with a luminescent complementary probe according to the Hybridization Protection Assay (HPA) technique. The number of copies is then evaluated by measuring the chemiluminescence, on the basis of a calibration curve. In parallel, a quantification of the PSA copy number makes it possible both to verify the informative nature of the urine sample (it contains prostate prostate epithelial cells) and to standardize the PCA3 RNA copy number [Groskopf J, Aubin SM, Deras IL, Blase A, Bodrug S, Clark C, et al. APTIMA PCA3 Molecular Urine Test: Development of a method to help in the diagnosis of prostate cancer. Clin Chem 2006; 52: 1089-95.]. When the PSA mRNA copy number is less than 10,000, the sample is considered uninformative. It seems that the realization of the rectal examination or not would be likely to influence the quality of the sample, it is for this reason that the method of collection of the urine was standardized. The collection consists of the collection of the first urinary stream that follows a rectal leaning (three pressures per prostate lobe, sufficient to depress the prostate surface by 1 cm, from the base to the apex), which aims to mobilize prostatic secretions enriched in prostatic epithelial cells, making it possible to increase the informative part of the sample. [Sokoll, Ellis W, Lange P, Noteboom J, Elliott DJ, Deras IL, et al. A multicenter evaluation of the PCA3 molecular urine test: pre-analytical effects, analytical performance, and diagnostic accuracy. Clin Chim Acta 2008; 389: 1-6.] If the sample is informative, a PCA3 score is established: it is defined by the ratio between PCA3 copy number and PSA copy number, which reflects the prostate cell richness of the sample and serves as a normalizer. . The threshold value of the PCA3 score that has been set to consider a patient as positive is 35.
Alors que le PCA3 semble être reconnu comme le meilleur marqueur du cancer de la prostate jamais identifié, certaines études ont. contestée cette spécificité, et l'ont jugé exclusive à l'exon 4 du gène PCA3. [Gandini, O., Luci, L, Stigliano, A., Lucera, R., Di Silverio, F., Toscano, V., and Cardillo, M. R. Is DD3 a new prostate-specific gene? AnticancerRes., 23 (1A): 305-308, 2003.]. Il reste donc nécessaire de clarifier la question de la spécificité du marqueur PCA3 et fournir des outils qui identifient spécifiquement des séquences de PCA3 associés au CaP. While PCA3 appears to be recognized as the best marker of prostate cancer ever identified, some studies have. challenged this specificity, and found it exclusive to exon 4 of the PCA3 gene. [Gandini, O., Luci, L, Stigliano, A., Lucera, R., Di Silverio, F., Toscano, V., and Cardillo, M. R. Is DD3 a new prostate-specific gene? AnticancerRes., 23 (1A): 305-308, 2003.]. Thus, it remains necessary to clarify the question of the specificity of the PCA3 marker and provide tools that specifically identify PCA3 sequences associated with CaP.
L'apparition de nouveaux marqueurs du CaP soulève d'importantes questions sur leurs places dans l'arsenal diagnostique. En dehors du score PCA3, deux autres biomarqueurs sont particulièrement présent dans la littérature récente le gène de fusion TMPRSS2-ERG et l'AMACR. The appearance of new markers of CaP raises important questions about their place in the diagnostic arsenal. Apart from the PCA3 score, two other biomarkers are particularly present in the recent literature, the TMPRSS2-ERG fusion gene and AMACR.
Alpha-méthylacyl-CoAracémase (AMACR) est un gène situé sur le chromosome 5, il code pour une enzyme de 382 aminoacides impliquée dans la bêta-oxydation des chaînes ramifiées des acides et dérivés. Alpha-methylacyl-CoAracemase (AMACR) is a gene located on chromosome 5, it encodes a 382 amino acid enzyme involved in the beta-oxidation of branched chains of acids and derivatives.
AMACR est constamment surexprimé dans l'épithélium cancéreux de la prostate; par conséquent, il devient un biomarqueur spécifique idéal pour les cellules cancéreuses au sein de la glande prostatique[Brawer, M.K.; Chetner, M. P.; Beatie, J.; Buchner, D.M.; Vessella, R.L.; Lange, P.H. Screening for prostaticcarcinomawith prostate specificantigen. J. Urol. 1992, 147, 841-845 ; Catalona, W.J.; Smith, D.S.; Ornstein, D.K. Prostate cancer détection in men with sérum psa concentrations of 2.6 to 4.0 ng/mL and benign prostate examination. Enhancement of specificitywith free psameasurements. JAMA 1997, 277, 1452-1455.] AMACR is constantly overexpressed in the cancerous epithelium of the prostate; therefore, it becomes an ideal specific biomarker for cancer cells within the prostate gland [Brawer, M.K .; Chetner, M. P .; Beatie, J .; Buchner, D.M .; Vessella, R.L .; Lange, P.H. Screening for prostaticcarcinomawith prostate specificantigen. J. Urol. 1992, 147, 841-845; Catalona, W.J .; Smith, D.S .; Ornstein, D.K. Prostate cancer detection in men with psa serum concentrations of 2.6 to 4.0 ng / mL and benign prostate examination. Enhancement of specificitywith free psameasurements. JAMA 1997, 277, 1452-1455.]
L'étude de l'expression de la protéine AMACR, en utilisant des méthodes immunohistochimiques, sur des biopsies prostatiques cancéreuses et d'autres bénignes, a montré une forte immunoréactivité d'AMACR dans tous les cancers de la prostate, en revanche peu ou pas d'immunoréactivité a été observée dans les glandes bénignes. Par conséquent, AMACR est considéré comme un marqueur immunohistochimique utile pour le diagnostic du cancer de la prostate. [Jiang Z, Woda B, Wu C, et al. Discovery and clinical application of a novel prostate cancer marker. Am J ClinPathol.2004;122:275-289.] The study of the expression of the AMACR protein, using immunohistochemical methods, on prostate cancer and other benign biopsies, showed a strong immunoreactivity of AMACR in all prostate cancers, on the other hand little or no immunoreactivity was observed in the benign glands. By therefore, AMACR is considered an immunohistochemical marker useful for the diagnosis of prostate cancer. [Jiang Z, Woda B, Wu C, et al. Discovery and clinical application of a prostate cancer marker. Am J ClinPathol.2004; 122: 275-289.]
Toutefois, en raison des protocoles d'immunocoloration non normalisés, les critères d'interprétation et motif de coloration hétérogène, il y'a une grande variation dans la sensibilité et la spécificité de l'immunoréactivité d'AMACR dans les biopsies de la prostate. En outre, l'expression d'AMACR a été démontrée dans les néoplasies intra-prsotatique (PIN) de haut grade et les adénocarcinomes prostatiques. [Varma M, Jasani B. Diagnostic utility of immunohistochemistry in morphologically difficult prostate cancer: review of current literature. Histopathol. 2005;47:1-16.] However, due to non-standard immunostaining protocols, interpretation criteria, and heterogeneous staining pattern, there is a wide variation in the sensitivity and specificity of AMACR immunoreactivity in prostate biopsies. In addition, the expression of AMACR has been demonstrated in high-grade intra-prsotatic neoplasia (PIN) and prostatic adenocarcinoma. [Varma M, Jasani B. Diagnostic utility of immunohistochemistry in morphologically difficult prostate cancer: review of current literature. Histopathol. 2005; 47: 1-16].
Il est vrai que la spécificité de l'AMACR pour le cancer a été bien établi, et que son utilisation en immunohistochimie pour le diagnostic du cancer de la prostate a fait ses preuves, cependant plusieurs aléas techniques peuvent affectés la pertinence des résultats. It is true that the specificity of AMACR for cancer has been well established, and that its use in immunohistochemistry for the diagnosis of prostate cancer has been proven, however several technical hazards can affect the relevance of the results.
Par contre l'utilisation de la qPCR pour la détection du transcrit de l'AMACR aussi bien dans des échantillons tissulaire qu'urinaire a montré une sensibilité et spécificité respective de 70 et 71%. Ces chiffres atteignent 81 et 84% si l'on combine l'AMACR au PCA3.[Ouyang B, Bracken B, Burke B, Chung E, Liang J, Ho SM. Aduplex quantitative polymerase chain reaction assay basedon quantification of alpha-methylacyl-CoA racemase transcriptsand prostate cancer antigen 3 in urine sedimentsimproved diagnostic accuracy for prostate cancer. J Urol2009;181:2508— 13.] On the other hand, the use of qPCR for the detection of the AMACR transcript in both tissue and urinary samples showed a respective sensitivity and specificity of 70 and 71%. These figures reach 81 and 84% when combining AMACR with PCA3 [Ouyang B, Bracken B, Burke B, Chung E, Liang J, Ho SM. Aduplex quantitative polymerase chain reaction assay basedon quantification of alpha-methylacyl-CoA racemase transcriptsand prostate cancer antigen 3 in urine sedimentimproved diagnostic accuracy for prostate cancer. J Urol2009; 181: 2508-13.]
Une autre combinaison, celle du PCA3 et du gène de fusion le TMPRSS2-ERG semble aussi augmenter la sensibilité et la spécificité de détection du cancer de la prostate.  Another combination of PCA3 and the TMPRSS2-ERG fusion gene also appears to increase the sensitivity and specificity of detection of prostate cancer.
Jusqu'à présent, les gènes de fusion étaient considérés comme des événements rares dans les tumeurs épithéliales qui se caractérisent habituellement par des altérations chromosomiques complexes, non spécifiques. La mise en évidence récente de gènes de fusion TMPRSS2-ETS dans une majorité des cancers de la prostate représente une véritable révolution dans la connaissance biologique de ces tumeurs, la variante la plus fréquente (90% des cas) implique deux gènes TMPRSS2 (Transmembraneprotease, serine 2) et ERG (Ets Related Gene) situés sur le chromosome 21(TMPRSS2 au niveau 21q22.3 et ERG au niveau 21q22.2). Dans le cas physiologique, ces deux gènes sont exprimés séparément. [SalagierskiMaciej and Jack A. Schalken.PCA3 and TMPRSS2-ERG: Promising Biomarkers in Prostate Cancer Diagnosis. Cancers 2010; 2:1432-1440.] Until now, fusion genes were considered rare events in epithelial tumors that are typically characterized by complex, nonspecific chromosomal alterations. The recent demonstration of TMPRSS2-ETS fusion genes in a majority of prostate cancers represents a real revolution in the biological knowledge of these tumors, the most common variant (90% of cases) involves two genes TMPRSS2 (Transmembraneprotease, serine 2) and ERG (Ets Related Gene) located on chromosome 21 (TMPRSS2 at level 21q22.3 and ERG at level 21q22.2). In the physiological case, these two genes are expressed separately. [SalagierskiMaciej and Jack A. Schalken.PCA3 and TMPRSS2-ERG: Promising Biomarkers in Prostate Cancer Diagnosis. Cancers 2010; 2: 1432-1440].
Le gène TMPRSS2 est un membre de la famille des sérines protéase transmembranaire 2 fortement exprimée à la fois dans les cellules prostatiques normales et cancéreuses constitué de 14 exons, possédant dans ses promoteurs des séquences androgénodépendantes, son expression est régulée par les androgènes. Le gène ERG appartient à la famille ETS (The E26 Transformation Spécifie) (ERG, ETV1, ETV4) codant pour des facteurs de transcription nucléaires, le gène ERG est formé de 11 exons caractérisés par des domaines d'ADN liant l'ETS et de divers domaines d'interaction protéique.[Beuzeboc P, Soulié M, Richaud P, Salomon L et al. Fusion gènes and prostate cancer.From discovery to prognosis and therapeutic perspectives. Progrès en urologie 2009; 19:819-824.] The TMPRSS2 gene is a member of the transmembrane serine protease family 2 strongly expressed in both normal and cancerous prostatic cells consisting of 14 exons, with androgen-dependent sequences in its promoters, its expression is regulated by androgens. The ERG gene belongs to the ETS family (The E26 Transformation Specifies) (ERG, ETV1, ETV4) encoding nuclear transcription factors, the ERG gene is formed of 11 exons characterized by ETS-binding DNA domains and various domains of protein interaction [Beuzeboc P, Soulie M, Richaud P, Solomon L et al. Fusion genes and prostate cancer.From discovery to prognosis and therapeutic perspectives. Progress in Urology 2009; 19: 819-824].
Les fusions génétiques récurrentes entre TMPRSS2 et ERG sont dues à des délétions introniques sur les chromosomes 21q,22.2-3, ces gènes de fusion impliquent l'extrémité 5' non codante de TMPRSS2 (21q22.3) et l'extrémité 5' des membres de la famille de facteurs de transcription ETS qui sont soit ERG (21q22.2), ETV1 (7p21.2) ou ETV4 (17q21). Ils entraînent la surexpression de protéines chimériques ou anormales qui pourrait affecter la progression tumorale. The recurrent genetic fusions between TMPRSS2 and ERG are due to intron deletions on the 21q, 22.2-3 chromosomes, these fusion genes involve the 5 'non-coding end of TMPRSS2 (21q22.3) and the 5' end of the members. of the family of ETS transcription factors that are either ERG (21q22.2), ETV1 (7p21.2) or ETV4 (17q21). They lead to overexpression of chimeric or abnormal proteins that could affect tumor progression.
Il existe plusieurs variantes du TMPRSS2-ERG issue de l'épissage alternatif, la variante la plus courante concerne l'exon 1 de TMPRSS2 fusionné à l'exon 4 d'ERG.[Hessels D, Frank PS, Gerald WV, et al. Détection of TMPRSS2-ERG Fusion Transcripts and Prostate Cancer Antigen 3 in Urinary Sédiments May Improve Diagnosis of Prostate Cancer. Clin Cancer Res 2007; 13:5103-5108.]  There are several variants of alternative splicing TMPRSS2-ERG, the most common variant being exon 1 of TMPRSS2 fused to exon 4 of ERG [Hessels D, Frank PS, Gerald WV, et al. Detection of TMPRSS2-ERG Fusion Transcripts and Prostate Cancer Antigen 3 in Urinary Sediment May Improve Diagnosis of Prostate Cancer. Clin Cancer Res 2007; 13: 5103-5108].
Plusieurs études ont montré que la surexpression du transcrit de TMPRSS2-ERG est hautement spécifique de la présence d'un cancer dans le tissu prostatique. [Tomlins SA, Bjartell A, Chinnaiyan AM, Jenster G, Nam RK, Rubin MA, et al. ETS gene fusions in prostate cancer: from discovery to daily clinical practice. EurUrol 2009;56:275- 86. ] Several studies have shown that overexpression of the TMPRSS2-ERG transcript is highly specific for the presence of cancer in prostatic tissue. [Tomlins SA, Bjartell A, Chinnaiyan AM, Jenster G, Nam RK, Rubin MA, et al. ETS gene fusions in prostate cancer: from discovery to daily clinical practice. EurUrol 2009; 56: 275-86.]
[Pettersson A, Graff RE, Bauer SR, Pitt MJ, Lis RT, Stack EC, et al. The TMPRSS2:ERG rearrangement, ERG expression, and prostate cancer outeomes: a cohort study and meta- analysis. Cancer EpidemiolBiomarkersPrev 2012;21:1497-509.] L'expression du gène de fusion dans les cellules prostatiques cancéreuses semble être un facteur pronostic important de la progression tumorale et un critère d'agressivité avec des métastases ganglionnaire et un score de Gleason élevé. [Mehra R, Tomlins SA, Yu J, Cao X, Wang L, Menon A, et al. Characterization of TMPRSS2-ETS gene aberrations in androgen- independent metastatic prostate cancer.Cancer Res 2008;68:3584— 90.]Un test urinaire spécifique, identique à celui développé pour PCA3, a secondairement été développé, qui permet de détecter et d'évaluer quantitativement l'expression du TMPRSS2-ERG. [Tomlins SA, Aubin SM, Siddiqui J, Lonigro RJ, Sefton-Miller L, Miick S, et al. Urine TMPRSS2:ERG fusion transcript stratifiés prostate cancer risk in men with elevated sérum PSA. SciTransI Med 2011;3:94ra72] [Pettersson A, Graff RE, Bauer SR, Pitt MJ, Lis RT, Stack EC, et al. The TMPRSS2: ERG rearrangement, ERG expression, and prostate cancer tumors: a cohort study and meta-analysis. Cancer EpidemiolBiomarkersPrev 2012; 21: 1497-509.] The expression of the fusion gene in prostate cancer cells seems to be an important prognostic factor for tumor progression and a criterion of aggressiveness with lymph node metastases and a high Gleason score. [Mehra R, Tomlins SA, Yu J, Cao X, Wang L, Menon A, et al. Characterization of TMPRSS2-ETS gene aberrations in androgen-independent metastatic prostate cancer.Cancer Res 2008; 68: 3584-90.] A specific urine test, identical to that developed for PCA3, was secondarily developed, which allows for detection and quantitatively evaluate the expression of TMPRSS2-ERG. [Tomlins SA, Aubin SM, Siddiqui J, RJ Lonigro, Sefton-Miller L, Miick S, et al. Urine TMPRSS2: ERG fusion transcript stratified prostate cancer risk in men with elevated PSA serum. SciTransI Med 2011; 3: 94ra72]
L'étude de l'expression du TMPRSS2-ERG au niveau des urines par qPCR a montré une sensibilité et spécificité de 37 et 93% respectivement, la combinaison du PCA3 avec le TMPRSS2-ERG semble augmenter la sensibilité de 73% pour la détection du CaP. [Hessels D, Frank PS, Gerald WV, et al. Détection of TMPRSS2-ERG Fusion Transcripts and Prostate Cancer Antigen 3 in Urinary Sédiments May Improve Diagnosis of Prostate Cancer. Clin Cancer Res 2007; 13:5103-5108.] The study of urinary expression of TMPRSS2-ERG in urine by qPCR showed a sensitivity and specificity of 37 and 93% respectively, the combination of PCA3 with TMPRSS2-ERG seems to increase the sensitivity of 73% for the detection of CaP. [Hessels D, Frank PS, Gerald WV, et al. Detection of TMPRSS2-ERG Fusion Transcripts and Prostate Cancer Antigen 3 in Urinary Sediment May Improve Diagnosis of Prostate Cancer. Clin Cancer Res 2007; 13: 5103-5108].
La méthode standard actuelle pour le diagnostic du cancer de la prostate repose principalement sur le dosage du PSA et la réalisation d'un toucher rectal, lorsque l'un des deux examens et positifs le patients est orienté vers une biopsie prostatique dirigée par une échographie transrectale. Pour un patient si une première biopsie est négative et le dosage du PSA demeure élevé le recours au test urinaire PCA3 devient incontournable. The current standard method for the diagnosis of prostate cancer is based mainly on the PSA assay and the achievement of a rectal examination, when one of the two examinations and positive the patient is directed to a prostate biopsy directed by a transrectal ultrasound . For a patient if a first biopsy is negative and the PSA measurement remains high the use of the PCA3 urinary test becomes unavoidable.
Pourtant le coût de ce test demeure très élevé et donc inaccessible pour une tranche non négligeable de la population, ajoutant à cela l'indisponibilité du test dans de nombreux pays d'où la nécessité de sous traitment qui augmente encore plus le coût de l'analyse. Le test urinaire PCA3 constitue un outil diagnostique qui semble apporter au dosage sérique du PSA un gain en temps de spécificité et de valeur prédictive négative. Son intérêt réside dans le choix de la démarche diagnostic du cancer de la prostate à adopter et ainsi mieux orienter les patients justifiants de biopsies prostatiques. Cependant pour les raisons citées ci-dessus il est préférable d'opter pour une autre méthode de quantification du transcrit de PCA3 qui peut être utilisé en combinaison avec d'autres marqueurs moléculaires du cancer de la prostate qui semble aboutir à de meilleures performances que l'utilisation du score PCA3 seul. Donc l'utilisation d'une autre technique quantitative et qualitative en même temps permettra d'une part d'obtenir une meilleure sensibilité et fiabilité avec un moindre coût. However, the cost of this test remains very high and therefore inaccessible for a significant portion of the population, adding to this the unavailability of the test in many countries hence the need for sub-treatment which further increases the cost of the test. analysis. The PCA3 urinary test is a diagnostic tool that seems to provide the serum PSA assay with a gain in specificity time and negative predictive value. His interest lies in the choice of the approach to prostate cancer diagnosis to adopt and better guide patients justifying prostate biopsies. However for the reasons mentioned above it is preferable to opt for another PCA3 transcript quantification method which can be used in combination with other molecular markers of prostate cancer which seems to lead to better performance than the use of the PCA3 score alone. So the use of another quantitative and qualitative technique at the same time will on the one hand to obtain a better sensitivity and reliability with a lower cost.
Actuellement, la qPCR vient répondre à ces exigences d'autant plus que son application au diagnostic clinique en oncologie a connu un succès en raison de sa haute spécificité, sa rapidité, sa fiabilité et la possibilité d'un multiplexage ainsi que son faible cout. [Klein, Dieter. In Trends in MolecularMedicine. 2002 8(6):257-260] Currently, qPCR meets these requirements especially as its application to clinical diagnosis in oncology has been successful because of its high specificity, speed, reliability and the possibility of multiplexing and its low cost. [Klein, Dieter. In Trends in MolecularMedicine. 2002 8 (6): 257-260]
Bien que fiable et robuste, la technique qPCR peut générer des résultats variables lorsqu'elle est appliquée à la quantification des transcrits, en regard de ce fait cette technique doit être standardisée pour éviter que toute variation du protocole utilisé (qualité d'ARN ou l'efficacité de la Reverse transcription) n'introduit des erreurs dans la quantification du transcrit. Le choix d'une normalisation appropriée représente l'un des aspects les plus importants de la qPCR, la normalisation par un rapport à un gène de référence demeure la méthode la plus couramment utilisée. Les gènes de référence, gènes contrôles ou gènes de ménage (houskeepinggene), sont des gènes qui codent pour des protéines dont la fonction est essentielle à la viabilité cellulaire. Ces gènes ont une expression ubiquitaire, stable entre les différents tissus et les individus quelques soit les conditions expérimentales.[Ho-Pun- Cheung A, Cellier D, Lopez-Crapez E: [Considérations for normalisation of RT-qPCR in oncology.]. Ann Biol Clin (Paris) 2008, 66:121-129] Although reliable and robust, the qPCR technique can generate variable results when it is applied to the quantification of transcripts, so this technique must be standardized to avoid any variation of the protocol used (quality of RNA or Reverse transcription efficiency) introduces errors in the quantification of the transcript. The choice of appropriate standardization is one of the most important aspects of qPCR; normalization to a reference gene is still the most commonly used method. Reference genes, control genes or housekeeping genes (houskeepinggene), are genes that encode proteins whose function is essential for cell viability. These genes have ubiquitous, stable expression between different tissues and individuals, whatever the experimental conditions [Ho-Pun-Cheung A, Cellier D, Lopez-Crapez E: [Considerations for normalization of RT-qPCR in oncology.]. Ann Biol Clin (Paris) 2008, 66: 121-129]
Pour le meilleur de nos connaissances, il existe peu d'étude comparant systématiquementplusieurs gènes contrôles normalisateurs dans les échantillons du cancer de la prostate. Parmi les gènes qui ont été décrit, on retrouve ACTB (Beta-actin), ALAS1 (Aminolevulinate, delta-synthase 1), B2M (Beta-2-microglobulin), GAPD (Glyceraldehyde-3- phosphate Dehydrogenase) et HPRT1 (Hypoxanthinephosphoribosyltransferase 1) [Ohl F, Jung M, Xu C, Stephan C, Rabien A, Burkhardt M, Nitsche A, Kristiansen G, Radonic A, Jung K: Gene expression studies in prostate cancer tissue: whichreferencegeneshouldbeselected? J Mol Med 2005, 83:1014-1024] Le choix d'un gène de contrôle approprié est une question délicate, c'est pour cette raison qu'il faut tester plusieurs gènes et choisir le plus stable pour gagner en fiabilité et précision. Dans le cas de la présente invention, une douzaine de gènes contrôles ont été testé, parmi lesquels 3gènes des plus stables ont été sélectionnés. La validation et la confirmation de ces trois gènes s'est faite par le biais d'outils statistiques universel à savoir geNorm, NormFinder et BestKeeper. For the best of our knowledge, there is little study comparing systematically several normalizing control genes in prostate cancer samples. Among the genes that have been described are ACTB (Beta-actin), ALAS1 (Aminolevulinate, delta-synthase 1), B2M (Beta-2-microglobulin), GAPD (Glyceraldehyde-3-phosphate Dehydrogenase) and HPRT1 (Hypoxanthinephosphoribosyltransferase 1 ) [Ohl F, Jung M, Xu C, Stephan C, Rabien A, Burkhardt M, Nitsche A, Kristiansen G, Radonic A, Jung K: Gene expression studies in prostate cancer tissue: whichreferencegeneshouldbeselected? J Mol Med 2005, 83: 1014-1024] The choice of a suitable control gene is a delicate issue, that's why you have to test several genes and choose the most stable to gain reliability and precision. In the case of the present invention, a dozen control genes have been tested, of which 3 of the most stable genes have been selected. The validation and confirmation of these three genes was done through universal statistical tools namely geNorm, NormFinder and BestKeeper.
EXPOSE DE L'INVENTION SUMMARY OF THE INVENTION
La présente invention concerne en général le diagnostic du cancer de la prostate. De manière plus spécifique, la présente invention fait référence à un procédé de détection du cancer de la prostate dans un échantillon de patient en utilisant un ensemble de sondes et d'amorces nouveaux pour la détection et la quantification des transcrits des gènes PCA3, AMACR et le gène de fusion TMPRSS2-ERG. The present invention generally relates to the diagnosis of prostate cancer. More specifically, the present invention refers to a method of detecting prostate cancer in a patient sample using a set of novel probes and primers for the detection and quantitation of PCA3, AMACR and the TMPRSS2-ERG fusion gene.
Le procédé de la présente invention représente une amélioration des autres méthodes antérieurs citées ci-dessus et permet a) de gagner en spécificité en utilisant trois gènes hautement spécifique du cancer de la prostate b) de gagner en sensibilité en utilisant des nouvelles sondes et amorces plus spécifiques et plus sensibles c) de détecter, à l'inverse des autres méthodes de l'art antérieur, toutes le variantes d'épissage du PCA3, étant donné que les sondes et amorces de PCA3 de la présente invention sont désignées de tel manière à détecter tous les transcrits décrits jusqu'à présent, ce qui permettra un gain supplémentaire en spécificité d) en fiabilité et reproductibilité en utilisant des gènes contrôles normalisateurs plus stables que ceux de l'art antérieur e) une réduction du coût de consommables et du temps de réalisation du fait que l'amplification des transcrits d'au moins un des gènes PCA3, AMACR et TMPRSS2-ERG et du gène ou des gènes contrôles se font simultanément dans le même puits de qPCR. Selon la présente invention, la détection et la quantification des transcrits des gènes cibles se font par la méthode qPCR en différentes étapes a) designer et synthétiser des nouvelles séquences nucléotidique de sondes et amorces qui s'hybrident spécifiquement sur les transcrits des gènes cibles ou les gène contrôles b) le gène contrôle est sélectionné parmi le groupe RPL5, HPRT1 et HNRNPA1 c) Selon une autre caractéristique de l'invention, la quantification plus sensible et plus spécifique des transcrits des gènesPCA3, AMACR et TMPRSS2-ERG se fait soit par la méthode ŒH3CT en utilisant un échantillon de cellules exprimant ces gènes d'une façon normale comme calibrateur soit par une extrapolation du nombre de copie des transcrits des gènes cibles à partir d'une courbe standard. Cette dernière est générée par une gamme de dilution de calibrant constitués par un plasmide bactérien qui contient à la fois une séquence du gène cible et du gène de référence comprenant les amplicons reconnus sur leurs ADNc correspondants(d) l'évolution de ce rapport entre un groupe de patients témoins ayant ou pas une pathologie prostatique bénigne et des patients atteints de cancer de prostate avec des biopsies prostatique positives ou négatives, permet de déterminer un seuil minimum de détection et une identification de patients candidats pour une prise en charge . The method of the present invention is an improvement of the other prior methods mentioned above and allows a) to gain in specificity by using three highly specific genes for prostate cancer b) to gain in sensitivity using new probes and primers more specific and more sensitive c) to detect, in contrast to other methods of the prior art, all the PCA3 splice variants, since the PCA3 probes and primers of the present invention are designated in such a way as to detect all the transcripts described so far, which will allow additional gain in specificity d) in reliability and reproducibility using more stable normalizing control genes than those of the prior art e) a reduction in the cost of consumables and time that the amplification of the transcripts of at least one of the PCA3, AMACR and TMPRSS2-ERG genes and the gene or genes Checks are done simultaneously in the same qPCR well. According to the present invention, the detection and quantification of transcripts of the target genes is done by the qPCR method in different steps a) to design and synthesize novel nucleotide sequences of probes and primers that hybridize specifically to the transcripts of the target genes or the control gene b) the control gene is selected from the group RPL5, HPRT1 and HNRNPA1 c) According to another characteristic of the invention, the more sensitive and more specific quantification of the transcripts of the genesPCA3, AMACR and TMPRSS2-ERG is either by the H3CT method using a sample of cells expressing these genes in a normal way as a calibrator or by extrapolating the copy number of the transcripts of the target genes from a standard curve. The latter is generated by a range of calibrant dilution constituted by a bacterial plasmid which contains both a target gene and reference gene sequence comprising the amplicons recognized on their corresponding cDNAs (d) the evolution of this ratio between a group of control patients with or without benign prostatic pathology and prostate cancer patients with positive or negative prostate biopsies, can determine a minimum threshold of detection and identification of patients candidates for management.
Selon une caractéristique de l'invention, a) les amorces permettant par exemple la détection du transcrit du gène PCA3 dans un échantillon biologique ont les séquences d'oligonucléotides : SEQ ID NO : 1, SEQ ID NO : 2, b) les amorces pour détecter le transcrit du gène contrôle par exemple RPL5 dans un échantillon biologique ont des séquences d'oligonucléotides sélectionnées parmi un groupe de : SEQ ID NO : 15, SEQ ID NO : 16, SEQ ID NO : 17, SEQ ID NO : 18, SEQ ID NO : 19, SEQ ID NO : 20. According to one characteristic of the invention, a) the primers allowing for example the detection of the PCA3 gene transcript in a biological sample have the oligonucleotide sequences: SEQ ID NO: 1, SEQ ID NO: 2, b) the primers for detect the transcript of the control gene for example RPL5 in a biological sample have oligonucleotide sequences selected from a group of: SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20.
Selon une autre caractéristique de la présente invention, a) la sonde pour détecter le transcrit du gène PCA3 dans un test échantillon a une séquence SEQ ID : 3, b) la sonde pour détecter le transcrit du gène contrôle RPL5 dans un échantillon biologique a une séquence SEQ ID : 21. According to another characteristic of the present invention, a) the probe for detecting the PCA3 gene transcript in a sample test has a sequence SEQ ID: 3, b) the probe for detecting the transcript of the RPL5 control gene in a biological sample has a sequence SEQ ID: 21.
En accord avec cette invention, l'ensemble des amorces qui amplifient par exemple les transcrit du gène PCA3 et RPL5 dans un échantillon biologique inclus, a) pour PCA3 par exemple, une amorce «forward» ayant une séquence: SEQ ID NO : 1, et une amorce «reverse» ayant une séquence SEQ ID NO : 2, b) pour RPL5par exemple, une amorce «forward» ayant une séquence parmi le groupe : SEQ ID NO : 15, SEQ ID NO : 16, SEQ ID NO : 17 et une amorce «reverse» ayant une séquence sélectionnée parmi SEQ ID NO : 18, SEQ ID NO : 19, SEQ ID NO : 20. According to this invention, all the primers which amplify, for example, the transcripts of the PCA3 and RPL5 gene in an included biological sample, a) for PCA3 for example, a "forward" primer having a sequence: SEQ ID NO: 1, and a "reverse" primer having a sequence SEQ ID NO: 2, b) for RPL5 for example, a "forward" primer having a sequence from the group: SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 and a "reverse" primer having a sequence selected from SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20.
La présente invention concerne aussi une méthode pour la détection des transcrits des gènes PCA3 et RPL5 dans un même échantillon biologique. Cette méthode se déroule en plusieurs étapes, a) Pour PCA3, mettre en contact un échantillon biologique avec une amorce «forward» ayant une séquence SEQ ID NO : 1, et une amorce «reverse» sélectionnée SEQ ID NO : 2 dans des conditions d'amplification spécifiques pour générer une séquence cible, b) Pour RPL5, mettre en contact un échantillon biologique avec une amorce «forward» ayant une séquence sélectionnée parmi SEQ ID NO : 15, SEQ ID NO : 16, et une amorce reverse sélectionnée parmi SEQ ID NO : 18, SEQ ID NO : 19, SEQ ID NO : 20, dans des conditions d'amplification spécifiques pour générer une séquence cible, c) Détecter l'amplification des deux séquences cibles, PCA3 et RPL5, dans un même échantillon biologique avec deux sondes différentes. Pour PCA3, la sonde a une séquence SEQ ID NO : 3 et pourRPL5, la sonde a une séquence SEQ ID NO : 21. Selon la présente invention, la méthode d'amplification d'un gène consiste à mettre l'échantillon biologique dans une réaction d'amplification en présence de réactifs d'amplification. La réaction d'amplification peut être une PCR, RT-PCR ou qPCR. The present invention also relates to a method for the detection of PCA3 and RPL5 gene transcripts in the same biological sample. This method takes place in several steps, a) For PCA3, put a biological sample in contact with a "forward" primer having a sequence SEQ ID NO: 1, and a "reverse" primer selected SEQ ID NO: 2 under specific amplification conditions to generate a target sequence; b) For RPL5, bringing a biological sample into contact with a "forward" primer having a sequence selected from SEQ ID NO: 15, SEQ ID NO: 16, and a reverse primer selected from SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, under the conditions of specific amplification to generate a target sequence, c) Detect the amplification of the two target sequences, PCA3 and RPL5, in the same biological sample with two different probes. For PCA3, the probe has a sequence SEQ ID NO: 3 and for RPL5, the probe has a sequence SEQ ID NO: 21. According to the present invention, the method of amplification of a gene consists in putting the biological sample in a amplification reaction in the presence of amplification reagents. The amplification reaction may be PCR, RT-PCR or qPCR.
En accordance avec la présente invention, une sonde contient une unité fluorescente (reporter) attachée à la région 5' d'ADN, en plus d'une partie quencher à la région 3' d'ADN. La quantification de l'unité fluorescence permet la quantification des gènes cibles et des gènes contrôles (PCA3 ouRPL5). In accordance with the present invention, a probe contains a fluorescent unit (reporter) attached to the 5 'region of DNA, in addition to a quencher portion to the 3' region of DNA. The quantification of the fluorescence unit allows the quantification of target genes and control genes (PCA3 or RPL5).
En accordance aussi avec cette invention, l'amplification des transcrits des gènes cibles : PCA3, AMACR ou TMPRSS2-ERG et l'un des gènes de références : RPL5, HPRT1 ou HNRNPAlpar la qPCR de la présente invention peuvent se faire en format simplexe ou multiplexe. Also according to this invention, the amplification of the transcripts of the target genes: PCA3, AMACR or TMPRSS2-ERG and one of the reference genes: RPL5, HPRT1 or HNRNPA1 by the qPCR of the present invention can be in simplex format or multiplex.
BREVE DESCRIPTION DES FIGURES BRIEF DESCRIPTION OF THE FIGURES
Figure la: Graphique représentant les cycles de la PCR en fonction du Delta Rn pour les transcrits du gène PCA3. La lignée cellulaire du cancer de la prostate positive pour le PCA3 (LNCaP) est utilisée comme source du matériel génétique subissant une qPCR de la présente invention. Cinq concentrations d'ADNc (ADN résultant de la transcription inverse de l'ensemble des ARNm de LNCaP) (1.25pg - 12.5 ng) ont été utilisées.  Figure la: Graph showing PCR cycles versus Delta Rn for PCA3 gene transcripts. The PCA3 positive prostate cancer cell line (LNCaP) is used as the source of the genetic material undergoing qPCR of the present invention. Five concentrations of cDNA (DNA resulting from reverse transcription of all LNCaP mRNAs) (1.25pg - 12.5 ng) were used.
Figure lb: Graphique représentant les cycles de la PCR en fonction du Delta Rn pour les transcrits du gène AMACR. La lignée cellulaire du cancer de la prostate positive pour l'AMACR (LNCaP) est utilisée comme source du matériel génétique subissant une qPCR de la présente invention. 5 concentrations d'ADNc (ADN résultant de la transcription inverse de l'ensemble des ARNm de LNCaP) (1.25pg - 12.5 ng) ont été utilisées. Figure 1b: Graph showing PCR cycles versus Delta Rn for AMACR gene transcripts. The AMACR positive prostate cancer cell line (LNCaP) is used as the source of the genetic material undergoing a qPCR of the present invention. 5 cDNA concentrations (DNA resulting from reverse transcription of all LNCaP mRNAs) (1.25 μg - 12.5 ng) were used.
Figure 1C: Graphique représentant les cycles de la PCR en fonction du Delta Rn pour les transcrits du gène TMPRSS2-ERG. La lignée cellulaire du cancer de la prostate positive pour le TMPRSS2-ERG (VCaP) est utilisée comme source du matériel génétique subissant une qPCR de la présente invention. 5 concentrations d'ADNc (ADN résultant de la transcription inverse de l'ensemble des ARNm de VCaP) (1.25pg - 12.5 ng) ont été utilisées.  Figure 1C: Graph showing PCR cycles versus Delta Rn for transcripts of the TMPRSS2-ERG gene. The prostate cancer cell line positive for TMPRSS2-ERG (VCaP) is used as the source of the genetic material undergoing qPCR of the present invention. CDNA concentrations (DNA resulting from reverse transcription of all VCaP mRNAs) (1.25 μg - 12.5 ng) were used.
Figure 2a : Courbe standard (Cycle threshold (Ct)-versus-log quantité ADNc) reconstituée par les résultats obtenus en Figure la. Figure 2a: Standard curve (Cycle threshold (Ct) -versus-log amount cDNA) reconstituted by the results obtained in Figure la.
Figure 2b : Courbe standard (Cycle threshold (Ct)-versus-log quantité ADNc) reconstituée par les résultats obtenus en Figure lb.  Figure 2b: Standard curve (Cycle threshold (Ct) -versus-log amount cDNA) reconstituted by the results obtained in Figure lb.
Figure 2c : Courbe standard (Cycle threshold (Ct)-versus-log quantité ADNc) reconstituée par les résultats obtenus en Figure le.  Figure 2c: Standard curve (Cycle threshold (Ct) -versus-log amount cDNA) reconstituted by the results obtained in Figure 1c.
Figure 3a: Graphique représentant les cycles de la PCR en fonction du Delta Rn pour les transcrits du gène RPL5. La lignée cellulaire du cancer de la prostate positive (LNCaP) est utilisée comme source du matériel génétique subissant une qPCR de la présente invention. 5 concentrations d'ADNc (ADN résultant de la transcription inverse de l'ensemble des ARNm de LNCaP) (1.25pg - 12.5 ng) ont été utilisées. Figure 3a: Graph showing PCR cycles versus Delta Rn for transcripts of the RPL5 gene. The positive prostate cancer cell line (LNCaP) is used as the source of the genetic material undergoing qPCR of the present invention. 5 cDNA concentrations (DNA resulting from reverse transcription of all LNCaP mRNAs) (1.25 μg - 12.5 ng) were used.
Figure 3b :Graphique représentant les cycles de la PCR en fonction du Delta Rn pour les transcrits du gène HNRNPAl. La lignée cellulaire du cancer de la prostate positive (LNCaP) est utilisée comme source du matériel génétique subissant une qPCR de la présente invention. 5 concentrations d'ADNc (ADN résultant de la transcription inverse de l'ensemble des ARNm de LNCaP) (1.25pg - 12.5 ng) ont été utilisées. Figure 3b: Graph showing PCR cycles versus Delta Rn for transcripts of the HNRNPA1 gene. The positive prostate cancer cell line (LNCaP) is used as the source of the genetic material undergoing qPCR of the present invention. 5 cDNA concentrations (DNA resulting from reverse transcription of all LNCaP mRNAs) (1.25 μg - 12.5 ng) were used.
Figure 3c: Graphique représentant les cycles de la PCR en fonction du Delta Rn pour les transcrits du gène HNRNPAl. La lignée cellulaire du cancer de la prostate positive (LNCaP) est utilisée comme source du matériel génétique subissant une qPCR de la présente invention. 5 concentrations d'ADNc (ADN résultant de la transcription inverse de l'ensemble des ARNm de LNCaP) (1.25pg - 12.5 ng) ont été utilisées. Figure 3c: Graph showing PCR cycles versus Delta Rn for transcripts of the HNRNPA1 gene. The positive prostate cancer cell line (LNCaP) is used as the source of the genetic material undergoing qPCR of the present invention. 5 cDNA concentrations (DNA resulting from reverse transcription of all LNCaP mRNAs) (1.25 μg - 12.5 ng) were used.
Figure 4a : Courbe standard (Cycle threshold (Ct)-versus-log quantité ADNc) reconstituée par les résultats obtenus en Figure 4a. Figure 4b : Courbe standard (Cycle threshold (Ct)-versus-log quantité ADNc) reconstituée par les résultats obtenus en Figure 4b. Figure 4a: Standard curve (Cycle threshold (Ct) -versus-log amount cDNA) reconstituted by the results obtained in Figure 4a. Figure 4b: Standard curve (Cycle threshold (Ct) -versus-log amount cDNA) reconstituted by the results obtained in Figure 4b.
Figure 4c : Courbe standard (Cycle threshold (Ct)-versus-log quantité ADNc) reconstituée par les résultats obtenus en Figure 4c.  Figure 4c: Standard curve (Cycle threshold (Ct) -versus-log amount cDNA) reconstituted by the results obtained in Figure 4c.
Figure 5 : Courbes des gènes contrôles les plus stables et les moins stables dans les biopsies prostatique de patients atteint de cancer ou non. L'expression de plusieurs gènes contrôles a été quantifiée par la qPCR de la présente invention. Figure 5: Curves of the most stable and less stable control genes in prostate biopsies of cancer patients and non-cancer patients. The expression of several control genes was quantified by the qPCR of the present invention.
EXPOSE DETAILLE DE L'INVENTION La présente invention préconise de nouvelles sondes, amorces, ensemble d'amorces, ensemble de sondes et amorces qui peuvent être utilisés pour amplifier, détecter et quantifier avec plus de fiabilité les gènes spécifiquement exprimés dans le cancer de la prostate PCA3 et/ou AMACR et/ou TMPRSS2-ERG ou les gènes contrôles RPL5 et/ou HPRT1 et/ou HNRNPA1 dans un échantillon biologique. L'invention préconise aussi une méthode de détection des transcrits des gènes cibles PCA3 et/ou AMACR et/ou TMPRSS2-ERG et des gènes contrôles RPL5 et/ou HPRT1 et/ou HNRNPA1 dans un échantillon biologique en utilisant les ensembles d'amorces et sondes cités précédemment. L'ensemble des amorces et sondes de la présente invention permettent une meilleur sensibilité et spécificité pour détecter les transcrits des gènes cibles et des gènes contrôles. DETAILED DESCRIPTION OF THE INVENTION The present invention advocates novel probes, primers, primer sets, probe sets, and primers that can be used to amplify, detect, and more reliably quantify the genes specifically expressed in prostate cancer. PCA3 and / or AMACR and / or TMPRSS2-ERG or the control genes RPL5 and / or HPRT1 and / or HNRNPA1 in a biological sample. The invention also provides a method for detecting transcripts of the PCA3 and / or AMACR and / or TMPRSS2-ERG target genes and RPL5 and / or HPRT1 and / or HNRNPA1 control genes in a biological sample using the primers and probes mentioned above. The set of primers and probes of the present invention allow a better sensitivity and specificity for detecting transcripts of target genes and control genes.
Selon une caractéristique de la présente invention, l'amplification des transcrits des gènes PCA3 et/ou AMACR et/ou TMPRSS2-ERG et des gènes contrôles RPL5 et/ou HPRT1 et/ou HNRNPA1 se fait au moins en qPCR en format simplexe ou multiplexe permettant ainsi d'asseoir un diagnostic assuré du cancer de la prostate et un gain en temps et en cout. Selon une autre caractéristique de l'invention, la détection et la quantification plus sensible et plus spécifique permettra de sélectionner les patients candidats pour une prise en charge adaptée. Le mot 'PCA3' décrit dans la présente invention, représente le gène 'Prostate cancer antigen 3' qui produit des ARNm non codants, ce gène est exprimé uniquement au niveau des tissus prostatique et surexprimé dans le cas d'un cancer de la prostate. According to one characteristic of the present invention, the amplification of the transcripts of the PCA3 and / or AMACR and / or TMPRSS2-ERG genes and of the RPL5 and / or HPRT1 and / or HNRNPA1 control genes is at least in qPCR in simplex or multiplexed format. thus making it possible to establish an assured diagnosis of prostate cancer and a gain in time and cost. According to another characteristic of the invention, the more sensitive and specific detection and quantification will make it possible to select the candidate patients for appropriate management. The word 'PCA3' described in the present invention represents the 'Prostate cancer antigen 3' gene which produces noncoding mRNAs, this gene is expressed only in the prostate tissue and overexpressed in the case of prostate cancer.
Le mot 'AMACR' décrit dans la présente invention, représente le gène 'alpha-methylacyl- CoAracemase' qui code pour une isomérase impliquée dans la bêta-oxydation des chaînes ramifiées des acides gras et dérivés, un niveau élevé de la protéine AMACR et son activité est associé au cancer de la prostate. Le mot 'TMPRSS2-ERG' décrit dans la présente invention, représente le gène de fusion issue d'une translocation du gène androgénorégulé TMPRSSS2 (transmembraneprotease serine 2) fortement exprimé par les cellules prostatiques normales et cancéreuses, au gène ERG qui code pour des facteurs de transcription intervenant dans les voies de signalisation régulatrice de la croissance cellulaire, la différenciation et la carcinogenèse. La détection et la quantification des transcrits des gènes cité ci-dessus permet d'asseoir un diagnostic fiable et de procéder à une prise en charge adaptée. Le mot 'gène' utilisé dans la présente invention réfère à une séquence d'acide nucléique de la molécule d'ADN occupant une région précise dans un chromosome et permet de coder les instructions pour la synthèse de l'ARN. The word 'AMACR' described in the present invention represents the 'alpha-methylacyl-CoAracemase' gene which encodes an isomerase involved in the beta-oxidation of branched chains of fatty acids and derivatives, a high level of the AMACR protein and its activity is associated with prostate cancer. The word "TMPRSS2-ERG" described in the present invention represents the fusion gene resulting from a translocation of the androgen-regulated gene TMPRSSS2 (transmembraneprotease serine 2) strongly expressed by normal and cancerous prostate cells, to the ERG gene which encodes factors. of transcription intervening in regulatory signaling pathways of cell growth, differentiation and carcinogenesis. The detection and quantification of gene transcripts mentioned above makes it possible to establish a reliable diagnosis and to carry out appropriate treatment. The word 'gene' used in the present invention refers to a nucleic acid sequence of the DNA molecule occupying a specific region in a chromosome and permits the encoding of instructions for RNA synthesis.
Le mot 'gène cible' utilisé dans la présente invention réfère aux gènes dont en cible la détection et la quantification dans un échantillon biologique pour le diagnostic du cancer de la prostate. The term 'target gene' used in the present invention refers to genes whose detection and quantification is targeted in a biological sample for the diagnosis of prostate cancer.
Le mot Oligonucléotide' est une séquence composée d'ADN ou d'ARN ou leur combinaison avec une longueur qui varie de 10 à 70 nucléotides. Les oligonucléotides sont généralement obtenus par synthèse chimique, sous forme de simple brin. The word Oligonucleotide is a sequence composed of DNA or RNA or their combination with a length that ranges from 10 to 70 nucleotides. The oligonucleotides are generally obtained by chemical synthesis, in the form of a single strand.
L'amplification comme utilisé ici, réfère à une ou plusieurs méthodes capables de copier un acide nucléique permettant ainsi une augmentation du nombre de copie d'une séquence d'acide nucléique cible. La séquence amplifiée peut être un acide ribonucléotide (ARN) ou un acide desoxyribonucléotide (ADN) Le mot 'transcription inverse' citée ici, représente une méthode permettant la synthèse d'ADN complémentaire (ADNc) à partir de molécule d'ARN. L'ADNc sera utilisée dans la méthode PCR, RT-PCR ou qPCR. Amplification as used herein refers to one or more methods capable of copying a nucleic acid thereby allowing an increase in the number of copies of a target nucleic acid sequence. The amplified sequence may be a ribonucleotide acid (RNA) or a deoxyribonucleotide acid (DNA) The term 'reverse transcription', referred to herein, represents a method for the synthesis of complementary DNA (cDNA) from an RNA molecule. The cDNA will be used in the PCR, RT-PCR or qPCR method.
Le mot 'amorce' réfère à une séquence d'oligonucléotides synthétisée chimiquement ou naturellement. L'amorce est le point d'initiation de la synthèse d'ADN dans des conditions optimales de température et en présence de d'enzyme, tampons, de nucléotides et de séquences nucléotidiques complémentaires spécifiques. The word "primer" refers to a sequence of oligonucleotides synthesized chemically or naturally. The primer is the point of initiation of DNA synthesis under optimal temperature conditions and in the presence of specific enzyme, buffers, nucleotides and complementary nucleotide sequences.
Le mot 'sonde' citée ici réfère à une séquence nucléotidique qui forme une structure hybride avec une séquence cible dans une molécule d'un échantillon biologique. Le mot 'PCR' (polymerasechainreaction) comme utilisée dans la présente invention réfère à une méthode dont un échantillon d'ADNc ou d'ADN est ajouté dans une solution en présence de nucléotides non attachés (exemple les dNTPs), 2 oligonucleotides amorces (forward et reverse); et de l'enzyme ADN polymérase (préférablement la Taq polymérase résistant à la chaleur) qui permet la catalyse la formation d'ADN à partir des 2 amorces et dNTPs. La solution mixe est chauffée à 94-96 C° pour dénaturer la molécule d'ADN et former 2 brins simples d'ADN. Les amorces vont ensuite se fixer spécifiquement sur l'ADN simple brin permettant ainsi à l'ADN polymérase de catalyser l'attachement des dNTPs aux amorces. The word 'probe' referred to herein refers to a nucleotide sequence that forms a hybrid structure with a target sequence in a molecule of a biological sample. The word 'PCR' (polymerasechainreaction) as used in the present invention refers to a method of which a cDNA or DNA sample is added in a solution in the presence of unattached nucleotides (eg dNTPs), 2 oligonucleotide primers (forward and reverse); and DNA polymerase enzyme (preferably heat-resistant Taq polymerase) which catalyzes the formation of DNA from both primers and dNTPs. The mixed solution is heated to 94-96 ° C to denature the DNA molecule and form 2 single strands of DNA. The primers will then bind specifically to the single-stranded DNA thereby allowing the DNA polymerase to catalyze the attachment of the dNTPs to the primers.
Le mot 'RT-PCR' (reverse transcriptase-PCR) utilisé dans la présente invention représente une méthode de PCR dont le produit de départ n'est pas directement un ADN mais un ARN traduit en ADNc après transcription inverse. The word 'RT-PCR' (reverse transcriptase-PCR) used in the present invention represents a PCR method whose starting material is not directly DNA but an RNA translated into cDNA after reverse transcription.
Le mot 'qPCR' (quantitative PCR ou real time RT-PCR) décrit dans la présente invention représente une méthode de PCR permettant l'étude des produits de la réaction PCR pendant les premières étapes d'amplification de l'ADN. La détection des produits de PCR se fait par des sondes marquées à leur extrémité 5' par un fluorochrome émetteur (reporter), et à leur extrémité 3' par un fluorochrome suppresseur (quencher) fluorescent ou non, qui inhibe l'émission du reporter lorsqu'ils sont à proximité. Dans ce cas, l'intensité du signal de la fluorescence mesurée au cours la réaction d'amplification est proportionnelle au nombre de produits nouvellement formés (amplicons). La mesure en ADN ou ADNc se fait en logarithme. La détection et la quantification du nombre de copies d'un gène cible présent initialement dans un échantillon biologique par qPCR, est généralement dérivée de son CT (cycle threshold). Le CT dépend de la quantité de matrice initialement présente dans l'échantillon biologique amplifié et correspond au nombre de cycles d'amplification où la courbe d'amplification croise la ligne de seuil. Cette ligne est placée au niveau de la phase exponentielle, de façon à se distinguer clairement du bruit de fond. The word "qPCR" (quantitative PCR or real time RT-PCR) described in the present invention represents a PCR method for studying the products of the PCR reaction during the first DNA amplification steps. The PCR products are detected by probes labeled at the 5 'end by a transmitter fluorochrome (reporter), and at their 3' end by a fluorescent or non-fluorescent quencher, which inhibits the emission of the reporter when they are nearby. In this case, the signal intensity of the fluorescence measured during the amplification reaction is proportional to the number of newly formed products (amplicons). The measurement in DNA or cDNA is done in logarithm. The detection and quantification of the number of copies of a target gene initially present in a biological sample by qPCR is generally derived from its C T (cycle threshold). The CT depends on the amount of matrix initially present in the amplified biological sample and corresponds to the number of amplification cycles where the amplification curve crosses the threshold line. This line is placed at the exponential phase, so as to be clearly distinguishable from background noise.
Parmi les sondes les plus utilisées en qPCR on trouve les sondes « molecularbeacons » et TaqMan qui utilisent l'activité exonucléase 5 fluorogénique de l'enzyme Taq polymérase pour mesurer la quantité de la séquence d'ADN dans un échantillon biologique. Préférentiellement, la qPCR de la présente invention utilise les sondes TaqMan et l'analyse d'amplification est faite par ABI PRISM 7900HT 'sequencedetection System' qui est un système de screening pouvant détecter et quantifier des acides nucléiques. La quantité des gènes PCA3, AMACR et TMPRSS2-ERG et des gènes contrôles est calculée par le logiciel intégré dans le système ABI PRISM 7900HT en utilisant soit la méthode de la quantification relative ou de la courbe standard. Selon la présente invention, le reporteur de la sonde peut être FAM, JOE, YAKYE (YY) et le quencher BBQ, BHOJL, ou TAMRA. Among the most used probes in qPCR are the "molecularbeacons" and TaqMan probes that use the fluorogenic exonuclease activity of the Taq polymerase enzyme to measure the amount of the DNA sequence in a biological sample. Preferentially, the qPCR of the present invention uses TaqMan probes and the amplification analysis is made by ABI PRISM 7900HT 'sequenced detection system' which is a screening system that can detect and quantify nucleic acids. The amount of the PCA3, AMACR and TMPRSS2-ERG genes and control genes is calculated by the software integrated into the ABI PRISM 7900HT system using either the relative quantization method or the standard curve. According to the present invention, the reporter of the probe can be FAM, JOE, YAKYE (YY) and the BBQ quencher, BHOJL, or TAMRA.
Le mot simplexe de la présente invention représente un essai qui ne se déroule pas simultanément avec d'autres essais dans le même tube réactionnel. Selon la présente invention, la qPCR en simplexe reflète la détection et la quantification du nombre de copies d'un seul gène dans un tube de réaction. The simplex word of the present invention represents an assay which does not proceed simultaneously with other assays in the same reaction tube. According to the present invention, simplex qPCR reflects the detection and quantification of the copy number of a single gene in a reaction tube.
Le mot 'gène contrôle', 'gène de référence' ou 'housekeepinggene' décrit dans la présente invention, représente un gène dont l'expression est ubiquitaire, stable entre les différents tissus, entre les individus et quelles que soient les conditions expérimentales. L'utilisation de ce contrôle endogène permet en théorie de contrôler toutes les étapes du protocole expérimental, son expression reflétant non seulement la quantité et la qualité de l'ARIM utilisé, mais aussi les efficacités de la RT et de la PCR. The word "control gene", "reference gene" or "housekeepinggene" described in the present invention, represents a gene whose expression is ubiquitous, stable between different tissues, between individuals and whatever the experimental conditions. The use of this endogenous control theoretically controls all steps of the experimental protocol, its expression reflecting not only the quantity and quality of the MRIA used, but also the efficiencies of RT and PCR.
Parmi les gènes contrôles les plus utilisés, on retrouve l'ACTB (β-actine) la B2M (β-2- microglobuline, le GAPDH (glyceraldehyd-3-phosphate dehydrogenase), l'HPRT (hypoxanthineribosyltransferase) et autres. Le mot multiplexe cité dans la présente invention réfère à un essai qui se déroule simultanément avec au moins un autre essai dans le même tube réactionnel. La qPCR en multiplexe préconise une détection et une quantification du nombre de copies d'au moins 2 gènes dans un même tube de réaction. Selon la présente invention, les 2 gènes en question sont soit des gènes cible, des gènes contrôles ou un gène cible et un gène contrôle, qui peuvent être détectés simultanément par qPCR. Among the most used control genes, there are ACTB (β-actin) B2M (β-2-microglobulin, GAPDH (glyceraldehyd-3-phosphate dehydrogenase), HPRT (hypoxanthineribosyltransferase) and others. The multiplex word cited in the present invention refers to an assay that runs concurrently with at least one other assay in the same reaction tube. The multiplexed qPCR recommends detection and quantification of the number of copies of at least 2 genes in the same reaction tube. According to the present invention, the 2 genes in question are either target genes, control genes or a target gene and a control gene, which can be simultaneously detected by qPCR.
Le mot 'échantillon biologique' comme décrit dans la présente invention réfère à un fluide corporel, ce fluide peut être un sérum, un plasma, une salive, un éjaculat ou une urine ou un échantillon de tissu prostatique issu d'une biopsie fraîche ou paraffinée tumoral ou non, n'exprimant pas, exprimant ou surexprimant les gènes cibles. En accord avec la présente invention, l'échantillon biologique peut être d'origine humaine ou animal n'exprimant pas, exprimant ou surexprimant les gènes cibles qui peuvent être amplifié en utilisant les amorces et sondes de la présente invention. The word 'biological sample' as described in the present invention refers to a body fluid, which fluid may be a serum, plasma, saliva, ejaculate or urine or a prostate tissue sample derived from a fresh or waxed biopsy tumor or not, not expressing, expressing or overexpressing the target genes. In accordance with the present invention, the biological sample may be of human or animal origin that does not express, expressing or overexpressing the target genes that can be amplified using the primers and probes of the present invention.
EXEMPLES EXAMPLES
L'exemple 1 représente une description du protocole utilisé dans la méthode qPCR de la présente invention. Les étapes d'extraction d'ARN, de synthèse d'ADNc et de qPCR sont décrites dans ce protocole. Example 1 represents a description of the protocol used in the qPCR method of the present invention. The steps of RNA extraction, cDNA synthesis and qPCR are described in this protocol.
L'exemple 2: Figure 1 et Figure 2 décrivent la haute sensibilité et spécificité de la qPCR de la présente invention pour détecter les transcrits des gènes PCA3 et l'AMACR au niveau de lignées cellulaires humaine du cancer de la prostate, LNCaP surexprimant PCA3 et AMACR. Les résultats de la qPCR de la présente invention sont montrés en Figure 1 (courbe d'amplification : cycle-vs-Delta Rn), Figure 2 (courbe standard : quantité d'ADNc de LNCaP vs-valeurs Ct). Les valeurs de qualité obtenus sont suivant les normes IVD internationales (R2>0,95, slope entre -3,0 et 3,9 et éfficacité de 90-112)) avec une courbe standard à : un slope de -3,215, un R2 de 0,986 et une efficacité de 104,66 pour le gène PCA3 (Figure 2a) ; un slope de -3,393, un R2 de 0,998 et une efficacité de 97,101 pour le gène AMACR (Figure 2b)). Les courbes d'amplification (Figure 1) montrent aussi des allures parfaites. L'exemple 3: Figure 3 et Figure 4 décrivent la haute sensibilité et spécificité de la qPCR de la présente invention pour détecter les transcrits des gènes contrôles au niveau de la lignée cellulaire humaine du cancer de la prostate. Example 2: Figure 1 and Figure 2 describe the high sensitivity and specificity of the qPCR of the present invention for detecting PCA3 and AMACR gene transcripts at human prostate cancer cell lines, LNCaP overexpressing PCA3 and AMACR. The results of the qPCR of the present invention are shown in Figure 1 (amplification curve: cycle-vs-Delta Rn), Figure 2 (standard curve: amount of LNCaP cDNA vs. Ct values). The quality values obtained are according to international IVD standards (R2> 0.95, slope between -3.0 and 3.9 and efficiency of 90-112)) with a standard curve at: a slope of -3.215, a R2 0.986 and an efficiency of 104.66 for the PCA3 gene (Figure 2a); a slope of -3,393, an R2 of 0.998 and an efficiency of 97.101 for the AMACR gene (Figure 2b)). The amplification curves (Figure 1) also show perfect paces. Example 3: Figure 3 and Figure 4 describe the high sensitivity and specificity of the qPCR of the present invention for detecting transcripts of the control genes at the human prostate cancer cell line.
Les résultats de la qPCR de la présente invention sont montrés en Figure 3(courbe d'amplification : cycle-vs-Delta Rn), Figure 4 (courbe standard : quantité d'ADNc de LNCaP- vs-valeurs Ct) . Les valeurs de qualité obtenus sont suivant les normes IVD internationales (R2>0,95, slope entre -3,0 et 3,9 et éfficacité de 90-112)) avec une courbe standard à un slope de -3,49, un R2 de 0,999 et une efficacité de 101 ,884 pour le gène RPL5 (Figure 4a) ; un slope de -3,278, un R2 de 0,996 et une efficacité de 101,884 pour le gène HNRNPAl(Figure 4b) et un slope de -3,465, un R2 de 0,993 et une efficacité de 94,365 pour le gène 1 HPRT1 (Figure 4c). Les courbes d'amplification (Figure 3) montrent aussi des allures parfaites.  The results of the qPCR of the present invention are shown in Figure 3 (amplification curve: cycle-vs-Delta Rn), Figure 4 (standard curve: amount of LNCaP cDNA vs Ct-values). The quality values obtained are according to international IVD standards (R2> 0.95, slope between -3.0 and 3.9 and efficiency of 90-112)) with a standard curve at a slope of -3.49, a R2 of 0.999 and an efficiency of 101, 884 for the RPL5 gene (Figure 4a); a slope of -3.278, an R2 of 0.996 and an efficiency of 101.884 for the HNRNPA1 gene (FIG. 4b) and a slope of -3.465, an R2 of 0.993 and an efficiency of 94.365 for the 1 HPRT1 gene (FIG. 4c). The amplification curves (Figure 3) also show perfect paces.
L'exemple 4: Figure 5 montre la courbe des gènes contrôles les plus stables. La mesure de la stabilité de l'expression de plusieurs gènes contrôles par qPCR sur des échantillons biologique été validée en utilisant le logiciel GeNorm. Les gènes contrôles RPL5, HPRT1 et HNRNPA1 se trouvent tous à droite de là courbe dans la partie des gènes les plus stables (Figure 5). Les mêmes gènes contrôles ont été identifiés aussi comme les plus stables dans les lignées cellulaires de la prostate (LNCaP, VCaP, NPrEC) en utilisant le même logiciel Genorm (résultats ne sont pas montrés).  Example 4: Figure 5 shows the curve of the most stable control genes. The measurement of the stability of the expression of several control genes by qPCR on biological samples was validated using the GeNorm software. The control genes RPL5, HPRT1 and HNRNPA1 are all to the right of this curve in the part of the most stable genes (Figure 5). The same control genes were also identified as the most stable in prostate cell lines (LNCaP, VCaP, NPrEC) using the same Genorm software (results are not shown).
EXPERIENCES EXPERIENCES
Exemple 1 : Protocole de qPCR de la présente invention pour la détection et la quantification des transcrits des gènes PCA3, AMACR et TMPRSS2-ERG au niveau des lignées cellulaires positives de la prostate ou des biopsies paraffinées du cancer de la prostate RNeasy mini kit du Qiagen a été utilisé pour extraire l'ARN cellulaire deLNCaP, VCaP et NPrEC selon les recommandations du fournisseur (Qjagenlnc). Alors que l'extraction de l'ARN à partir des biopsies prostatique a été faite par le kit PureLinkTM FFPE Total RNA Isolation Kit suivant les recommandations des fournisseurs. La quantité de l'ARN a été mesuré au NanoDrop 2000 Spectrophotometer (Thermo SCIENTIFIC), tandis que la qualité et la pureté de l'ARN obtenue est testée par électrophorèse sur gel d'agarose, ou par le Bioanalyzer (Agilant). L'ADN complémentaire (ADNc) est obtenu à partir d'ARN total extrait d'échantillon test. La synthèse d'ADNc est réalisée à l'aide du Thermocycleur (AppliedBiosystems) en utilisant le kit RNA to cDNA Reverse Transcription selon les recommandations du fournisseur (AppliedBiosystems). Les amorces et la sonde des gènes cibles et 5μΙ d'ADNc sont ajoutés au mastermix de la réaction qPCR (TaqManFastUniversal PCR Master mix : AppliedBiosystems) pour un volume final de 25μΙ. Example 1: qPCR protocol of the present invention for the detection and quantification of PCA3, AMACR and TMPRSS2-ERG gene transcripts in prostate positive cell lines or paraffinic biopsies of prostate cancer RNeasy mini kit from Qiagen was used to extract cellular RNA from LNCaP, VCaP and NPrEC according to the supplier's recommendations (Qjagenlnc). While RNA extraction from prostate biopsies was done by the PureLinkTM FFP Total RNA Isolation Kit following the recommendations of the suppliers. The amount of RNA was measured by the NanoDrop 2000 Spectrophotometer (Thermo SCIENTIFIC), while the quality and purity of the RNA obtained is tested by agarose gel electrophoresis, or by the Bioanalyzer (Agilant). The complementary DNA (cDNA) is obtained from total RNA extracted from the test sample. The cDNA synthesis is performed using the Thermocycler (AppliedBiosystems) using the RNA kit to cDNA Reverse Transcription according to the supplier's recommendations (AppliedBiosystems). The primers and the probe of the target genes and 5 μΙ of cDNA are added to the mastermix of the qPCR reaction (TaqManFastUniversal PCR Master mix: AppliedBiosystems) for a final volume of 25 μΙ.
Dans le cas de la réaction en format simplexe, seulement la sonde et les amorces de l'un des gènes cibles PCA3, AMACR et TMPRSS2-ERG ou gène contrôle sont utilisés dans différent puits de qPCR ; alors que pour la réaction en format multiplexe les sondes et les amorces pour l'un des gènes PCA3, AMACR et TMPRSS2-ERG et un gène contrôle sont utilisés simultanément dans le même puits de réaction qPCR.  In the case of the simplex reaction, only the probe and primers of one of the target genes PCA3, AMACR and TMPRSS2-ERG or control gene are used in different qPCR wells; while for the multiplexed reaction the probes and primers for one of the PCA3, AMACR and TMPRSS2-ERG genes and a control gene are used simultaneously in the same qPCR reaction well.
Les conditions du cycle thermal de la qPCR de la présente invention sont divisées en différentes étapes : étape 1 à 95C° pendant 20 secondes; étape 2 (cycle de 50) à 95C° pendant 1 seconde ; et une étape 3 à 60°C pendant 30 secondes.  The thermal cycle conditions of the qPCR of the present invention are divided into different steps: step 1 at 95 ° C for 20 seconds; step 2 (cycle 50) at 95 ° C for 1 second; and step 3 at 60 ° C for 30 seconds.
Dans le cas de la courbe standard de la qPCR de la présente invention, des séries de dilutions d'ADNc sont utilisées. Les concentrations utilisées sont l,25pg, 12,5pg, 125pg, l,25ng et 12,5ng. Pour cette courbe standard, et comme les réglementations international, une valeur R2>0,95 est acceptée par contre une valeur R2<0,95 est refusée et la qPCR doit être répétée. In the case of the standard qPCR curve of the present invention, sets of cDNA dilutions are used. The concentrations used are 1.25pg, 12.5pg, 125pg, 1.25ng and 12.5ng. For this standard curve, and as international regulations, a value R2> 0.95 is accepted, however, a value R2 <0.95 is refused and the qPCR must be repeated.
Exemples 2, 3: La performance de qPCR de la présente invention pour la détection et la quantification des transcrits des gènes cibles et les gènes contrôles dans les lignées cellulaires de la prostate (courbe d'amplification, courbe standard,) Examples 2, 3: The performance of qPCR of the present invention for the detection and quantification of target gene transcripts and control genes in prostate cell lines (amplification curve, standard curve)
Les séquences des amorces et de les sondes spécifiques pour chacun des gènes cible utilisés en Figure 1, Figure 2 Sequences of primers and probes specific for each of the target genes used in Figure 1, Figure 2
Pour le gène PCA3 : For the PCA3 gene:
- Amorce Forward : 5'ACAGAGATCCCTGGGAGAAA3' (SEQ ID N° 1)  Forward Forward: 5'ACAGAGATCCCTGGGAGAAA3 '(SEQ ID NO: 1)
- Amorce reverse : 5'AATGTCCTTCCCTCACAAGC 3' (SEQ ID N° 2)  Reverse primer: 5'AATGTCCTTCCCTCACAAGC 3 '(SEQ ID No. 2)
- Sonde : 5' R-ACCAGGCACAGGGCGAGGCT -Q 3' (SEQ ID N° 3) Pour le gène AMACR : Probe: 5 'R-ACCAGGCACAGGGCGAGGCT -Q 3' (SEQ ID NO: 3) For the AMACR gene:
- Amorce Forward : 5'GCGGTGTCATGGAGAAACT3' (SEQ ID N° 4)  Forward Forward: 5'GCGGTGTCATGGAGAAACT3 '(SEQ ID NO: 4)
- Amorce reverse : 5'CCACTCAG CCTG G C ATAA 3' (SEQ ID N°6)  Reverse primer: 5'CCACTCAG CCTG G C ATAA 3 '(SEQ ID No. 6)
- Sonde : 5' R- AG CCTTG G ATTTTCCCG CTG C-Q 3' (SEQ ID N° 8) Pour le gène TMPRSS2-ERG :  Probe: 5 'R-AG CCTTG ATTTTCCCG CTG C-Q 3' (SEQ ID NO: 8) For the TMPRSS2-ERG gene:
- Amorce Forward : 5' G G C AG G A AG CCTT ATC AGT 3'(SEQ ID N° 10)  Forward Forward: 5 'G G C AG AG AG AT AT AGT 3' (SEQ ID NO: 10)
- Amorce reverse : 5' CG CG GTC ATCTCTG TOT A 3' (SEQ ID N° 12)  Reverse primer: 5 'CG CG GTC ATCTCTG TOT A 3' (SEQ ID NO: 12)
- Sonde : 5' R- TGTGGCGTTCCGTAGGCACA-Q 3' (SEQ ID N° 14  Probe: 5 'R-TGTGGCGTTCCGTAGGCACA-Q 3' (SEQ ID NO: 14)
Pour les sondes : R= YY et Q=BHQ1 For the probes: R = YY and Q = BHQ1
Exemple 4 :La sélection des gènes de référence s'est effectuée selon la démarche suivante : une dizaine de gènes ont été sélectionnés en se basant sur l'état de l'art et sur des bases de données. L'analyse de la stabilité de ces gènes s'est faite au moyen de la qPCR selon les mêmes protocoles pour l'extraction et la synthèse d'ADNc que l'exemplel. Le plan des expériences a été fait de telle sorte que les gènes contrôles soient testés au niveau de différents échantillons biologiques à savoir les lignées cellulaires et des échantillons tissulaires, et ce dans deux conditions différentes (sains et malades). Trois répliquâtes ont été utilisés pour chaque conditions (les répliquâtes correspondent à des échantillons issue d'une extraction d'ARN et de réaction de RT différente), chacun de ces répliquâtes a été testé en duplicates dans la même expérience. Example 4: The selection of the reference genes was carried out according to the following procedure: a dozen genes were selected based on the state of the art and on databases. The stability analysis of these genes was done using qPCR according to the same protocols for the extraction and synthesis of cDNA as the exemplel. The experimental design was done in such a way that the control genes were tested in different biological samples, namely cell lines and tissue samples, under two different conditions (healthy and diseased). Three replicates were used for each condition (replicates correspond to samples from RNA extraction and different RT reaction), each of these replicates was tested in duplicate in the same experiment.
Les valeurs Ct obtenues au cours des différentes expériences pour le même échantillon, ont été rassemblées et exploité pour l'analyse par les différents logiciels. Pour les logiciels, NormFinder et BestKeeper les résultats bruts ont été analysé (les résultats de l'analyse ne sont pas représentés). Pour le geNorm, les valeurs Ct ont été converties en quantité relative (courbe étalon, méthode des ACt) selon la formule suivante : 2Cq ref ct mean ;Cqref = Ct min. La Figure 5 présente les résultats ce de cette analyse. The Ct values obtained during the different experiments for the same sample, were collected and used for analysis by the different software. For software, NormFinder and BestKeeper the raw results were analyzed (the results of the analysis are not shown). For the geNorm, the Ct values were converted into relative quantity (standard curve, ACt method) according to the following formula: 2 Cq ref ct mean ; Cqref = Ct min. Figure 5 presents the results of this analysis.

Claims

REVENDICATIONS: CLAIMS:
1. Méthode pour la détection et la quantification, dans un échantillon biologique 1. Method for detection and quantification, in a biological sample
provenant d'un patient, des gènes ou des transcrits de gènes cibles PCA3 et/ou  from a patient, genes or transcripts of PCA3 target genes and / or
AMACR et/ou TMPRSS2-ERG, caractérisée en ce que la méthode permet une augmentation en spécificité et sensibilité de la quantification de l'expression des gènes cibles PC A3, AMACR, TMPRSS2-ERG en utilisant des gènes contrôles  AMACR and / or TMPRSS2-ERG, characterized in that the method allows an increase in the specificity and sensitivity of the quantification of the expression of the target genes PC A3, AMACR, TMPRSS2-ERG using control genes
normalisateurs choisis parmi les gènes RPL5 et/ou HPRT1 et/ou HNRNPAl , dans le but de poser un diagnostic fiable du cancer de la prostate et en ce que la méthode comprend les étapes suivantes :  normalizers chosen from the RPL5 and / or HPRT1 and / or HNRNPA1 genes, in order to make a reliable diagnosis of prostate cancer and that the method comprises the following steps:
- Extraction de TARN à partir d'un échantillon biologique provenant d'un patient- Extraction of RNA from a biological sample from a patient
- Test de pureté et de la quantité de TARN par électrophorèse, nanodrop ou par bioanalyseur. - Test of purity and amount of RNA by electrophoresis, nanodrop or bioanalyzer.
- Synthèse de l'ADN complémentaire (ADNc) à partir de l'ARN total extrait de l'échantillon biologique et réalisé à l'aide du thermocycleur.  Synthesis of the complementary DNA (cDNA) from the total RNA extracted from the biological sample and carried out using the thermocycler.
- Ajout de 5 μΐ d'ADNc, d'une amorce «forward» ayant des séquences sélectionnées parmi le groupe de séquences : [SEQ ID N° 1 ,SEQ ID N° 4, SEQ ID N° 5, SEQ ID N° 9, SEQ ID N° 10 ,SEQ ID N° 15, SEQ ID N° 16, SEQ ID N° 17, SEQ ID N° 22 ,SEQ ID N° 25, SEQ ID N° 26], d'une amorce «reverse» sélectionnée parmi le groupe de séquences [SEQ ID N° 2, SEQ ID N° 6, SEQ ID N° 7, SEQ ID N° 1 1 , SEQ ID N° 12 ,SEQ ID N° 18, SEQ ID N° 19, SEQ ID N° 20, SEQ ID N° 23 ,SEQ ID N° 27, SEQ ID N° 28] et d'une sonde de détection sélectionnée parmi le groupe de séquences [SEQ ID N° 3, SEQ ID N° 8, et SEQ ID N° 13, SEQ ID N° 14, SEQ ID N° 21, et SEQ ID N° 24, SEQ ID N° 29] au master mix de la réaction qPCR pour un volume final d'au moins 25μ1.  Addition of 5 μl of cDNA, a "forward" primer having sequences selected from the group of sequences: [SEQ ID No. 1, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 9 , SEQ ID NO: 10, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 22, SEQ ID NO: 25, SEQ ID NO: 26], a reverse primer Selected from the group of sequences [SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 1 1, SEQ ID NO: 12, SEQ ID NO: 18, SEQ ID NO: 19 , SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 27, SEQ ID NO: 28] and a detection probe selected from the group of sequences [SEQ ID NO: 3, SEQ ID NO: 8 , and SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 21, and SEQ ID NO: 24, SEQ ID NO: 29] to the master mix of the qPCR reaction for a final volume of at least 25μ1.
- Application du cycle thermal de la qPCR  - Application of the qPCR thermal cycle
- Mesure de l'amplification du gène  - Measurement of gene amplification
2. Méthode selon la revendication 1, dans laquelle l'échantillon est un tissu prostatique ou un fluide corporel sélectionné parmi le sérum, le plasma, la salive, l'éjaculat ou l'urine. The method of claim 1, wherein the sample is a prostate tissue or body fluid selected from serum, plasma, saliva, ejaculate, or urine.
3. Méthode selon la revendication 1, ou les gènes contrôles normalisateurs utilisés pour ce test ont été identifiés parmi une série de gènes comme étant des gènes les plus stablement exprimés dans différents lignées cellulaires et biopsies surexprimant ou exprimant normalement les gènes cibles PC A3, AMACR et TMPRSS2-ERG. 3. Method according to claim 1, wherein the normalizing control genes used for this test have been identified among a series of genes as being the most stably expressed genes in different cell lines and biopsies overexpressing or expressing the target PC A3, AMACR target genes. and TMPRSS2-ERG.
4. Méthode selon la revendication 1, où deux amorces pour amplifier le transcrit des gènes contrôles normalisateurs dans l'échantillon biologique sont constituées d'une amorce «forward» ayant une séquence sélectionnée parmi le groupe de séquences : SEQ ID N° 15, SEQ ID N° 16, SEQ ID N° 17 pour le gène RPL5, SEQ ID N° 22 pour le gène HNRNPAl et SEQ ID N° 25, SEQ ID N° 26, pour le gène HPRT1 et une amorce «reverse» sélectionnée parmi le groupe de séquences : SEQ ID N° 15, SEQ ID N° 16, SEQ ID N° 17 pour le gène RPL5, SEQ ID N° 22 pour le gène HNRNPAl et SEQ ID N° 25, SEQ ID N° 26, pour le gène HPRT1.  4. Method according to claim 1, wherein two primers for amplifying the transcript of normalizing control genes in the biological sample consist of a "forward" primer having a sequence selected from the group of sequences: SEQ ID No. 15, SEQ ID No. 16, SEQ ID No. 17 for the RPL5 gene, SEQ ID No. 22 for the HNRNPA1 gene and SEQ ID No. 25, SEQ ID No. 26, for the HPRT1 gene and a "reverse" primer selected from the group of sequences: SEQ ID No. 15, SEQ ID No. 16, SEQ ID No. 17 for the RPL5 gene, SEQ ID No. 22 for the HNRNPA1 gene and SEQ ID No. 25, SEQ ID No. 26, for the HPRT1 gene.
5. Méthode selon la revendication 1, où une sonde pour détecter le transcrit des gènes contrôles normalisateurs dans un échantillon biologique, a une séquence SEQ ID N°21 pour le gène RPL5, SEQ ID N°24 pour le gèneHNRNPAl et SEQ ID N°29 pour le gène HPRT1.  5. Method according to claim 1, wherein a probe for detecting the transcript of normalizing control genes in a biological sample, has a sequence SEQ ID No. 21 for the gene RPL5, SEQ ID No. 24 for the geneHNRNPAl and SEQ ID No. 29 for the HPRT1 gene.
6. Méthode selon la revendication 1, où les gènes contrôles normalisateurs peuvent être utilisés soit individuellement (un seul gène comme normalisateur) ou bien ensembles (deux ou trois gènes comme normalisateur) permettant ainsi une augmentation en fiabilité et sensibilité de quantification des gènes PC A3, AMACR et TMPRSS2-ERG.  6. The method of claim 1, wherein the normalizing control genes can be used either individually (a single gene as normalizer) or together (two or three genes as normalizer) thus allowing an increase in reliability and quantification sensitivity PC A3 genes. , AMACR and TMPRSS2-ERG.
7. Méthode selon les revendications 1 à 6, où Les sondes pour détecter le transcrit des gènes cibles PC A3, AMACR et TMPRSS2-ERG et des gènes contrôles normalisateurs RPL5, HPRT1 et HNRNPA l en qPCR sont attachées à des entités fluorescentes (reporters) et des inhibiteurs de fluorescence (quenchers). Le reporteur peut être FAM, JOE ou YY ou similaires, attaché à l'extrémité 5' et l'inhibiteur de fluorescence (quencher) peut être BBQ, BHQ1, ou TAMRA ou similaires attaché à l'extrémité 3'.  7. The method according to claims 1 to 6, wherein the probes for detecting the transcript of PC A3, AMACR and TMPRSS2-ERG target genes and normalizing control genes RPL5, HPRT1 and HNRNPA l in qPCR are attached to fluorescent entities (reporters). and fluorescence inhibitors (quenchers). The reporter may be FAM, JOE or YY or the like, attached to the 5 'end and the fluorescence inhibitor (quencher) may be BBQ, BHQ1, or TAMRA or the like attached to the 3' end.
8. Méthode selon les revendications 1 à 7, où la détection des transcrits des gènes PC A3, AMACR et TMPRSS2-ERG et/ou des gènes contrôles normalisateurs RPL5, HPRT1 et HNRNPAl dans échantillon biologique est effectuée de façon séparée (format simplexe) ou simultanée dans un même puits de qPCR (format multiplex).  The method according to claims 1 to 7, wherein the detection of transcripts of PC A3, AMACR and TMPRSS2-ERG genes and / or normalizing control genes RPL5, HPRT1 and HNRNPA1 in biological sample is carried out separately (simplex format) or simultaneous in the same well of qPCR (multiplex format).
9. Méthode selon les revendications 1 à 8, où le degré d'expression est mesuré à l'échelle d'ARNm. 9. The method of claims 1 to 8, wherein the degree of expression is measured at the mRNA scale.
10. Méthode selon les revendications 1 à 9, où l'utilisation de ladite méthode comprend au moins une des techniques PCR, PCR en temps réel (qPCR) ou transcription inverse PCR (RT-PCR). The method according to claims 1 to 9, wherein the use of said method comprises at least one of PCR, real-time PCR (qPCR) or reverse transcription PCR (RT-PCR) techniques.
PCT/MA2015/000022 2014-10-17 2015-12-16 Probes and primers for the rapid and reliable quantification of the genes specific to prostate cancer, using suitable reference genes WO2016060537A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
MA37434A MA37434B1 (en) 2014-10-17 2014-10-17 Probes and primers for rapid and reliable quantification of prostate cancer-specific genes using adequate control genes
MA37434 2014-10-17

Publications (2)

Publication Number Publication Date
WO2016060537A2 true WO2016060537A2 (en) 2016-04-21
WO2016060537A3 WO2016060537A3 (en) 2016-09-29

Family

ID=55747527

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/MA2015/000022 WO2016060537A2 (en) 2014-10-17 2015-12-16 Probes and primers for the rapid and reliable quantification of the genes specific to prostate cancer, using suitable reference genes

Country Status (2)

Country Link
MA (1) MA37434B1 (en)
WO (1) WO2016060537A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106636000A (en) * 2016-12-23 2017-05-10 广东圣赛生物科技有限公司 hESCs-TK cell line and building method and application thereof
CN110628908A (en) * 2019-09-19 2019-12-31 北京恩泽康泰生物科技有限公司 Biomarker and detection kit for prostate cancer diagnosis grading and benign and malignant prediction

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102006032394B4 (en) * 2006-03-17 2011-07-07 Technische Universität Dresden, 01069 Method for diagnosis and differentiation of prostate cancer

Non-Patent Citations (30)

* Cited by examiner, † Cited by third party
Title
"Cancer Management Guidelines", January 2004, CANCER AGENCY, article "Tumour markers-assays: PSA-total and free.BC Cancer Agency"
ALTINTAS DM; ALLIOLI N; DECAUSSIN M; DE BERNARD S; RUFFION A; SAMARUT J ET AL.: "Differentially expressed androgen-regulated genes in androgensensitive tissues reveal potential biomarkers of early prostate cancer", PLOS ONE, vol. 8, 2013, pages E66278
BEUZEBOC P; SOULIÉ M; RICHAUD P; SALOMON L ET AL.: "Fusion genes and prostate cancer.From discovery to prognosis and therapeutic perspectives", PROGRÈS EN UROLOGIE, vol. 19, 2009, pages 819 - 824
BRAWER M K; CHETNER M P; BEATIE J ET AL.: "Screening for prostaticcarcinomawith PSA", J UROI, vol. 147, 1992, pages 841 - 845
BRAWER, M.K.; CHETNER, M.P.; BEATIE, J.; BUCHNER, D.M.; VESSELLA, R.L.; LANGE, P.H: "Screening for prostaticcarcinomawith prostate specificantigen", J. UROL., vol. 147, 1992, pages 841 - 845
BUSSEMAKERS MJ; VAN BOKHOVEN A; VERHAEGH GW; SMIT FP; KARTHAUS HF; SCHALKEN JA ET AL.: "DD3: a new prostate-specific gene, highly overexpressed in prostate cancer", CANCER RES, vol. 59, 1999, pages 5975 - 9
CATALONA, W.J.; SMITH, D.S.; ORNSTEIN, D.K: "Prostate cancer detection in men with serum psa concentrations of 2.6 to 4.0 ng/mL and benign prostate examination. Enhancement of specificitywith free psameasurements", JAMA, vol. 277, 1997, pages 1452 - 1455
FERLAY J; SHIN HR; BRAY F ET AL.: "GLOBOCAN 2008, Cancer incidence and mortality worldwide: IARC CancerBase No. 10", 2010, INTERNATIONAL AGENCY FOR RESEARCH ON CANCER
GANDINI, O.; LUCI, L.; STIGLIANO, A.; LUCERA, R.; DI SILVERIO, F.; TOSCANO, V.; CARDILLO, M. R: "Is DD3 a new prostate-specific gene?", ANTICANCERRES., vol. 23, no. 1A, 2003, pages 305 - 308, XP009032063
GROSKOPF J; AUBIN SM; DERAS IL; BLASE A; BODRUG S; CLARK C ET AL.: "APTIMA PCA3 molecular urine test: development of a method to aid in the diagnosis of prostate cancer", CLIN CHEM, vol. 52, 2006, pages 1089 - 95
HESSELS D; FRANK PS; GERALD WV ET AL.: "Detection of TMPRSS2-ERG Fusion Transcripts and Prostate Cancer Antigen 3 in Urinary Sediments May Improve Diagnosis of Prostate Cancer", CLIN CANCER RES, vol. 13, 2007, pages 5103 - 5108
HESSELS D; FRANK PS; GERALD WV ET AL.: "Détection of TMPRSS2-ERG Fusion Transcripts and Prostate Cancer Antigen 3 in Urinary Sediments May Improve Diagnosis of Prostate Cancer", CLIN CANCER RES, vol. 13, 2007, pages 5103 - 5108
HESSELS D; KLEIN GUNNEWIEK JM; VAN OORT L; KARTHAUS HF; VAN LEENDERS GJ; VAN BALKEN B ET AL.: "DD3(PCA3)-based molecular urine analysis for the diagnosis of prostate cancer", EURUROL, vol. 44, 2003, pages 8 - 15
HESSELS D; SCHALKEN JA: "The use of PCA3 in the diagnosis of prostate cancer", NAT REVUROL, vol. 6, 2009, pages 255 - 61, XP009132139
HO-PUN-CHEUNG A; CELLIER D; LOPEZ-CRAPEZ E: "Considerations for normalisation of RT-qPCR in oncology", ANN BIOL CLIN (PARIS, vol. 66, 2008, pages 121 - 129
JIANG Z; WODA B; WU C ET AL.: "Discovery and clinical application of a novel prostate cancer marker", AM J CLINPATHOL., vol. 122, 2004, pages 275 - 289, XP055184230, DOI: doi:10.1309/EJUYUQPEX1MG68MK
KLEIN, DIETER, LN TRENDS IN MOLECULARMEDICINE, vol. 8, no. 6, 2002, pages 257 - 260
LETRAN JL; BLASÉ AB; LOBERIZA FR ET AL.: "Repeat ultrasound guided prostate needle biopsy : use of free to total PSA ratio in predicting prostatic carcnoma. 7", J. UROL, vol. 60, 1998, pages 426 - 9
MEHRA R; TOMLINS SA; YU J; CAO X; WANG L; MENON A ET AL.: "Characterization of TMPRSS2-ETS gene aberrations in androgen-independent metastatic prostate cancer", CANCER RES, vol. 68, 2008, pages 3584 - 90, XP055252069, DOI: doi:10.1158/0008-5472.CAN-07-6154
OHL F; JUNG M; XU C; STEPHAN C; RABIEN A; BURKHARDT M; NITSCHE A; KRISTIANSEN G; RADONIC A; JUNG K: "Gene expression studies in prostate cancer tissue: whichreferencegeneshouldbeselected?", J MOL MED, vol. 83, 2005, pages 1014 - 1024, XP019320313, DOI: doi:10.1007/s00109-005-0703-z
OUYANG B; BRACKEN B; BURKE B; CHUNG E; LIANG J; HO SM: "Aduplex quantitative polymerase chain reaction assay basedon quantification of alpha-methylacyl-CoA racemase transcriptsand prostate cancer antigen 3 in urine sedimentsimproved diagnostic accuracy for prostate cancer", J URO1, vol. 181, 2009, pages 2508 - 13
PETTERSSON A; GRAFF RE; BAUER SR; PITT MJ; LIS RT; STACK EC ET AL.: "The TMPRSS2:ERG rearrangement, ERG expression, and prostate cancer outcomes: a cohort study and meta-analysis", CANCER EPIDEMIOLBIOMARKERSPREV, vol. 21, 2012, pages 1497 - 509
PLATZ EA; GIOVANNUCCI E: "Cancer epidemiology and prevention", 2006, OXFORD UNIVERSITY PRESS, article "Prostate cancer", pages: 1128 - 50
SALAGIERSKIMACIEJ; JACK A: "Schalken.PCA3 and TMPRSS2-ERG: Promising Biomarkers in Prostate Cancer Diagnosis", CANCERS, vol. 2, 2010, pages 1432 - 1440
SCHALKEN JA; HESSELS D; VERHAEGH G: "New targets for therapy in prostate cancer: differential display code 3 (DD3(PCA3)), a highly prostate cancer-specific gene", UROLOGY, vol. 62, 2003, pages 34 - 43, XP002578236, DOI: doi:10.1016/S0090-4295(03)00759-3
SOKOILU; ELLIS W; LANGE P; NOTEBOOM J; ELLIOTT DJ; DERAS IL ET AL.: "A multicenter evaluation of the PCA3 molecular urine test: pre-analytical effects, analytical performance, and diagnostic accuracy", CLIN CHIM ACTA, vol. 389, 2008, pages 1 - 6
THOMPSON IM; ANKERST DP; CHI C ET AL.: "Operating characteristics of prostate-specific antigen in men with an initial PSA level of 3.0 ng/mL or lower", JAMA, vol. 294, no. 1, 2005, pages 66 - 70
TOMLINS SA; AUBIN SM; SIDDIQUI J; LONIGRO RJ; SEFTON-MILLER L; MIICK S ET AL.: "Urine TMPRSS2:ERG fusion transcript stratifies prostate cancer risk in men with elevated serum PSA", SCITRANSL MED, vol. 3, 2011, pages 94 - 72
TOMLINS SA; BJARTELL A; CHINNAIYAN AM; JENSTER G; NAM RK; RUBIN MA ET AL.: "ETS gene fusions in prostate cancer: from discovery to daily clinical practice", EURUROL, vol. 56, 2009, pages 275 - 86, XP026320082, DOI: doi:10.1016/j.eururo.2009.04.036
VARMA M; JASANI B: "Diagnostic utility of immunohistochemistry in morphologically difficult prostate cancer: review of current literature", HISTOPATHOL., vol. 47, 2005, pages 1 - 16

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106636000A (en) * 2016-12-23 2017-05-10 广东圣赛生物科技有限公司 hESCs-TK cell line and building method and application thereof
CN110628908A (en) * 2019-09-19 2019-12-31 北京恩泽康泰生物科技有限公司 Biomarker and detection kit for prostate cancer diagnosis grading and benign and malignant prediction
CN110628908B (en) * 2019-09-19 2022-05-10 北京恩泽康泰生物科技有限公司 Biomarker and detection kit for prostate cancer diagnosis grading and benign and malignant prediction

Also Published As

Publication number Publication date
WO2016060537A3 (en) 2016-09-29
MA37434A1 (en) 2016-05-31
MA37434B1 (en) 2017-01-31

Similar Documents

Publication Publication Date Title
US20210246515A1 (en) COMBINATION OF mRNA EXPRESSION LEVELS OF DLX1 AND HOXC6 IN URINE AS MOLECULAR MARKERS IN PROSTATE CANCER
RU2491289C2 (en) Polynucleotide primers
CA2739140A1 (en) Molecular markers in prostate cancer
NO340089B1 (en) A method for diagnosing an oropharyngeal squamous cell carcinoma (OSCC) in an individual by detecting a biomarker selected from the group consisting of IL8, IL1B, DUSP1, H3F3A, OAZ1, S100P and SAT in cell-free saliva
AU2013281355B2 (en) Targeted RNA-seq methods and materials for the diagnosis of prostate cancer
JP2010530761A (en) Separation of long fragment RNA from a fixed sample
FR2892730A1 (en) Detecting the presence/risk of cancer development in a mammal, comprises detecting the presence/absence or (relative) quantity e.g. of nucleic acids and/or polypeptides coded by the nucleic acids, which indicates the presence/risk
JP2012100628A (en) Method for sensitive detection of eml4-alk fused gene
CA2835728A1 (en) Molecular markers in prostate cancer
CA2979226A1 (en) Whole blood based mrna markers for predicting prostate cancer and methods of detecting the same
EP1294941B1 (en) Method for in vitro diagnosis of prostatic cancer and kit therefor
CA2500861A1 (en) Method for diagnosing prostate cancer
Avgeris et al. Expression analysis and clinical utility of L-Dopa decarboxylase (DDC) in prostate cancer
Fallahabadi et al. Frequency of PTEN alterations, TMPRSS2-ERG fusion and their association in prostate cancer
WO2016060537A2 (en) Probes and primers for the rapid and reliable quantification of the genes specific to prostate cancer, using suitable reference genes
WO2015133911A1 (en) Gene expression profiling for the diagnosis of prostate cancers
EP2635705B1 (en) Method of screening for colorectal cancer
Zhang et al. High frequency of the SDK1: AMACR fusion transcript in Chinese prostate cancer
JP2019531738A (en) Indoleamine-2,3-dioxygenase assay for the diagnosis and prognosis of prostate cancer
RU2374647C1 (en) Diagnostic technique for colon cancer and kit for implementing thereof
US20140106363A1 (en) Molecular markers in prostate cancer
KR20070116567A (en) Detection of lymph node metastasis from gastric carcinoma
US20090155786A1 (en) Compositions and methods for detecting markers of cancer
RU2688181C1 (en) Method for prediction of response time to androgen deprivation therapy in patients with prostate cancer
da Silva Next Generation Sequencing of a Custom Gene Panel to Improve the Diagnosis of Patients with Inherited Predisposition to Colorectal Polyposis

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15849842

Country of ref document: EP

Kind code of ref document: A2